Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
8-144873333-C-T p.Ter1631Ter stop_retained SCRIB 1 74606 1.34037E-5 37303 0 NA
8-144873358-C-T p.Arg1623His missense SCRIB 1 73670 1.3574E-5 36835 0 3.19163E-5
8-144873359-G-A p.Arg1623Cys missense SCRIB 5 73462 6.80624E-5 36731 0 4.21407E-4
8-144873361-C-T p.Arg1622His missense SCRIB 3 73120 4.10284E-5 36560 0 5.43124E-5
8-144873362-G-A p.Arg1622Cys missense SCRIB 4 72940 5.48396E-5 36470 0 0.00250941
8-144873374-C-T p.Val1618Ile missense SCRIB 2 72148 2.77208E-5 36074 0 1.82415E-4
8-144873375-G-A p.Pro1617Pro synonymous SCRIB 1 71992 1.38904E-5 35996 0 6.25782E-4
8-144873379-C-T p.Arg1616His missense SCRIB 10 71106 1.40635E-4 35553 0 6.76361E-4
8-144873380-G-A p.Arg1616Cys missense SCRIB 4 70750 5.65371E-5 35375 0 2.46694E-5
8-144873382-C-T p.Arg1615His missense SCRIB 1 70250 1.42349E-5 35125 0 4.86511E-5
8-144873383-G-A p.Arg1615Cys missense SCRIB 1 70114 1.42625E-5 35057 0 9.56633E-5
8-144873386-T-G p.Ser1614Arg missense SCRIB 1 69840 1.43184E-5 34920 0 NA
8-144873393-C-T p.Leu1611Leu synonymous SCRIB 1 68654 1.45658E-5 34327 0 NA
8-144873394-A-G p.Leu1611Pro missense SCRIB 1 68574 1.45828E-5 34287 0 NA
8-144873398-C-T p.Ala1610Thr missense SCRIB 1 67940 1.47189E-5 33970 0 NA
8-144873402-A-G p.Asp1608Asp synonymous SCRIB 2 67686 2.95482E-5 33843 0 NA
8-144873405-T-A p.Glu1607Asp missense SCRIB 38 67250 5.65056E-4 33625 0 0.00183636
8-144873405-T-C p.Glu1607Glu synonymous SCRIB 1 67254 1.4869E-5 33627 0 NA
8-144873419-C-T p.Ala1603Thr missense SCRIB 2 64110 3.11964E-5 32055 0 0.00125
8-144873423-G-A p.Pro1601Pro synonymous SCRIB 42 63598 6.60398E-4 31799 0 0.0040858
8-144873425-G-A p.Pro1601Ser missense SCRIB 2 63344 3.15736E-5 31672 0 NA
8-144873440-G-T p.Leu1596Met missense SCRIB 1 61828 1.61739E-5 30914 0 NA
8-144873447-C-T p.Leu1593Leu synonymous SCRIB 1 61340 1.63026E-5 30670 0 NA
8-144873449-GA-AT p.AlaLeu1592AlaLeu synonymous SCRIB 3 61366 4.8887E-5 30683 0 NA
8-144873474-C-T p.Pro1584Pro synonymous SCRIB 1 60086 1.66428E-5 30043 0 0.00253807
8-144873475-G-A p.Pro1584Leu missense SCRIB 979 59936 0.0163341 29968 8 0.0337598
8-144873477-GCCTGGAGGGCAGGGACAGGTGGGCAGTGAGCTGAGGGCAGCTGGGCTCCTGGGAGCTCACCCCAGCCCGGCCCCAACTCA-G p.Gly1583fs frameshift SCRIB 6 60050 9.99167E-5 30025 0 NA
8-144873477-G-A p.Gly1583Gly splice_region+synonymous SCRIB 1 60050 1.66528E-5 30025 0 5.16732E-6
8-144873582-G-A p.Ser1575Phe missense SCRIB 1 64108 1.55987E-5 32054 0 2.25144E-5
8-144873604-C-T p.Asp1568Asn missense SCRIB 1 65506 1.52658E-5 32753 0 NA
8-144873605-C-T p.Pro1567Pro synonymous SCRIB 2 65418 3.05726E-5 32709 0 2.21926E-5
8-144873606-G-A p.Pro1567Leu missense SCRIB 19 65532 2.89935E-4 32766 0 0.001875
8-144873617-T-C c.4696-7A>G splice_region SCRIB 1 66652 1.50033E-5 33326 0 4.19417E-6
8-144873827-GC-G c.4770+8delG splice_region SCRIB 20 81770 2.44588E-4 40885 0 3.19366E-4
8-144873831-G-C c.4770+5C>G splice_region SCRIB 3 81794 3.66775E-5 40897 0 6.26566E-4
8-144873832-G-C c.4770+4C>G splice_region SCRIB 1 81790 1.22264E-5 40895 0 NA
8-144873833-T-G c.4770+3A>C splice_region SCRIB 1 81730 1.22354E-5 40865 0 NA
8-144873835-C-A c.4770+1G>T splice_donor SCRIB 1 81798 1.22252E-5 40899 0 NA
8-144873841-TGTCATA-T p.Tyr1587_Asp1588del conservative_inframe_deletion SCRIB 2 81926 2.44123E-5 40963 0 4.03008E-6
8-144873842-G-A p.Asp1588Asp synonymous SCRIB 1 81932 1.22052E-5 40966 0 NA
8-144873843-T-C p.Asp1588Gly missense SCRIB 2 81934 2.44099E-5 40967 0 NA
8-144873844-C-T p.Asp1588Asn missense SCRIB 1 81952 1.22023E-5 40976 0 4.03343E-6
8-144873846-T-C p.Tyr1587Cys missense SCRIB 1 81954 1.2202E-5 40977 0 4.43884E-5
8-144873846-T-G p.Tyr1587Ser missense SCRIB 1 81954 1.2202E-5 40977 0 NA
8-144873854-T-C p.Arg1584Arg synonymous SCRIB 2 81908 2.44176E-5 40954 0 NA
8-144873855-C-A p.Arg1584Ile missense SCRIB 1 81952 1.22023E-5 40976 0 NA
8-144873866-C-T p.Leu1580Leu synonymous SCRIB 2 81996 2.43914E-5 40998 0 8.9548E-6
8-144873868-G-A p.Leu1580Leu synonymous SCRIB 4 82026 4.8765E-5 41013 0 NA
8-144873872-C-T p.Ala1578Ala synonymous SCRIB 5 81974 6.09949E-5 40987 0 NA
8-144873873-G-A p.Ala1578Val missense SCRIB 2 81968 2.43998E-5 40984 0 0.00151362
8-144873876-A-T p.Phe1577Tyr missense SCRIB 2 81998 2.43908E-5 40999 0 6.25E-4
8-144873883-T-C p.Arg1575Gly missense SCRIB 1 81992 1.21963E-5 40996 0 3.2041E-5
8-144873888-T-C p.Asp1573Gly missense SCRIB 1 81992 1.21963E-5 40996 0 9.13275E-6
8-144873892-ACTT-A p.Lys1571del conservative_inframe_deletion SCRIB 1 81976 1.21987E-5 40988 0 NA
8-144873894-T-C p.Lys1571Arg missense SCRIB 1 81968 1.21999E-5 40984 0 NA
