Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
12-64849613-CTC-TTT c.-31-7_-31-5delCTCinsTTT splice_region TBK1 1 82100 1.21803E-5 41050 0 NA
12-64849616-T-G c.-31-4T>G splice_region TBK1 3 82322 3.64423E-5 41161 0 NA
12-64849618-AG-TT c.-31-2_-31-1delAGinsTT splice_acceptor TBK1 1 82330 1.21462E-5 41165 0 NA
12-64849621-A-G c.-30A>G 5_prime_UTR_premature_start_codon_gain TBK1 3 82546 3.63434E-5 41273 0 2.26404E-5
12-64849621-A-C c.-30A>C splice_region TBK1 1 82546 1.21145E-5 41273 0 6.37714E-5
12-64849654-C-T p.Gln2* stop_gained TBK1 1 83124 1.20302E-5 41562 0 NA
12-64849656-G-C p.Gln2His missense TBK1 1 83130 1.20294E-5 41565 0 4.04102E-6
12-64849659-C-T p.Ser3Ser synonymous TBK1 68 83130 8.17996E-4 41565 0 0.00207059
12-64849665-T-C p.Ser5Ser synonymous TBK1 1 83152 1.20262E-5 41576 0 8.28075E-6
12-64849668-T-C p.Asn6Asn synonymous TBK1 1 83176 1.20227E-5 41588 0 3.99186E-6
12-64849684-T-G p.Ser12Ala missense TBK1 2 83214 2.40344E-5 41607 0 2.38852E-5
12-64849701-A-G p.Gln17Gln synonymous TBK1 1 83232 1.20146E-5 41616 0 1.19463E-5
12-64849710-T-C p.Thr20Thr synonymous TBK1 1 83216 1.20169E-5 41608 0 NA
12-64849714-A-C p.Asn22His missense TBK1 5 83206 6.00918E-5 41603 0 3.98457E-6
12-64849714-A-G p.Asn22Asp missense TBK1 1 83206 1.20184E-5 41603 0 3.98457E-6
12-64849716-T-C p.Asn22Asn synonymous TBK1 2666 83128 0.032071 41564 61 0.0332246
12-64849723-C-T p.Arg25Cys missense TBK1 2 83146 2.40541E-5 41573 0 3.18634E-5
12-64849724-G-A p.Arg25His missense TBK1 1 83160 1.2025E-5 41580 0 NA
12-64849731-A-T p.Arg27Ser missense TBK1 1 83134 1.20288E-5 41567 0 NA
12-64849745-C-T c.87+8C>T splice_region TBK1 4 83032 4.81742E-5 41516 0 2.02252E-4
12-64853965-A-G c.88-4A>G splice_region TBK1 2 80304 2.49054E-5 40152 0 3.19081E-5
12-64853975-G-A p.Gly32Ser missense TBK1 1 80654 1.23986E-5 40327 0 NA
12-64853989-T-C p.Ala36Ala synonymous TBK1 1 81204 1.23147E-5 40602 0 3.06024E-4
12-64854006-A-G p.Asn42Ser missense TBK1 1 82036 1.21898E-5 41018 0 0.00101523
12-64854009-T-G p.Ile43Arg missense TBK1 2 82124 2.43534E-5 41062 0 8.77178E-6
12-64854016-C-T p.Phe45Phe synonymous TBK1 88 82248 0.00106993 41124 0 0.00103741
12-64854048-T-A p.Phe56Tyr missense TBK1 1 82356 1.21424E-5 41178 0 NA
12-64854056-T-C p.Leu59Leu synonymous TBK1 6 82264 7.29359E-5 41132 0 6.37146E-5
12-64854058-G-C p.Leu59Phe missense TBK1 1 82252 1.21578E-5 41126 0 NA
12-64854067-C-T p.Leu62Leu synonymous TBK1 1 82108 1.21791E-5 41054 0 4.30207E-6
12-64854082-T-C p.Ile67Ile synonymous TBK1 14 81828 1.71091E-4 40914 0 3.50408E-4
12-64854098-A-G p.Ile73Val missense TBK1 3 81818 3.66667E-5 40909 0 4.89041E-5
12-64854104-G-A p.Glu75Lys missense TBK1 1 81762 1.22306E-5 40881 0 8.39659E-6
12-64854106-G-A p.Glu75Glu synonymous TBK1 2 81550 2.45248E-5 40775 0 NA
12-64858113-GACA-G p.Thr79del disruptive_inframe_deletion TBK1 1 82164 1.21708E-5 41082 0 8.28926E-6
12-64858116-A-G p.Thr77Thr splice_region+synonymous TBK1 1 82404 1.21353E-5 41202 0 NA
12-64858120-A-G p.Thr79Ala missense TBK1 3 82474 3.63751E-5 41237 0 NA