8-144873899-T-C p.Gly1569Gly synonymous SCRIB 1 81878 1.22133E-5 40939 0 3.21192E-5
8-144873900-C-T p.Gly1569Glu missense SCRIB 1 81840 1.2219E-5 40920 0 4.04181E-6
8-144873908-G-A p.Pro1566Pro splice_region+synonymous SCRIB 2 81786 2.44541E-5 40893 0 4.0536E-6
8-144873909-G-A p.Pro1566Leu missense+splice_region SCRIB 1 81762 1.22306E-5 40881 0 NA
8-144873910-G-A p.Pro1566Ser missense+splice_region SCRIB 2 81762 2.44612E-5 40881 0 NA
8-144873918-G-T c.4696-8C>A splice_region SCRIB 2 81598 2.45104E-5 40799 0 NA
8-144874050-C-T p.Arg1564His missense SCRIB 1 75486 1.32475E-5 37743 0 5.21975E-5
8-144874056-G-A p.Pro1562Leu missense SCRIB 5 75812 6.59526E-5 37906 0 1.01688E-4
8-144874058-G-A p.Ser1561Ser synonymous SCRIB 1 75582 1.32307E-5 37791 0 1.7508E-5
8-144874068-G-A p.Thr1558Ile missense SCRIB 1 73058 1.36878E-5 36529 0 NA
8-144874073-G-A p.Pro1556Pro synonymous SCRIB 2 72766 2.74854E-5 36383 0 3.24675E-5
8-144874076-G-T p.Gly1555Gly synonymous SCRIB 1 71152 1.40544E-5 35576 0 NA
8-144874078-C-T p.Gly1555Ser missense SCRIB 2852 68554 0.0416022 34277 55 0.0729902
8-144874078-C-A p.Gly1555Cys missense SCRIB 1 69446 1.43997E-5 34723 0 NA
8-144874078-CG-TC p.LeuGly1554LeuSer missense SCRIB 1 69446 1.43997E-5 34723 0 NA
8-144874079-G-A p.Leu1554Leu synonymous SCRIB 621 70464 0.00881301 35232 18 0.0290667
8-144874081-G-A p.Leu1554Phe missense+splice_region SCRIB 2 70532 2.83559E-5 35266 0 1.67302E-5
8-144874083-TCTGGGGGGACAAGAAGCGGGCATTGGAAGCAGCCCATGCGGCAGGCTGACCCCCCCGACCTGCCCTGACCCACAGAC-T c.4657+1_4658-1delGTCTGTGGGTCAGGGCAGGTCGGGGGGGTCAGCCTGCCGCATGGGCTGCTTCCAATGCCCGCTTCTTGTCCCCCCAG splice_acceptor SCRIB 5 69558 7.18825E-5 34779 0 NA
8-144874085-T-TG c.4658-3_4658-2insC splice_region SCRIB 5 69460 7.19839E-5 34730 0 1.15902E-4
8-144874086-G-A c.4658-3C>T splice_region SCRIB 1 70636 1.41571E-5 35318 0 3.433E-5
8-144874089-G-A c.4658-6C>T splice_region SCRIB 1 70700 1.41443E-5 35350 0 1.71809E-5
8-144874089-G-T c.4658-6C>A splice_region SCRIB 1 70700 1.41443E-5 35350 0 NA
8-144874091-G-A c.4658-8C>T splice_region SCRIB 1 70304 1.42239E-5 35152 0 3.14575E-4
8-144874168-AGGGGTGGGCGAC-A p.Ser1547_Pro1550del disruptive_inframe_deletion SCRIB 1 55788 1.7925E-5 27894 0 6.4433E-5
8-144874170-G-C p.Pro1550Ala missense SCRIB 1 56112 1.78215E-5 28056 0 3.19224E-5
8-144874177-C-T p.Ser1547Ser synonymous SCRIB 3 53444 5.61335E-5 26722 0 3.21285E-4
8-144874180-C-T p.Pro1546Pro synonymous SCRIB 6 53212 1.12757E-4 26606 0 4.51467E-4
8-144874186-G-A p.Pro1544Pro synonymous SCRIB 1 53512 1.86874E-5 26756 0 1.92382E-4
8-144874189-C-T p.Ala1543Ala synonymous SCRIB 2 52760 3.79075E-5 26380 0 3.19428E-5
8-144874190-G-C p.Ala1543Gly missense SCRIB 1 52800 1.89394E-5 26400 0 NA
8-144874190-G-A p.Ala1543Val missense SCRIB 4 52800 7.57576E-5 26400 0 1.20934E-4
8-144874192-AG-A p.Pro1542fs frameshift SCRIB 1 53154 1.88133E-5 26577 0 NA
8-144874196-G-T p.Ser1541Tyr missense SCRIB 4 53356 7.49681E-5 26678 0 1.57101E-4
8-144874206-C-T p.Glu1538Lys missense SCRIB 1 52946 1.88872E-5 26473 0 NA
8-144874207-G-A p.Ala1537Ala synonymous SCRIB 3 52822 5.67945E-5 26411 0 1.65577E-4
8-144874214-C-T p.Arg1535Gln missense SCRIB 2 52896 3.781E-5 26448 0 1.75747E-4
8-144874224-G-A p.Pro1532Ser missense SCRIB 1 53048 1.88509E-5 26524 0 NA
8-144874229-C-T p.Arg1530Gln missense SCRIB 3 53680 5.58867E-5 26840 0 4.79501E-5
8-144874230-G-A p.Arg1530Trp missense SCRIB 2 53792 3.71802E-5 26896 0 2.25754E-5
8-144874231-C-T p.Thr1529Thr synonymous SCRIB 2 53830 3.7154E-5 26915 0 2.17495E-4
8-144874238-C-T p.Arg1527Gln missense SCRIB 7 55274 1.26642E-4 27637 0 9.57365E-5
8-144874239-G-A p.Arg1527Trp missense SCRIB 3 55304 5.42456E-5 27652 0 8.44652E-5
8-144874250-G-A p.Ser1523Phe missense SCRIB 3 56834 5.27853E-5 28417 0 6.37959E-5
8-144874251-A-G p.Ser1523Pro missense SCRIB 1 56778 1.76125E-5 28389 0 NA
8-144874274-C-T p.Arg1515Gln missense SCRIB 5 58484 8.54935E-5 29242 0 9.57549E-5
8-144874281-C-T p.Ala1513Thr missense SCRIB 1 58810 1.70039E-5 29405 0 NA
8-144874284-C-T p.Asp1512Asn missense SCRIB 1 59390 1.68379E-5 29695 0 NA
8-144874297-C-T p.Lys1507Lys synonymous SCRIB 29 60030 4.83092E-4 30015 0 7.94727E-4
8-144874300-C-T p.Met1506Ile missense SCRIB 1 60072 1.66467E-5 30036 0 NA
8-144874302-TCCTGCAGAGAACAGCGGGCAGGGGTGACTTGGGGCAGGAGCAGGGACAGGCAGCAGGGCGGGGTGGCGACCCCACACAGGGGCTCA-T p.Met1506fs frameshift SCRIB 12 59842 2.00528E-4 29921 5 NA
8-144874307-C-T c.4515-4G>A splice_region SCRIB 15 59652 2.51458E-4 29826 0 6.25E-4
8-144874309-G-A c.4515-6C>T splice_region SCRIB 6 59660 1.0057E-4 29830 0 2.11555E-5