12-64858121-C-T p.Thr79Ile missense TBK1 1 82384 1.21383E-5 41192 0 3.25436E-5
12-64858143-G-A p.Met86Ile missense TBK1 2 82892 2.41278E-5 41446 0 NA
12-64858146-A-G p.Glu87Glu synonymous TBK1 3 82932 3.61742E-5 41466 0 8.26105E-6
12-64858154-C-T p.Pro90Leu missense TBK1 1 82956 1.20546E-5 41478 0 NA
12-64858171-A-G p.Thr96Ala missense TBK1 1 83012 1.20465E-5 41506 0 NA
12-64858175-T-A p.Val97Asp missense TBK1 1 83022 1.2045E-5 41511 0 NA
12-64858177-T-G p.Leu98Val missense+splice_region TBK1 1 83016 1.20459E-5 41508 0 NA
12-64858186-C-T p.Pro101Ser missense TBK1 1 82946 1.2056E-5 41473 0 8.2447E-6
12-64858188-T-G p.Pro101Pro synonymous TBK1 3 82964 3.61603E-5 41482 0 NA
12-64858197-C-G p.Ala104Ala synonymous TBK1 1 82898 1.2063E-5 41449 0 NA
12-64858199-A-G p.Tyr105Cys missense TBK1 1 82828 1.20732E-5 41414 0 4.00731E-6
12-64858225-A-G p.Ile114Val missense TBK1 1 82490 1.21227E-5 41245 0 NA
12-64858234-C-T p.Arg117* stop_gained TBK1 1 82246 1.21586E-5 41123 0 8.33729E-6
12-64858246-ATGTT-A c.358+4_358+7delTGTT splice_region TBK1 24 82150 2.92148E-4 41075 0 7.33325E-4
12-64858247-T-C c.358+4T>C splice_region TBK1 2 82120 2.43546E-5 41060 0 2.32338E-4
12-64860700-A-G p.Leu126Leu synonymous TBK1 5 82340 6.07238E-5 41170 0 2.23072E-4
12-64860701-C-T p.Arg127* stop_gained TBK1 1 82278 1.21539E-5 41139 0 NA
12-64860703-A-C p.Arg127Arg synonymous TBK1 2 82372 2.42801E-5 41186 0 3.18593E-5
12-64860703-A-T p.Arg127Arg synonymous TBK1 1 82374 1.21398E-5 41187 0 NA
12-64860706-G-A p.Glu128Glu synonymous TBK1 1 82696 1.20925E-5 41348 0 NA
12-64860717-T-A p.Val132Glu missense TBK1 1 83146 1.2027E-5 41573 0 4.01349E-6
12-64860723-G-A p.Arg134His missense TBK1 1 83166 1.20241E-5 41583 0 3.18878E-5
12-64860724-T-C p.Arg134Arg synonymous TBK1 1 83192 1.20204E-5 41596 0 NA
12-64860750-G-A p.Arg143His missense TBK1 1 83228 1.20152E-5 41614 0 3.18654E-5
12-64860752-G-A p.Val144Ile missense TBK1 1 83234 1.20143E-5 41617 0 8.23873E-6
12-64860755-A-G p.Ile145Val missense TBK1 1 83218 1.20166E-5 41609 0 8.23886E-6
12-64860759-G-C p.Gly146Ala missense TBK1 1 83244 1.20129E-5 41622 0 8.23859E-6
12-64860760-G-A p.Gly146Gly synonymous TBK1 3 83242 3.60395E-5 41621 0 8.23818E-6
12-64860761-G-A p.Glu147Lys missense TBK1 1 83236 1.2014E-5 41618 0 1.15335E-4
12-64860774-C-T p.Ser151Phe missense TBK1 6 83236 7.20842E-5 41618 0 2.3964E-5
12-64860774-C-G p.Ser151Cys missense TBK1 1 83236 1.2014E-5 41618 0 7.98799E-6
12-64860776-G-C p.Val152Leu missense TBK1 12 83246 1.44151E-4 41623 0 2.79664E-5
12-64860778-G-T p.Val152Val synonymous TBK1 3 83240 3.60404E-5 41620 0 1.64756E-5
12-64860799-T-G p.Gly159Gly synonymous TBK1 1 83222 1.20161E-5 41611 0 NA
12-64860828-A-G p.Gln169Arg missense TBK1 1 83118 1.20311E-5 41559 0 4.07242E-6
12-64860835-T-C p.Val171Val synonymous TBK1 1 83066 1.20386E-5 41533 0 4.05328E-6
12-64860841-G-A p.Leu173Leu synonymous TBK1 104 83008 0.00125289 41504 0 0.00315407
12-64860857-T-C p.Tyr179His missense TBK1 1 82182 1.21681E-5 41091 0 NA
12-64860863-G-A c.540+1G>A splice_donor TBK1 1 81408 1.22838E-5 40704 0 4.4613E-6