8-144874382-G-A c.4514+8C>T splice_region SCRIB 3 51236 5.85526E-5 25618 0 2.87356E-4
8-144874408-G-A p.Ala1499Val missense SCRIB 1 49368 2.0256E-5 24684 0 3.99218E-5
8-144874440-G-A p.Ala1488Ala synonymous SCRIB 52 47618 0.00109202 23809 0 0.00863821
8-144874446-G-C p.Ser1486Ser synonymous SCRIB 1 47418 2.1089E-5 23709 0 5.63171E-6
8-144874457-G-A p.Arg1483Cys missense SCRIB 2 46578 4.29387E-5 23289 0 6.38244E-5
8-144874460-C-T p.Glu1482Lys missense SCRIB 4 46420 8.61698E-5 23210 0 1.30796E-4
8-144874461-G-A p.Pro1481Pro synonymous SCRIB 1 46438 2.15341E-5 23219 0 6.048E-6
8-144874465-G-A p.Ala1480Val missense SCRIB 1 46114 2.16854E-5 23057 0 6.38081E-5
8-144874467-C-T p.Pro1479Pro synonymous SCRIB 1 45966 2.17552E-5 22983 0 1.86215E-5
8-144874468-G-C p.Pro1479Arg missense SCRIB 2 46006 4.34726E-5 23003 0 3.6547E-5
8-144874471-G-A p.Pro1478Leu missense SCRIB 1 45868 2.18017E-5 22934 0 NA
8-144874476-C-T p.Pro1476Pro synonymous SCRIB 7 45550 1.53677E-4 22775 0 0.00153531
8-144874479-A-G p.Ser1475Ser synonymous SCRIB 2 45334 4.4117E-5 22667 0 1.26134E-5
8-144874483-T-C p.Gln1474Arg missense SCRIB 1 45302 2.20741E-5 22651 0 5.12295E-4
8-144874487-C-T p.Val1473Met missense SCRIB 1 44934 2.22549E-5 22467 0 3.19203E-5
8-144874488-G-A p.Arg1472Arg synonymous SCRIB 1 44638 2.24024E-5 22319 0 0.0020555
8-144874491-C-T p.Leu1471Leu synonymous SCRIB 1 44608 2.24175E-5 22304 0 2.66406E-4
8-144874495-C-T p.Arg1470Gln missense SCRIB 4 44292 9.03098E-5 22146 0 4.55373E-5
8-144874496-G-A p.Arg1470Trp missense SCRIB 2 44108 4.53432E-5 22054 0 6.27353E-4
8-144874499-C-T p.Glu1469Lys missense SCRIB 1 44090 2.26809E-5 22045 0 NA
8-144874506-G-A p.Arg1466Arg synonymous SCRIB 11 43678 2.51843E-4 21839 0 0.00103734
8-144874529-G-A p.Arg1459Trp missense SCRIB 1 42696 2.34214E-5 21348 0 7.42302E-6
8-144874533-C-T p.Pro1457Pro synonymous SCRIB 4 42642 9.38042E-5 21321 0 4.39223E-4
8-144874534-G-A p.Pro1457Leu missense SCRIB 2 42524 4.70323E-5 21262 0 0.00155602
8-144874539-G-A p.Gly1455Gly synonymous SCRIB 1 42276 2.36541E-5 21138 0 1.08578E-4
8-144874554-T-C p.Pro1450Pro synonymous SCRIB 41252 41438 0.995511 20719 20537 0.998096
8-144874554-T-G p.Pro1450Pro synonymous SCRIB 1 42104 2.37507E-5 21052 0 3.13234E-5
8-144874555-G-A p.Pro1450Leu missense SCRIB 1 42308 2.36362E-5 21154 0 4.10374E-5
8-144874555-G-T p.Pro1450Gln missense SCRIB 1 42308 2.36362E-5 21154 0 0.00206398
8-144874556-G-T p.Pro1450Thr missense SCRIB 1 42308 2.36362E-5 21154 0 NA
8-144874556-G-A p.Pro1450Ser missense SCRIB 1 42308 2.36362E-5 21154 0 NA
8-144874557-G-A p.Pro1449Pro synonymous SCRIB 1 42306 2.36373E-5 21153 0 8.27705E-6
8-144874558-G-A p.Pro1449Leu missense SCRIB 1 42308 2.36362E-5 21154 0 NA
8-144874560-G-A p.Ser1448Ser synonymous SCRIB 2 42336 4.72411E-5 21168 0 6.38325E-5
8-144874561-G-A p.Ser1448Phe missense SCRIB 1 42354 2.36105E-5 21177 0 5.15464E-4
8-144874564-G-A p.Ala1447Val missense SCRIB 1 42214 2.36888E-5 21107 0 1.09373E-4
8-144874566-C-T p.Pro1446Pro synonymous SCRIB 3 42352 7.08349E-5 21176 0 0.0015544
8-144874567-G-A p.Pro1446Leu missense SCRIB 1 42440 2.35627E-5 21220 0 2.18269E-4
8-144874574-GCCTGGGGAAGGGACAGGACGTGCTGTGGGGGGCAGGGGCACGTGGGGTGAGTAGGGGGCGTCTGGTGGGCGGGTGCTCA-G p.Arg1443fs frameshift SCRIB 12 42742 2.80754E-4 21371 4 NA
8-144874670-G-A p.Pro1438Leu missense SCRIB 7 49320 1.4193E-4 24660 0 6.38978E-5
8-144874678-C-G p.Trp1435Cys missense SCRIB 1 50708 1.97208E-5 25354 0 NA
8-144874685-GGCT-G p.Gln1432del disruptive_inframe_deletion SCRIB 1 52108 1.91909E-5 26054 0 6.12768E-6
8-144874695-C-T p.Asp1430Asn missense SCRIB 1 54554 1.83305E-5 27277 0 1.63319E-4
8-144874696-C-G p.Glu1429Asp missense SCRIB 8 54782 1.46033E-4 27391 0 6.25E-4
8-144874704-C-T p.Glu1427Lys missense SCRIB 1 56766 1.76162E-5 28383 0 NA
8-144874710-C-T p.Glu1425Lys missense SCRIB 3 58182 5.15623E-5 29091 0 0.00255363
8-144874713-C-T p.Gly1424Ser missense SCRIB 1 59678 1.67566E-5 29839 0 NA
8-144874715-A-G p.Leu1423Pro missense SCRIB 2 60442 3.30896E-5 30221 0 NA
8-144874717-C-T p.Thr1422Thr synonymous SCRIB 1 60926 1.64134E-5 30463 0 7.15973E-5
8-144874718-G-A p.Thr1422Met missense SCRIB 3 61374 4.88806E-5 30687 0 0.00254582
8-144874720-C-T p.Glu1421Glu synonymous SCRIB 1 62574 1.59811E-5 31287 0 NA
8-144874725-C-T p.Gly1420Arg missense SCRIB 4 63792 6.27038E-5 31896 0 1.33627E-4
8-144874726-G-A p.Asp1419Asp synonymous SCRIB 3 64034 4.68501E-5 32017 0 6.25E-4
8-144874728-C-A p.Asp1419Tyr missense SCRIB 1 65212 1.53346E-5 32606 0 3.2202E-5
8-144874734-C-T p.Ala1417Thr missense SCRIB 1 65988 1.51543E-5 32994 0 6.17208E-5
8-144874735-G-A p.Leu1416Leu synonymous SCRIB 2 66838 2.99231E-5 33419 0 5.10725E-4
8-144874741-C-T p.Ala1414Ala synonymous SCRIB 2 69140 2.89268E-5 34570 0 2.73928E-5
8-144874741-C-G p.Ala1414Ala synonymous SCRIB 1 69140 1.44634E-5 34570 0 NA
8-144874742-G-A p.Ala1414Val missense SCRIB 1 69226 1.44454E-5 34613 0 1.6211E-4
8-144874745-T-G p.Glu1413Ala missense SCRIB 1 70752 1.41339E-5 35376 0 NA
8-144874747-G-A p.Ala1412Ala synonymous SCRIB 4 70860 5.64493E-5 35430 0 1.02302E-4
8-144874752-C-T p.Gly1411Arg missense SCRIB 3 73100 4.10397E-5 36550 0 4.61489E-5
8-144874755-C-G p.Ala1410Pro missense SCRIB 2 73470 2.7222E-5 36735 0 NA
8-144874757-T-G p.Glu1409Ala missense SCRIB 1 73972 1.35186E-5 36986 0 NA
8-144874766-T-C p.Glu1406Gly missense SCRIB 1 75858 1.31825E-5 37929 0 4.56475E-6
8-144874770-G-A p.Arg1405Trp missense SCRIB 5 76336 6.54999E-5 38168 0 9.56816E-5
8-144874771-C-T p.Leu1404Leu synonymous SCRIB 82 76768 0.00106815 38384 0 0.00242223
8-144874778-T-C p.Gln1402Arg missense SCRIB 2 77952 2.56568E-5 38976 0 4.43479E-6
8-144874780-C-T n.515G>A splice_region SCRIB 1 78146 1.27966E-5 39073 0 5.01958E-5
8-144874781-G-A p.Ala1401Val missense SCRIB 1 78214 1.27854E-5 39107 0 3.33145E-5
8-144874796-A-G p.Leu1396Pro missense SCRIB 1 79556 1.25698E-5 39778 0 NA
8-144874797-G-C p.Leu1396Val missense SCRIB 1 79610 1.25612E-5 39805 0 NA
8-144874802-C-G p.Arg1394Thr missense SCRIB 2 79756 2.50765E-5 39878 0 NA
8-144874805-GCTGCCGGAGGGCAGGGTGGGTCAGGCCAGACCAGCCGAGACCCAACCCCCACCCCACTTCCGTGCCCCTCAC-G c.4177+1_4178-1delGTGAGGGGCACGGAAGTGGGGTGGGGGTTGGGTCTCGGCTGGTCTGGCCTGACCCACCCTGCCCTCCGGCAG splice_acceptor SCRIB 8 79776 1.00281E-4 39888 0 NA
8-144874812-G-C p.Pro410Ala missense SCRIB 44 79998 5.50014E-4 39999 0 7.33793E-4
8-144874812-G-A p.Pro410Ser missense SCRIB 4 80000 5.0E-5 40000 0 4.01624E-5
8-144874815-G-A p.Pro409Ser missense SCRIB 1 79990 1.25016E-5 39995 0 9.1202E-5
8-144874819-G-A p.Pro407Pro synonymous SCRIB 8 80022 9.99725E-5 40011 0 3.18878E-5
8-144874831-C-G p.Trp403Cys missense SCRIB 4 80096 4.99401E-5 40048 0 2.55004E-4
8-144874834-G-A p.Val402Val synonymous SCRIB 1 80240 1.24626E-5 40120 0 4.59276E-6
8-144874836-C-T p.Val402Ile missense SCRIB 1 80460 1.24285E-5 40230 0 NA
8-144874837-C-G p.Leu401Leu synonymous SCRIB 1 80488 1.24242E-5 40244 0 NA
8-144874841-C-G p.Arg400Pro missense SCRIB 1 80584 1.24094E-5 40292 0 NA
8-144874841-C-T p.Arg400Gln missense SCRIB 1 80584 1.24094E-5 40292 0 1.46439E-5
8-144874842-G-A p.Arg400Trp missense SCRIB 1 80596 1.24076E-5 40298 0 5.8584E-5
8-144874850-AC-A p.Val397fs frameshift SCRIB 1 80734 1.23864E-5 40367 0 4.61123E-6
8-144874858-C-G p.Gly394Gly synonymous SCRIB 1 80920 1.23579E-5 40460 0 1.48947E-5
8-144874866-C-T p.Gly392Arg missense SCRIB 13 81068 1.60359E-4 40534 0 1.59448E-4
8-144874867-G-T p.His391Gln missense SCRIB 1 81014 1.23435E-5 40507 0 NA
8-144874890-G-C p.Gln1389Glu missense SCRIB 1 81344 1.22935E-5 40672 0 4.67128E-6
8-144874892-A-G p.Met1388Thr missense SCRIB 2 81354 2.45839E-5 40677 0 1.48703E-5
8-144874899-G-A p.Arg1386Trp missense SCRIB 1 81302 1.22998E-5 40651 0 2.99581E-5
8-144874917-C-A p.Val1380Leu missense SCRIB 11 81368 1.35188E-4 40684 0 2.00988E-4
8-144874921-G-A p.Ser1378Ser synonymous SCRIB 2 81332 2.45906E-5 40666 0 1.43225E-5
8-144874926-C-T p.Val1377Met missense SCRIB 3 81298 3.69013E-5 40649 0 3.18695E-5
8-144874927-G-C p.Arg1376Arg synonymous SCRIB 1 81254 1.23071E-5 40627 0 4.57859E-6
8-144874927-G-A p.Arg1376Arg synonymous SCRIB 1 81252 1.23074E-5 40626 0 1.41703E-5
8-144874928-C-T p.Arg1376His missense SCRIB 1 81252 1.23074E-5 40626 0 4.56071E-5
8-144874933-A-C p.Pro1374Pro synonymous SCRIB 1 81216 1.23128E-5 40608 0 NA
8-144874936-G-T p.Pro1373Pro synonymous SCRIB 1 81226 1.23113E-5 40613 0 1.37851E-5
8-144874936-G-A p.Pro1373Pro synonymous SCRIB 1 81226 1.23113E-5 40613 0 NA
8-144874937-G-T p.Pro1373His missense SCRIB 1 81186 1.23174E-5 40593 0 NA
8-144874939-G-A p.Gly1372Gly synonymous SCRIB 4 81078 4.93352E-5 40539 0 9.19929E-6
8-144874940-C-T p.Gly1372Asp missense SCRIB 1 81096 1.23311E-5 40548 0 NA
8-144874945-G-A p.Ala1370Ala synonymous SCRIB 8 80996 9.87703E-5 40498 0 6.65354E-5
8-144874945-G-C p.Ala1370Ala synonymous SCRIB 2 80996 2.46926E-5 40498 0 4.59411E-6
8-144874956-C-T p.Val1367Met missense SCRIB 2 80890 2.47249E-5 40445 0 3.18654E-5
8-144874957-G-A p.Arg1366Arg synonymous SCRIB 1765 80740 0.0218603 40370 23 0.0464996
8-144874958-C-T p.Arg1366His missense SCRIB 4 80862 4.9467E-5 40431 0 3.67071E-5
8-144874959-G-A p.Arg1366Cys missense SCRIB 3 80792 3.71324E-5 40396 0 8.00625E-5