12-64860864-T-TTCA c.540+2_540+3insTCA splice_region TBK1 1 81290 1.23016E-5 40645 0 NA
12-64860869-C-A c.540+7C>A splice_region TBK1 1 80896 1.23616E-5 40448 0 NA
12-64860869-C-CATA c.540+7_540+8insATA splice_region TBK1 1 80892 1.23622E-5 40446 0 NA
12-64868002-A-C c.541-8A>C splice_region TBK1 1 82538 1.21156E-5 41269 0 NA
12-64868004-T-G c.541-6T>G splice_region TBK1 1 82588 1.21083E-5 41294 0 NA
12-64868005-C-G c.541-5C>G splice_region TBK1 1 82614 1.21045E-5 41307 0 NA
12-64868032-C-T p.Ala188Val missense TBK1 1 82948 1.20557E-5 41474 0 NA
12-64868054-G-A p.Gln195Gln synonymous TBK1 1 83156 1.20256E-5 41578 0 8.23859E-6
12-64868089-T-C p.Ile207Thr missense TBK1 7 83240 8.40942E-5 41620 0 9.56511E-5
12-64868099-A-T p.Thr210Thr synonymous TBK1 15 83252 1.80176E-4 41626 0 0.00625
12-64868108-T-G p.His213Gln missense TBK1 1 83266 1.20097E-5 41633 0 NA
12-64868152-G-A p.Arg228His missense TBK1 2 83184 2.40431E-5 41592 0 3.18776E-5
12-64868154-A-G p.Arg229Gly missense TBK1 1 83182 1.20218E-5 41591 0 NA
12-64873813-G-A p.Lys241Lys synonymous TBK1 1 83116 1.20314E-5 41558 0 1.65049E-5
12-64873818-C-A p.Ser243Tyr missense TBK1 1 83138 1.20282E-5 41569 0 NA
12-64873835-G-A p.Val249Ile missense TBK1 1 83182 1.20218E-5 41591 0 3.18695E-5
12-64873860-T-C p.Ile257Thr missense TBK1 1 83212 1.20175E-5 41606 0 3.98807E-6
12-64873869-G-A p.Ser260Asn missense TBK1 1 83216 1.20169E-5 41608 0 8.24266E-6
12-64873892-A-G p.Ser268Gly missense TBK1 3 83180 3.60664E-5 41590 0 1.6506E-5
12-64873901-C-CGG p.Ser268fs frameshift TBK1 1 83156 1.20256E-5 41578 0 NA
12-64873902-G-A p.Arg271Gln missense+splice_region TBK1 7 83148 8.41872E-5 41574 0 5.04032E-4
12-64873903-G-GGGTCTTCAGGTTCTACTTACCCCTGTTCTTGCAAACATCCT c.812+1_812+2insGGTCTTCAGGTTCTACTTACCCCTGTTCTTGCAAACATCCT splice_donor TBK1 1 83136 1.20285E-5 41568 0 NA
12-64873903-G-GGGTCTTCAGGTTCTACTTACCCCTGTTCTTGCAAACA c.812+1_812+2insGGTCTTCAGGTTCTACTTACCCCTGTTCTTGCAAACA splice_donor TBK1 2 83136 2.4057E-5 41568 1 NA
12-64873903-G-GGGTCTTCAGGTTCTACTTACCCCTGTTCT c.812+1_812+2insGGTCTTCAGGTTCTACTTACCCCTGTTCT splice_donor TBK1 1 83136 1.20285E-5 41568 0 NA
12-64873903-G-GGGTCTTCAGGTTC c.812+1_812+2insGGTCTTCAGGTTC splice_donor TBK1 2 83136 2.4057E-5 41568 1 NA
12-64875615-A-C c.813-7A>C splice_region TBK1 5 81696 6.12025E-5 40848 0 3.18451E-5
12-64875625-T-G p.Gly272Gly synonymous TBK1 2 82222 2.43244E-5 41111 0 3.18654E-5
12-64875638-C-G p.Leu277Val missense TBK1 2 82800 2.41546E-5 41400 0 1.23877E-5
12-64875641-ACCCCTGTT-A p.Pro279fs frameshift TBK1 1 82820 1.20744E-5 41410 0 4.12909E-6
12-64875644-C-G p.Pro279Ala missense TBK1 1 82936 1.20575E-5 41468 0 NA
12-64875647-G-C p.Val280Leu missense TBK1 1 82964 1.20534E-5 41482 0 NA
12-64875665-G-C p.Glu286Gln missense TBK1 1 83028 1.20441E-5 41514 0 NA
12-64875673-T-C p.Asp288Asp synonymous TBK1 1 83052 1.20406E-5 41526 0 NA
12-64875680-A-G p.Lys291Glu missense TBK1 5 83054 6.02018E-5 41527 0 1.91046E-4
12-64875722-A-G p.Ile305Val missense TBK1 1 83122 1.20305E-5 41561 0 8.26651E-6