8-144874962-C-T p.Val1365Met missense SCRIB 1 80916 1.23585E-5 40458 0 2.36821E-5
8-144874976-T-C p.Tyr1360Cys missense SCRIB 1 80524 1.24187E-5 40262 0 NA
8-144874991-C-T p.Arg1355Gln missense SCRIB 2 80216 2.49327E-5 40108 0 3.18654E-5
8-144874992-G-A p.Arg1355Trp missense SCRIB 2 80200 2.49377E-5 40100 0 6.63262E-5
8-144874993-G-A p.Phe1354Phe synonymous SCRIB 8 80186 9.9768E-5 40093 0 1.27437E-4
8-144875008-C-T p.Pro1349Pro synonymous SCRIB 2 80024 2.49925E-5 40012 0 6.25782E-4
8-144875008-C-G p.Pro1349Pro synonymous SCRIB 2 80024 2.49925E-5 40012 0 5.50085E-6
8-144875009-G-A p.Pro1349Leu missense SCRIB 2 80018 2.49944E-5 40009 0 9.5584E-5
8-144875014-G-C p.Ala1347Ala synonymous SCRIB 2 80000 2.5E-5 40000 0 1.09407E-5
8-144875019-C-T p.Ala1346Thr missense SCRIB 1 79928 1.25113E-5 39964 0 1.70713E-5
8-144875021-G-T p.Pro1345His missense SCRIB 1 79948 1.25081E-5 39974 0 5.71298E-6
8-144875026-A-C p.Pro1343Pro synonymous SCRIB 257 79782 0.00322128 39891 2 0.0067007
8-144875029-C-T p.Thr1342Thr synonymous SCRIB 1 79452 1.25862E-5 39726 0 6.38814E-5
8-144875030-G-C p.Thr1342Arg missense SCRIB 1 79640 1.25565E-5 39820 0 1.10161E-5
8-144875030-G-A p.Thr1342Met missense SCRIB 2 79640 2.5113E-5 39820 0 1.10161E-5
8-144875031-T-TG p.Thr1342fs frameshift SCRIB 1 79628 1.25584E-5 39814 0 NA
8-144875032-G-T p.Pro1341Pro synonymous SCRIB 2 79704 2.50928E-5 39852 0 1.231E-5
8-144875032-G-C p.Pro1341Pro synonymous SCRIB 3 79704 3.76393E-5 39852 0 NA
8-144875032-G-A p.Pro1341Pro synonymous SCRIB 2 79704 2.50928E-5 39852 0 4.43725E-5
8-144875033-G-A p.Pro1341Leu missense SCRIB 1 79718 1.25442E-5 39859 0 6.26566E-4
8-144875034-G-A p.Pro1341Ser missense SCRIB 3 79744 3.76204E-5 39872 0 NA
8-144875035-G-A p.Pro1340Pro splice_region+synonymous SCRIB 4 79706 5.01844E-5 39853 0 0.00100806
8-144875037-GCTGGGGGGAGCGGACCTTGAGGTTTGGCTGGCATTCCTCCGAGATACTGGGGCCCCCGGGCACCCACCCCAACCACGCGCAGCAGGGAGGCGTGCTGCCCCCACACAC-G c.4017+1_4018-1del splice_acceptor SCRIB 6 79586 7.53901E-5 39793 0 NA
8-144875039-TG-T c.4018-3delC splice_region SCRIB 2 79644 2.51117E-5 39822 0 2.51105E-5
8-144875041-G-A c.4018-4C>T splice_region SCRIB 1 79704 1.25464E-5 39852 0 3.18837E-5
8-144875042-G-A c.4018-5C>T splice_region SCRIB 2 79754 2.50771E-5 39877 0 3.03896E-5
8-144875045-G-C c.4018-8C>G splice_region SCRIB 6 79692 7.52899E-5 39846 0 4.43469E-5
8-144875138-C-A c.4017+8G>T splice_region SCRIB 9 77000 1.16883E-4 38500 0 1.27551E-4
8-144875138-C-T c.4017+8G>A splice_region SCRIB 1 77002 1.29867E-5 38501 0 NA
8-144875138-CCA-C c.4017+6_4017+7delTG splice_region SCRIB 1 77002 1.29867E-5 38501 0 NA
8-144875153-G-A p.Pro1337Leu missense SCRIB 2 75646 2.64389E-5 37823 0 NA
8-144875154-G-A p.Pro1337Ser missense SCRIB 49 75496 6.49041E-4 37748 1 0.00204918
8-144875158-ATCC-A p.Glu1334del disruptive_inframe_deletion SCRIB 1 74954 1.33415E-5 37477 0 5.75175E-5
8-144875161-C-T p.Glu1334Glu synonymous SCRIB 1 74748 1.33783E-5 37374 0 7.48189E-6
8-144875167-C-T p.Pro1332Pro synonymous SCRIB 1 73336 1.36359E-5 36668 0 3.18939E-5
8-144875168-G-A p.Pro1332Leu missense SCRIB 302 73460 0.00411108 36730 0 0.0124535
8-144875184-C-T p.Val1327Met missense SCRIB 16 69440 2.30415E-4 34720 0 8.11329E-4
8-144875185-G-A p.Ala1326Ala synonymous SCRIB 9 69058 1.30325E-4 34529 0 6.25489E-4
8-144875188-C-T p.Ala1325Ala synonymous SCRIB 2 67720 2.95334E-5 33860 0 1.57208E-4
8-144875189-G-A p.Ala1325Val missense SCRIB 1 67160 1.48898E-5 33580 0 7.85916E-5
8-144875190-C-T p.Ala1325Thr missense SCRIB 2 66560 3.00481E-5 33280 0 6.37959E-5
8-144875191-G-A p.Phe1324Phe synonymous SCRIB 12 66450 1.80587E-4 33225 0 0.00119617
8-144875195-G-A p.Ala1323Val missense SCRIB 2 65072 3.07352E-5 32536 0 NA
8-144875204-G-T p.Ala1320Asp missense SCRIB 1 62468 1.60082E-5 31234 0 3.18776E-5
8-144875220-C-T p.Ala1315Thr missense SCRIB 3 57256 5.23963E-5 28628 0 1.40315E-4
8-144875221-G-A p.Pro1314Pro synonymous SCRIB 6 57796 1.03813E-4 28898 0 1.43743E-4
8-144875222-G-A p.Pro1314Leu missense SCRIB 1 57442 1.74089E-5 28721 0 NA
8-144875226-G-A p.Leu1313Leu synonymous SCRIB 2 55924 3.57628E-5 27962 0 3.18796E-5
8-144875237-G-A p.Ser1309Phe missense SCRIB 1 53310 1.87582E-5 26655 0 1.0046E-5
8-144875242-C-T p.Pro1307Pro synonymous SCRIB 813 50718 0.0160298 25359 10 0.0226311
8-144875249-G-C p.Pro1305Arg missense SCRIB 2 50214 3.98295E-5 25107 0 NA
8-144875252-G-A p.Pro1304Leu missense+splice_region SCRIB 1 48976 2.04182E-5 24488 0 2.40518E-5
8-144875253-G-A p.Pro1304Ser missense+splice_region SCRIB 1 48550 2.05973E-5 24275 0 NA
8-144875258-G-C c.3910-5C>G splice_region SCRIB 3 47864 6.26776E-5 23932 0 6.37471E-5
8-144875260-G-A c.3910-7C>T splice_region SCRIB 1 47266 2.11569E-5 23633 0 NA
8-144876092-G-A p.Pro1296Leu missense SCRIB 1 82304 1.21501E-5 41152 0 8.30565E-6
8-144876093-G-A p.Pro1296Ser missense SCRIB 1 82304 1.21501E-5 41152 0 3.1902E-5
8-144876117-C-T p.Ala1288Thr missense SCRIB 1 82148 1.21732E-5 41074 0 8.335E-6
8-144876123-C-G p.Gly1286Arg missense SCRIB 36 82116 4.38404E-4 41058 0 7.97296E-4
8-144876124-A-G p.Ser1285Ser synonymous SCRIB 1 82078 1.21835E-5 41039 0 3.18959E-5
8-144876124-A-T p.Ser1285Ser synonymous SCRIB 1 82080 1.21832E-5 41040 0 NA
8-144876127-C-T p.Pro1284Pro synonymous SCRIB 3 82034 3.65702E-5 41017 0 9.56877E-5
8-144876128-G-A p.Pro1284Leu missense SCRIB 1 82004 1.21945E-5 41002 0 3.19183E-5
8-144876131-A-AC p.Val1283fs frameshift SCRIB 1 81904 1.22094E-5 40952 0 NA
8-144876131-ACCTGGAGGAGTAGGCAGTGGGTGGGGTGAGGATGGGCAGGGCTGTGGCCCCCGACCAGGAGGGACTGGGGGCCCTGGGGCTTG-A p.Val1283fs frameshift SCRIB 1 81904 1.22094E-5 40952 0 NA
8-144876136-G-A c.3847-4C>T splice_region SCRIB 1 81812 1.22231E-5 40906 0 NA
8-144876138-G-A c.3847-6C>T splice_region SCRIB 3 81768 3.66892E-5 40884 0 8.02143E-6
8-144876139-G-A c.3847-7C>T splice_region SCRIB 2 81730 2.44708E-5 40865 0 8.3856E-6
8-144876251-G-C n.156C>G splice_region SCRIB 4 68834 5.81108E-5 34417 0 9.56633E-5
8-144877211-C-A p.Gln1281His missense SCRIB 1 78594 1.27236E-5 39297 0 1.75408E-5
8-144877216-C-T p.Val1280Met missense SCRIB 11 78372 1.40356E-4 39186 0 9.56755E-5
8-144877216-C-A p.Val1280Leu missense SCRIB 2 78372 2.55193E-5 39186 0 3.18918E-5
8-144877217-G-A p.Ser1279Ser synonymous SCRIB 2 78210 2.55722E-5 39105 0 6.25E-4
8-144877225-C-T p.Ala1277Thr missense SCRIB 3 78064 3.843E-5 39032 0 3.52088E-5
8-144877226-G-A p.Ser1276Ser synonymous SCRIB 25 78054 3.20291E-4 39027 0 5.19989E-4
8-144877229-G-A p.Pro1275Pro synonymous SCRIB 7 78056 8.96792E-5 39028 0 5.05051E-4
8-144877234-C-T p.Val1274Met missense SCRIB 4 77580 5.15597E-5 38790 0 4.42204E-5
8-144877235-G-A p.Ala1273Ala synonymous SCRIB 2 77482 2.58124E-5 38741 0 4.4379E-5
8-144877237-C-T p.Ala1273Thr missense SCRIB 4 77248 5.17813E-5 38624 0 6.25E-4
8-144877238-G-A p.Ala1272Ala synonymous SCRIB 35 77228 4.53204E-4 38614 0 2.48187E-4
8-144877241-C-T p.Leu1271Leu synonymous SCRIB 1 77030 1.2982E-5 38515 0 NA
8-144877245-G-C p.Ala1270Gly missense SCRIB 17 76748 2.21504E-4 38374 0 1.59459E-4
8-144877245-G-T p.Ala1270Asp missense SCRIB 1 76748 1.30297E-5 38374 0 NA
8-144877246-C-T p.Ala1270Thr missense SCRIB 1 76492 1.30733E-5 38246 0 3.19122E-5
8-144877247-G-A p.Arg1269Arg synonymous SCRIB 2 76460 2.61575E-5 38230 0 9.5706E-5
8-144877249-G-A p.Arg1269Cys missense SCRIB 1 76426 1.30846E-5 38213 0 1.78015E-5
8-144877250-G-A p.Tyr1268Tyr synonymous SCRIB 1 76452 1.30801E-5 38226 0 3.55764E-5
8-144877278-C-T p.Arg1259Gln missense SCRIB 2 76020 2.63089E-5 38010 0 1.79163E-5
8-144877279-G-A p.Arg1259Trp missense SCRIB 1 76020 1.31544E-5 38010 0 4.92667E-5
8-144877449-C-T p.Ala1257Thr missense+splice_region SCRIB 2 82754 2.4168E-5 41377 0 7.19384E-5
8-144877449-C-A p.Ala1257Ser missense+splice_region SCRIB 1 82754 1.2084E-5 41377 0 3.18939E-5
8-144877450-G-A p.Ala1256Ala synonymous SCRIB 18 82756 2.17507E-4 41378 0 6.26566E-4
8-144877461-C-G p.Ala1253Pro missense SCRIB 4 82720 4.83559E-5 41360 0 1.44044E-4
8-144877465-G-A p.Pro1251Pro synonymous SCRIB 2 82670 2.41926E-5 41335 0 8.39306E-6
8-144877466-G-C p.Pro1251Arg missense SCRIB 1 82694 1.20928E-5 41347 0 5.03457E-5
8-144877467-G-A p.Pro1251Ser missense SCRIB 1 82700 1.20919E-5 41350 0 3.19183E-5
8-144877476-G-A p.His1248Tyr missense SCRIB 2 82716 2.41791E-5 41358 0 NA
8-144877491-G-A p.Pro1243Ser missense SCRIB 1 82656 1.20983E-5 41328 0 NA
8-144877492-C-T p.Leu1242Leu synonymous SCRIB 5 82664 6.04858E-5 41332 0 5.8782E-5
8-144877492-C-A p.Leu1242Leu synonymous SCRIB 1 82666 1.20969E-5 41333 0 8.39743E-6
8-144877494-G-A p.Leu1242Leu synonymous SCRIB 1 82658 1.2098E-5 41329 0 3.99553E-6
8-144877497-CCTT-C p.Lys1240del conservative_inframe_deletion SCRIB 1 82662 1.20975E-5 41331 0 NA
8-144877502-TCCTGTGAGCAGAGCAGAGCAGACCCGTCAGGCACCACCGGCCTCGGGCTCCCTGGCCCTGGGGCTGCCGGCTGCAGGCACCTCTGA-T p.Glu1239fs frameshift SCRIB 7 82664 8.46801E-5 41332 0 NA
8-144877507-T-TGAGCA c.3715-5_3715-4insTGCTC splice_region SCRIB 42 82654 5.08142E-4 41327 0 0.00140521
8-144877583-C-T c.3714+7G>A splice_region SCRIB 1 82708 1.20907E-5 41354 0 3.18939E-5
8-144877596-T-TG p.Gly1237fs frameshift SCRIB 1 82758 1.20834E-5 41379 0 NA
8-144877598-G-T p.Pro1236Thr missense SCRIB 2 82742 2.41715E-5 41371 0 8.70959E-6