12-64875725-C-A p.Leu306Ile missense TBK1 33 83106 3.97083E-4 41553 0 3.14073E-4
12-64875726-T-C p.Leu306Pro missense TBK1 1 83078 1.20369E-5 41539 0 NA
12-64875731-C-T p.Arg308* stop_gained TBK1 2 83048 2.40825E-5 41524 0 NA
12-64875735-T-C p.Met309Thr missense TBK1 1 83028 1.20441E-5 41514 0 4.04773E-6
12-64875741-T-C p.Ile311Thr missense TBK1 1 83012 1.20465E-5 41506 0 NA
12-64875744-A-G p.His312Arg missense TBK1 2 82992 2.40987E-5 41496 0 4.05811E-6
12-64875754-G-A p.Ser315Ser synonymous TBK1 1 82894 1.20636E-5 41447 0 8.17548E-6
12-64875762-A-G p.Gln318Arg missense TBK1 1 82890 1.20642E-5 41445 0 NA
12-64875767-A-G p.Thr320Ala missense TBK1 1 82716 1.20896E-5 41358 0 NA
12-64875771-C-T p.Ala321Val missense TBK1 3 82566 3.63346E-5 41283 0 8.41071E-6
12-64875773-C-G p.His322Asp missense TBK1 1 82506 1.21203E-5 41253 0 NA
12-64875773-C-T p.His322Tyr missense TBK1 20 82502 2.42418E-4 41251 0 5.22572E-4
12-64875774-A-T p.His322Leu missense TBK1 3 82480 3.63725E-5 41240 0 4.17795E-6
12-64875775-T-TC p.Lys323fs frameshift TBK1 1 82436 1.21306E-5 41218 0 NA
12-64875777-A-ATGAATAAG p.Lys323fs frameshift TBK1 1 82390 1.21374E-5 41195 0 NA
12-64875787-T-A p.Ile326Ile synonymous TBK1 33355 75818 0.439935 37909 7178 0.481421
12-64875787-T-TAGATTAATTTAAAAAATTTAA p.Ile326_His327insArgLeuIleTerLysIleTer stop_gained TBK1 1 81844 1.22184E-5 40922 0 NA
12-64875788-C-A p.His327Asn missense TBK1 1 81630 1.22504E-5 40815 0 NA
12-64875801-C-T p.Thr331Ile missense+splice_region TBK1 4 80814 4.94964E-5 40407 0 0.00100705
12-64878086-T-A p.Ala332Ala synonymous TBK1 1 82802 1.2077E-5 41401 0 2.01313E-5
12-64878090-A-G p.Ile334Val missense TBK1 1 82866 1.20677E-5 41433 0 4.9141E-5
12-64878107-A-G p.Val339Val synonymous TBK1 1 83052 1.20406E-5 41526 0 4.0015E-6
12-64878118-C-G p.Thr343Ser missense TBK1 3 83110 3.60967E-5 41555 0 1.77696E-5
12-64878127-T-C p.Ile346Thr missense TBK1 3 83150 3.60794E-5 41575 0 8.73042E-6
12-64878147-A-G p.Ile353Val missense TBK1 3 83202 3.60568E-5 41601 0 6.36943E-5
12-64878148-T-C p.Ile353Thr missense TBK1 2 83200 2.40385E-5 41600 0 1.68265E-5
12-64878152-C-T p.Tyr354Tyr synonymous TBK1 19 83210 2.28338E-4 41605 0 6.36983E-5
12-64878159-C-T p.Arg357* stop_gained TBK1 1 83232 1.20146E-5 41616 0 7.96629E-6
12-64878163-G-A p.Arg358His missense TBK1 6 83250 7.20721E-5 41625 0 5.03525E-4
12-64878172-T-C p.Leu361Ser missense TBK1 1 83260 1.20106E-5 41630 0 NA
12-64878181-G-A p.Gly364Glu missense TBK1 2 83270 2.40183E-5 41635 0 2.38798E-5
12-64878185-G-C p.Arg365Ser missense TBK1 1 83266 1.20097E-5 41633 0 8.27253E-6
12-64878195-C-A p.His369Asn missense TBK1 1 83282 1.20074E-5 41641 0 2.47991E-5
12-64878200-C-T p.Phe370Phe synonymous TBK1 151 83288 0.00181299 41644 0 0.00171909
12-64878206-A-G p.Lys372Lys synonymous TBK1 7 83290 8.40437E-5 41645 0 2.47926E-5
12-64878207-A-C p.Thr373Pro missense TBK1 1 83288 1.20065E-5 41644 0 NA
12-64878225-A-G p.Ile379Val missense TBK1 4 83268 4.80377E-5 41634 0 5.57351E-5
12-64878241-G-A p.Arg384Gln missense TBK1 12 83220 1.44196E-4 41610 0 1.27429E-4