8-144877605-A-G p.Pro1233Pro synonymous SCRIB 1 82756 1.20837E-5 41378 0 3.19305E-5
8-144877611-C-A p.Leu1231Leu synonymous SCRIB 1 82764 1.20825E-5 41382 0 NA
8-144877618-C-T p.Arg1229Gln missense SCRIB 6 82774 7.24865E-5 41387 0 6.96561E-5
8-144877623-G-A p.Ile1227Ile synonymous SCRIB 10 82756 1.20837E-4 41378 0 4.40811E-5
8-144877632-G-C p.Ile1224Met missense SCRIB 2 82792 2.41569E-5 41396 0 NA
8-144877635-G-A p.Ser1223Ser synonymous SCRIB 1 82754 1.2084E-5 41377 0 4.00712E-6
8-144877636-C-T p.Ser1223Asn missense SCRIB 2 82774 2.41622E-5 41387 0 5.03525E-4
8-144877638-C-T p.Glu1222Glu synonymous SCRIB 2 82758 2.41668E-5 41379 0 5.35116E-4
8-144877650-C-A p.Arg1218Arg synonymous SCRIB 1 82686 1.20939E-5 41343 0 1.60743E-5
8-144877651-C-T p.Arg1218Gln missense SCRIB 2 82638 2.42019E-5 41319 0 6.43439E-5
8-144877654-T-G p.His1217Pro missense SCRIB 1648 82570 0.0199588 41285 27 0.0473313
8-144877658-C-T p.Gly1216Ser missense SCRIB 25 82642 3.0251E-4 41321 0 6.25E-4
8-144877659-G-A p.Ile1215Ile synonymous SCRIB 6 82672 7.2576E-5 41336 0 6.37796E-5
8-144877661-T-C p.Ile1215Val missense SCRIB 4 82672 4.8384E-5 41336 0 9.17667E-6
8-144877668-C-T p.Ala1212Ala synonymous SCRIB 1 82658 1.2098E-5 41329 0 3.19E-5
8-144877669-G-A p.Ala1212Val missense SCRIB 3 82662 3.62924E-5 41331 0 3.75319E-5
8-144877674-G-T p.Pro1210Pro synonymous SCRIB 1 82666 1.20969E-5 41333 0 6.37836E-5
8-144877678-T-A p.Asn1209Ile missense SCRIB 1 82610 1.21051E-5 41305 0 NA
8-144877690-C-A p.Gly1205Val missense SCRIB 1 82510 1.21197E-5 41255 0 NA
8-144877698-C-T p.Val1202Val splice_region+synonymous SCRIB 1 82328 1.21465E-5 41164 0 NA
8-144877705-G-A c.3604-5C>T splice_region SCRIB 1 82130 1.21758E-5 41065 0 1.22348E-5
8-144877706-AAG-A c.3604-8_3604-7delCT splice_region SCRIB 2 82106 2.43588E-5 41053 0 NA
8-144885546-C-T c.3603+7G>A splice_region SCRIB 4 48602 8.23011E-5 24301 0 6.09236E-5
8-144885546-C-G c.3603+7G>C splice_region SCRIB 2 48602 4.11506E-5 24301 0 NA
8-144885547-G-A c.3603+6C>T splice_region SCRIB 38 48632 7.81379E-4 24316 0 0.00626566
8-144885557-A-C p.Leu1200Arg missense SCRIB 2 49352 4.05252E-5 24676 0 6.38203E-5
8-144885558-G-A p.Leu1200Leu synonymous SCRIB 1 49294 2.02864E-5 24647 0 4.86145E-5
8-144885563-G-C p.Ala1198Gly missense SCRIB 4 49298 8.11392E-5 24649 0 6.3804E-5
8-144885564-C-T p.Ala1198Thr missense SCRIB 2 49156 4.06868E-5 24578 0 0.00151822
8-144885565-G-A p.Asp1197Asp synonymous SCRIB 1 49284 2.02906E-5 24642 0 1.92612E-4
8-144885567-C-T p.Asp1197Asn missense SCRIB 1 49284 2.02906E-5 24642 0 4.79037E-6
8-144885568-G-A p.Thr1196Thr synonymous SCRIB 3 49222 6.09484E-5 24611 0 4.76313E-6
8-144885579-C-G p.Glu1193Gln missense SCRIB 2 49450 4.04449E-5 24725 0 6.92042E-5
8-144885580-A-G p.Phe1192Phe synonymous SCRIB 42078 46138 0.912003 23069 19249 0.935
8-144885585-C-T p.Gly1191Ser missense SCRIB 2 49880 4.00962E-5 24940 0 4.14685E-5
8-144885586-G-A p.Asp1190Asp synonymous SCRIB 2 49866 4.01075E-5 24933 0 5.26682E-5
8-144885597-G-C p.Leu1187Val missense SCRIB 46 49976 9.20442E-4 24988 0 0.0025
8-144885600-C-T p.Val1186Met missense SCRIB 6 49924 1.20183E-4 24962 0 5.07099E-4
8-144885600-C-A p.Val1186Leu missense SCRIB 1 49924 2.00304E-5 24962 0 NA
8-144885601-G-A p.Thr1185Thr synonymous SCRIB 81 49940 0.00162195 24970 0 0.00271132
8-144885608-G-C p.Thr1183Ser missense SCRIB 1 49986 2.00056E-5 24993 0 NA
8-144885613-G-A p.Gly1181Gly synonymous SCRIB 3 49892 6.01299E-5 24946 0 7.41463E-5
8-144885620-C-T p.Ser1179Asn missense SCRIB 1 50482 1.9809E-5 25241 0 0.0015213
8-144885621-T-C p.Ser1179Gly missense SCRIB 1 50400 1.98413E-5 25200 0 4.20849E-5
8-144885628-C-G p.Leu1176Leu synonymous SCRIB 1 50480 1.98098E-5 25240 0 NA
8-144885634-C-T p.Val1174Val synonymous SCRIB 1 50776 1.96943E-5 25388 0 6.38284E-5
8-144885637-C-T p.Ala1173Ala synonymous SCRIB 7 50858 1.37638E-4 25429 0 1.59673E-4
8-144885638-G-A p.Ala1173Val missense SCRIB 1 50734 1.97106E-5 25367 0 1.04297E-5
8-144885641-T-A p.Glu1172Val missense SCRIB 2 50838 3.93407E-5 25419 0 4.46054E-6
8-144885646-G-A p.His1170His synonymous SCRIB 2 51028 3.91942E-5 25514 0 5.13959E-5
8-144885649-C-T p.Thr1169Thr synonymous SCRIB 2 50922 3.92758E-5 25461 0 9.20321E-5
8-144885650-G-A p.Thr1169Met missense SCRIB 2 51206 3.90579E-5 25603 0 1.02162E-5
8-144885663-G-A p.Leu1165Leu synonymous SCRIB 1 51338 1.94787E-5 25669 0 3.19142E-5
8-144885665-C-T p.Ser1164Asn missense SCRIB 1 51266 1.95061E-5 25633 0 6.25E-4
8-144885668-T-C p.Gln1163Arg missense SCRIB 1 51278 1.95015E-5 25639 0 4.00024E-5