12-64878266-A-G p.Leu392Leu synonymous TBK1 8 82948 9.6446E-5 41474 0 6.33714E-4
12-64878269-A-G p.Ile393Met missense TBK1 16 82904 1.92994E-4 41452 0 1.9101E-4
12-64878270-T-G p.Tyr394Asp missense TBK1 3 82874 3.61995E-5 41437 0 4.38035E-6
12-64878276-A-G p.Lys396Glu missense TBK1 1 82722 1.20887E-5 41361 0 3.18492E-5
12-64879235-T-C p.Ile397Thr missense+splice_region TBK1 26 80256 3.23963E-4 40128 1 0.00252016
12-64879252-C-T p.His403Tyr missense TBK1 2 80972 2.46999E-5 40486 0 4.82532E-5
12-64879254-T-C p.His403His synonymous TBK1 1 81012 1.23439E-5 40506 0 4.34805E-6
12-64879262-A-G p.Tyr406Cys missense TBK1 2 81124 2.46536E-5 40562 0 NA
12-64879272-C-T p.Asp409Asp synonymous TBK1 16 80956 1.97638E-4 40478 0 0.00252016
12-64879273-G-A p.Gly410Arg missense TBK1 1 80968 1.23506E-5 40484 0 3.18857E-5
12-64879294-G-GCAATAACAGGGGTTGTGTGTTATGCCTGCAGAATTGCCAGTACC c.1248+1_1248+2insCAATAACAGGGGTTGTGTGTTATGCCTGCAGAATTGCCAGTACC splice_donor TBK1 1 80706 1.23907E-5 40353 0 NA
12-64879707-C-T p.Ala417Val missense+splice_region TBK1 2 81718 2.44744E-5 40859 0 3.77501E-5
12-64879707-C-A p.Ala417Glu missense+splice_region TBK1 2 81718 2.44744E-5 40859 0 6.37471E-5
12-64879709-A-G p.Ile418Val missense TBK1 2 81796 2.44511E-5 40898 0 6.36902E-5
12-64879711-A-T p.Ile418Ile synonymous TBK1 2 81956 2.44033E-5 40978 0 NA
12-64879713-CAG-C p.Val421fs frameshift TBK1 1 81888 1.22118E-5 40944 0 3.18817E-5
12-64879718-G-A p.Val421Ile missense TBK1 1 82166 1.21705E-5 41083 0 2.21779E-5
12-64879718-G-C p.Val421Leu missense TBK1 2 82166 2.4341E-5 41083 0 3.30885E-5
12-64879719-TTG-T p.Cys423fs frameshift TBK1 1 82184 1.21678E-5 41092 0 4.44381E-6
12-64879776-G-A p.Arg440Gln missense TBK1 4 82280 4.86145E-5 41140 0 1.30591E-5
12-64879781-G-A p.Gly442Arg missense TBK1 1 82262 1.21563E-5 41131 0 NA
12-64879783-G-A p.Gly442Gly synonymous TBK1 1 82220 1.21625E-5 41110 0 NA
12-64879787-C-T p.Arg444* stop_gained TBK1 2 82142 2.43481E-5 41071 0 1.33584E-5
12-64882266-G-A c.1341-1G>A splice_acceptor TBK1 1 81606 1.2254E-5 40803 0 NA
12-64882268-GAATT-G p.Ile450fs frameshift TBK1 1 81752 1.22321E-5 40876 0 5.04959E-6
12-64882285-T-G p.Asp453Glu missense TBK1 1 82566 1.21115E-5 41283 0 NA
12-64882290-A-G p.Asn455Ser missense TBK1 1 82734 1.20869E-5 41367 0 3.18431E-5
12-64882295-A-G p.Thr457Ala missense TBK1 1 82846 1.20706E-5 41423 0 3.18492E-5
12-64882297-T-C p.Thr457Thr synonymous TBK1 1 82866 1.20677E-5 41433 0 NA
12-64882298-G-A p.Val458Ile missense TBK1 1 82898 1.2063E-5 41449 0 4.19815E-6
12-64882311-CAG-C p.Glu463fs frameshift TBK1 4 82998 4.81939E-5 41499 0 4.15248E-6
12-64882317-T-C p.Val464Ala missense TBK1 1142 83000 0.013759 41500 13 0.0162051
12-64882319-G-T p.Val465Leu missense TBK1 1 83044 1.20418E-5 41522 0 2.07905E-5
12-64882338-G-C p.Cys471Ser missense TBK1 2 83108 2.40651E-5 41554 0 NA
12-64882348-C-T p.Asn474Asn synonymous TBK1 1 83064 1.20389E-5 41532 0 1.11185E-5
12-64882375-A-G c.1442+7A>G splice_region TBK1 1 82900 1.20627E-5 41450 0 NA
12-64883821-A-C p.Val481Val splice_region+synonymous TBK1 1 82230 1.2161E-5 41115 0 NA
12-64883821-A-T p.Val481Val splice_region+synonymous TBK1 2 82230 2.4322E-5 41115 0 8.15102E-6
12-64883824-T-G p.Tyr482* stop_gained TBK1 2 82308 2.4299E-5 41154 0 NA
12-64883824-T-C p.Tyr482Tyr synonymous TBK1 1 82308 1.21495E-5 41154 0 4.06762E-6
12-64883835-T-A p.Met486Lys missense TBK1 1 82478 1.21244E-5 41239 0 NA
12-64883836-G-A p.Met486Ile missense TBK1 1 82500 1.21212E-5 41250 0 NA
12-64883849-G-A p.Glu491Lys missense TBK1 1 82666 1.20969E-5 41333 0 NA
12-64883856-C-T p.Ala493Val missense TBK1 1 82754 1.2084E-5 41377 0 NA
12-64883857-A-G p.Ala493Ala synonymous TBK1 1 82766 1.20823E-5 41383 0 3.18634E-5
12-64883871-T-G p.Ile498Ser missense TBK1 1 82878 1.20659E-5 41439 0 NA
12-64883884-C-T p.His502His synonymous TBK1 1 82908 1.20616E-5 41454 0 NA
12-64883886-C-T p.Thr503Ile missense TBK1 3 82894 3.61908E-5 41447 0 1.8354E-5
12-64883898-G-GACTTTCC p.Ile501fs frameshift TBK1 2 82876 2.41324E-5 41438 0 NA
12-64883898-G-T p.Arg507Ile missense+splice_region TBK1 1 82878 1.20659E-5 41439 0 3.18552E-5
12-64889263-C-A p.Leu508Ile missense+splice_region TBK1 87 82520 0.00105429 41260 0 0.00223001
12-64889279-G-A p.Gly513Glu missense TBK1 1 82614 1.21045E-5 41307 0 8.24348E-6
12-64889295-T-C p.Ser518Ser synonymous TBK1 5 82692 6.04653E-5 41346 0 3.29592E-5
12-64889307-C-T p.Ile522Ile synonymous TBK1 8 82770 9.66534E-5 41385 0 1.27478E-4
12-64889307-C-G p.Ile522Met missense TBK1 4 82770 4.83267E-5 41385 0 2.4717E-5
12-64889308-G-A p.Asp523Asn missense TBK1 3 82786 3.6238E-5 41393 0 4.94332E-5
12-64889320-T-A p.Ser527Thr missense TBK1 2 82854 2.41388E-5 41427 0 NA
12-64889321-C-G p.Ser527Cys missense TBK1 1 82858 1.20688E-5 41429 0 3.98108E-6
12-64889325-A-G p.Pro528Pro synonymous TBK1 2 82890 2.41284E-5 41445 0 NA
12-64889343-C-T p.Asp534Asp synonymous TBK1 2 83000 2.40964E-5 41500 0 1.99022E-5
12-64889344-G-A p.Ala535Thr missense TBK1 4 82996 4.81951E-5 41498 0 8.75719E-5
12-64889360-A-T p.Glu540Val missense TBK1 2 83090 2.40703E-5 41545 0 3.98115E-6
12-64889372-C-T p.Pro544Leu missense TBK1 2 83118 2.40622E-5 41559 0 4.94266E-5
12-64889384-AGTAGGTTATAGCTTTATGCGTAGTTTCTGCTCTTATTAATGTCCTTTTTCACATTGACTCAGTTAATTTATTTGAGTTTTTCTTCCTTAAATAG-A c.1643+1_1644-1delGTAGGTTATAGCTTTATGCGTAGTTTCTGCTCTTATTAATGTCCTTTTTCACATTGACTCAGTTAATTTATTTGAGTTTTTCTTCCTTAAATAG splice_acceptor TBK1 15 83152 1.80393E-4 41576 7 NA
12-64889471-TTAAA-T c.1644-7_1644-4delTAAA splice_region TBK1 22 82936 2.65265E-4 41468 0 9.6768E-5
12-64889498-C-G p.Leu555Val missense TBK1 2 82824 2.41476E-5 41412 0 NA
12-64889508-G-A p.Cys558Tyr missense TBK1 2 82718 2.41785E-5 41359 0 NA
12-64889516-G-A p.Glu561Lys missense TBK1 1 82648 1.20995E-5 41324 0 NA
12-64889526-A-G p.Tyr564Cys missense TBK1 1 82446 1.21292E-5 41223 0 6.18123E-5
12-64889529-A-C p.Gln565Pro missense TBK1 1 82384 1.21383E-5 41192 0 4.34329E-6
12-64889533-C-CA p.Asp569fs frameshift TBK1 1 82230 1.2161E-5 41115 0 NA
12-64889547-C-T p.Ala571Val missense TBK1 1 81866 1.22151E-5 40933 0 3.06965E-5
12-64889552-C-T p.Arg573Cys missense TBK1 1 81706 1.2239E-5 40853 0 3.32878E-5
12-64889553-G-A p.Arg573His missense+splice_region TBK1 4 81616 4.901E-5 40808 0 8.46253E-5
12-64889706-TAAAAAAAA-T n.466_*3delAAAAAAAA splice_region TBK1 3 43616 6.87821E-5 21808 1 NA
12-64889709-A-T n.468A>T splice_region TBK1 47 44628 0.00105315 22314 0 6.64673E-5
12-64889710-A-T n.469A>T splice_region TBK1 1 44582 2.24306E-5 22291 0 NA
12-64890139-A-G c.1721-8A>G splice_region TBK1 1 78082 1.2807E-5 39041 0 5.25034E-6
12-64890139-A-AT c.1721-8_1721-7insT splice_region TBK1 2 78080 2.56148E-5 39040 0 NA
12-64890148-A-C p.Arg574Ser missense+splice_region TBK1 2 78440 2.54972E-5 39220 0 NA
12-64890153-C-G p.Ala576Gly missense TBK1 2 78426 2.55017E-5 39213 0 NA
12-64890177-A-G p.Lys584Arg missense TBK1 2 78512 2.54738E-5 39256 0 2.67437E-5
12-64890736-C-G p.Leu590Val missense TBK1 1 82878 1.20659E-5 41439 0 NA
12-64890738-G-A p.Leu590Leu synonymous TBK1 2 82888 2.41289E-5 41444 0 8.68583E-6
12-64890760-A-G p.Met598Val missense TBK1 9 82970 1.08473E-4 41485 0 3.18451E-5
12-64890761-T-C p.Met598Thr missense TBK1 1 82974 1.2052E-5 41487 0 NA
12-64890765-G-A p.Thr599Thr synonymous TBK1 3 82958 3.61629E-5 41479 0 0.00100806
12-64890766-C-G p.His600Asp missense TBK1 1 82956 1.20546E-5 41478 0 NA
12-64890807-G-T p.Leu613Phe missense TBK1 16 82924 1.92948E-4 41462 0 0.0015121
12-64890821-A-G p.Glu618Gly missense TBK1 1 82886 1.20648E-5 41443 0 NA
12-64890824-G-C p.Trp619Ser missense TBK1 1 82884 1.20651E-5 41442 0 NA
12-64890825-G-A p.Trp619* stop_gained TBK1 1 82876 1.20662E-5 41438 0 NA
12-64890828-AAGGTGAGTAAACTTCTTTTGGAGTGATTAGTGGTTGACTGCACAATATAAATGTATATTTGAAGTAAGAATGCTTCACTAGACTGCATATCAATTGATTCTTTTTGGTTTTC-A p.Arg621fs frameshift TBK1 9 82862 1.08614E-4 41431 3 NA
12-64890997-T-C p.Asp639Asp synonymous TBK1 5 82058 6.09325E-5 41029 1 1.69655E-5
12-64890998-A-G p.Ile640Val missense TBK1 2 82030 2.43813E-5 41015 0 6.36983E-5
12-64891000-TGAA-T p.Glu643del disruptive_inframe_deletion TBK1 5 81966 6.10009E-5 40983 0 3.18512E-5
12-64891004-G-A p.Glu642Lys missense TBK1 3 81882 3.66381E-5 40941 0 3.18573E-5
12-64891008-A-T p.Glu643Val missense TBK1 1 81808 1.22237E-5 40904 0 8.5438E-6
12-64891018-A-G p.Lys646Lys synonymous TBK1 1 81462 1.22757E-5 40731 0 NA
12-64891032-CTAA-C p.Asn652del conservative_inframe_deletion TBK1 51 80890 6.30486E-4 40445 0 0.00130673
12-64891037-G-C p.Glu653Gln missense+splice_region TBK1 36 80616 4.46561E-4 40308 0 2.80318E-4
12-64891417-TGATG-T c.1960-10_1960-7delGATG splice_region TBK1 1 81802 1.22246E-5 40901 0 2.03926E-5
12-64891418-GATG-TTTT c.1960-10_1960-7delGATGinsTTTT splice_region TBK1 4 79488 5.03221E-5 39744 0 NA
12-64891419-A-ATTT c.1960-9_1960-8insTTT splice_region TBK1 38 78712 4.82773E-4 39356 0 0.0150235
12-64891419-A-ATTTT c.1960-9_1960-8insTTTT splice_region TBK1 6 78926 7.60206E-5 39463 0 6.57277E-4
12-64891419-ATG-TTT c.1960-9_1960-7delATGinsTTT splice_region TBK1 7 78980 8.863E-5 39490 0 NA
12-64891419-A-ATTTTTTTT c.1960-9_1960-8insTTTTTTTT splice_region TBK1 1 79014 1.2656E-5 39507 0 NA
12-64891419-A-ATTTTT c.1960-9_1960-8insTTTTT splice_region TBK1 1 79018 1.26553E-5 39509 0 2.8061E-5
12-64891419-A-ATTTTTTTTTTT c.1960-9_1960-8insTTTTTTTTTTT splice_region TBK1 1 79020 1.2655E-5 39510 0 NA
12-64891421-G-T c.1960-7G>T splice_region TBK1 236 77960 0.00302719 38980 0 0.0370239
12-64891421-G-GTTT c.1960-7_1960-6insTTT splice_region TBK1 10 80562 1.24128E-4 40281 0 5.66332E-4
12-64891424-TCAG-T c.1960-3_1960-1delCAG splice_acceptor TBK1 21 81236 2.58506E-4 40618 0 0.00624958
12-64891424-TCA-T c.1960-3_1960-2delCA splice_acceptor TBK1 2 81596 2.4511E-5 40798 0 3.34202E-4
12-64891425-C-T c.1960-3C>T splice_region TBK1 27 81156 3.32693E-4 40578 0 0.00798645
12-64891426-A-T c.1960-2A>T splice_acceptor TBK1 5 81604 6.12715E-5 40802 0 0.00385222
12-64891426-A-ATTTTT c.1960-2_1960-1insTTTTT splice_acceptor TBK1 2 81716 2.4475E-5 40858 0 4.17711E-4
12-64891427-G-T c.1960-1G>T splice_acceptor TBK1 6 81800 7.33496E-5 40900 0 0.00300752
12-64891427-G-GTTTTTT p.Glu653_Leu654insPhePhe disruptive_inframe_insertion TBK1 1 81892 1.22112E-5 40946 0 0.00568087
12-64891427-G-GTTTTTTT p.Leu654fs frameshift TBK1 2 81916 2.44153E-5 40958 0 4.17711E-5
12-64891427-G-GTTTT p.Leu654fs frameshift TBK1 1 81912 1.22082E-5 40956 0 5.04414E-6
12-64891430-A-T p.Leu654Phe missense+splice_region TBK1 1 81986 1.21972E-5 40993 0 NA
12-64891459-C-T p.Thr664Ile missense TBK1 1 82944 1.20563E-5 41472 0 NA
12-64891485-A-G p.Met673Val missense TBK1 1 83152 1.20262E-5 41576 0 NA
12-64891511-C-T p.Asn681Asn synonymous TBK1 2 83176 2.40454E-5 41588 0 8.2982E-6
12-64891515-T-C p.Leu683Leu synonymous TBK1 6 83170 7.21414E-5 41585 0 4.98124E-5
12-64891516-T-C p.Leu683Ser missense TBK1 3 83184 3.60646E-5 41592 0 4.08958E-6
12-64891534-G-GTATGAAGAAATTAAAGGAAGAGATGGAAGGGGT c.2066_2066+1insTATGAAGAAATTAAAGGAAGAGATGGAAGGGGT splice_donor TBK1 1 83114 1.20317E-5 41557 0 NA
12-64891741-T-A c.2067-7T>A splice_region TBK1 3 83082 3.61089E-5 41541 0 4.09843E-6
12-64891759-T-C p.Leu693Ser missense TBK1 1 83148 1.20267E-5 41574 0 NA
12-64891767-G-A p.Glu696Lys missense TBK1 2 83172 2.40466E-5 41586 0 1.65358E-5
12-64891777-G-A p.Gly699Glu missense TBK1 2 83180 2.40442E-5 41590 0 8.26624E-6
12-64891781-G-T p.Val700Val synonymous TBK1 2 83180 2.40442E-5 41590 0 1.59327E-4
12-64891810-T-A p.Ile710Asn missense TBK1 5 83162 6.01236E-5 41581 0 8.42531E-6
12-64891812-T-C p.Leu711Leu synonymous TBK1 1 83164 1.20244E-5 41582 0 1.65904E-5
12-64891822-G-A c.2138+3G>A splice_region TBK1 1 83134 1.20288E-5 41567 0 NA
12-64895131-TG-T p.Gly721fs frameshift TBK1 1 83308 1.20036E-5 41654 0 NA
12-64895141-C-T p.Arg724Cys missense TBK1 4 83314 4.80111E-5 41657 0 9.06185E-5
12-64895142-G-T p.Arg724Leu missense TBK1 1 83314 1.20028E-5 41657 0 8.23818E-6
12-64895145-A-G p.Asn725Ser missense TBK1 2 83330 2.4001E-5 41665 0 NA
12-64895146-C-T p.Asn725Asn synonymous TBK1 3 83326 3.60032E-5 41663 0 9.55597E-5
12-64895147-G-A p.Val726Ile missense TBK1 1 83326 1.20011E-5 41663 0 NA
12-64895148-T-C p.Val726Ala missense TBK1 1 83324 1.20013E-5 41662 0 3.18512E-5
12-64895154-G-T p.Cys728Phe missense TBK1 1 83338 1.19993E-5 41669 0 NA