8-144885669-G-C p.Gln1163Glu missense SCRIB 19 51152 3.71442E-4 25576 0 0.00183077
8-144885684-A-G p.Leu1158Leu synonymous SCRIB 1 50870 1.9658E-5 25435 0 NA
8-144885701-C-T p.Arg1152His missense SCRIB 31 49812 6.2234E-4 24906 0 0.00224143
8-144885702-G-A p.Arg1152Cys missense SCRIB 2 49406 4.04809E-5 24703 0 5.07614E-4
8-144885707-C-T p.Arg1150Gln missense SCRIB 11 48472 2.26935E-4 24236 0 5.07614E-4
8-144885711-C-T p.Gly1149Ser missense SCRIB 2 47904 4.17502E-5 23952 0 7.24698E-5
8-144885712-G-A p.Asp1148Asp synonymous SCRIB 6 47704 1.25776E-4 23852 0 3.2113E-4
8-144885714-C-T p.Asp1148Asn missense SCRIB 1 47372 2.11095E-5 23686 0 6.4189E-5
8-144885715-G-A p.Arg1147Arg synonymous SCRIB 4 47148 8.48392E-5 23574 0 6.25782E-4
8-144885717-G-A p.Arg1147Cys missense SCRIB 1 46778 2.13776E-5 23389 0 6.43666E-5
8-144885717-G-T p.Arg1147Ser missense SCRIB 1 46778 2.13776E-5 23389 0 NA
8-144885720-C-T p.Gly1146Arg missense SCRIB 4 46738 8.55835E-5 23369 0 0.00203252
8-144885727-C-T p.Gly1143Gly synonymous SCRIB 1 45914 2.17798E-5 22957 0 NA
8-144885730-C-T p.Thr1142Thr synonymous SCRIB 2 45582 4.3877E-5 22791 0 0.00101626
8-144885731-G-A p.Thr1142Met missense SCRIB 1 45418 2.20177E-5 22709 0 6.25782E-4
8-144885732-TGGGGCTCACCTGTGGGGAGACGTGGTATGGGAGAGACCTGTTGGGGGGTGGGGCCCAGGGCGGGCTGGGGTGGGG-T p.Val1139_Thr1142del splice_acceptor SCRIB 11 45362 2.42494E-4 22681 4 3.3521E-5
8-144885744-G-A c.3415-3C>T splice_region SCRIB 1 44430 2.25073E-5 22215 0 6.14205E-5
8-144885745-TGG-T c.3415-6_3415-5delCC splice_region SCRIB 1 44246 2.26009E-5 22123 0 NA
8-144885749-G-A c.3415-8C>T splice_region SCRIB 1 44036 2.27087E-5 22018 0 2.46433E-5
8-144885820-G-A p.Ser1137Ser synonymous SCRIB 1 45332 2.20595E-5 22666 0 NA
8-144885835-C-T p.Glu1132Glu synonymous SCRIB 1 46782 2.13757E-5 23391 0 NA
8-144885849-C-T p.Asp1128Asn missense SCRIB 4 48324 8.27746E-5 24162 0 6.42797E-5
8-144885850-G-A p.Arg1127Arg synonymous SCRIB 2 48586 4.11641E-5 24293 0 6.68896E-5
8-144885856-G-A p.Asn1125Asn synonymous SCRIB 1 50028 1.99888E-5 25014 0 1.07408E-5
8-144885864-C-T p.Ala1123Thr missense SCRIB 3 51000 5.88235E-5 25500 0 1.95881E-4
8-144885865-G-A p.His1122His synonymous SCRIB 1 51192 1.95343E-5 25596 0 3.21234E-5
8-144885867-G-A p.His1122Tyr missense SCRIB 1 51712 1.93379E-5 25856 0 6.38196E-4
8-144885880-C-T p.Gly1117Gly synonymous SCRIB 5 54398 9.19151E-5 27199 0 1.35269E-4
8-144885882-C-T p.Gly1117Arg missense SCRIB 1 54578 1.83224E-5 27289 0 NA
8-144885883-G-A p.Arg1116Arg synonymous SCRIB 1 54500 1.83486E-5 27250 0 2.97197E-5
8-144885884-C-T p.Arg1116His missense SCRIB 2 54994 3.63676E-5 27497 0 NA
8-144885885-G-A p.Arg1116Cys missense SCRIB 3 55454 5.40989E-5 27727 0 4.86789E-6
8-144885889-G-T p.Ser1114Arg missense SCRIB 1 56870 1.7584E-5 28435 0 NA
8-144885889-G-A p.Ser1114Ser synonymous SCRIB 1 56870 1.7584E-5 28435 0 NA
8-144885900-G-C p.Leu1111Val missense SCRIB 1 59282 1.68685E-5 29641 0 NA
8-144885925-G-A p.Cys1102Cys synonymous SCRIB 1 63044 1.58619E-5 31522 0 NA
8-144885935-C-T p.Arg1099Gln missense SCRIB 1 64108 1.55987E-5 32054 0 4.5685E-5
8-144885936-G-A p.Arg1099Trp missense SCRIB 4 64276 6.22316E-5 32138 0 2.27195E-5
8-144885951-C-G p.Ala1094Pro missense SCRIB 1 64988 1.53875E-5 32494 0 NA
8-144885952-C-T p.Pro1093Pro synonymous SCRIB 1 65406 1.52891E-5 32703 0 3.26897E-5
8-144885953-G-A p.Pro1093Leu missense SCRIB 2 65492 3.05381E-5 32746 0 3.25641E-5
8-144885962-C-T p.Arg1090Gln missense SCRIB 1 66866 1.49553E-5 33433 0 6.39223E-5
8-144885976-C-G p.Leu1085Leu synonymous SCRIB 1 68352 1.46301E-5 34176 0 NA
8-144885978-G-A p.Leu1085Leu synonymous SCRIB 1 68466 1.46058E-5 34233 0 NA
8-144885992-C-T p.Arg1080Gln missense SCRIB 1 69040 1.44844E-5 34520 0 5.04541E-4
8-144885993-G-A p.Arg1080Trp missense SCRIB 2 69410 2.88143E-5 34705 0 2.1718E-5
8-144885996-G-A p.Leu1079Phe missense SCRIB 1 69754 1.43361E-5 34877 0 NA
8-144886017-G-C p.Gln1072Glu missense SCRIB 2 71616 2.79267E-5 35808 0 3.19305E-5
8-144886021-C-T p.Thr1070Thr synonymous SCRIB 3 71812 4.17757E-5 35906 0 2.58005E-5
8-144886022-G-A p.Thr1070Met missense SCRIB 4 72300 5.5325E-5 36150 0 5.05561E-4
8-144886028-TC-T p.Asp1068fs frameshift SCRIB 1 73372 1.36292E-5 36686 0 NA
8-144886030-C-G p.Arg1067Arg synonymous SCRIB 4 73746 5.42402E-5 36873 0 3.82656E-4
8-144886031-C-T p.Arg1067Gln missense SCRIB 3 73864 4.06152E-5 36932 0 2.6588E-5
8-144886032-G-A p.Arg1067Trp missense SCRIB 2 73926 2.70541E-5 36963 0 6.73982E-5
8-144886035-C-A p.Val1066Leu missense SCRIB 1 74498 1.34232E-5 37249 0 NA
8-144886035-C-T p.Val1066Met missense SCRIB 1 74498 1.34232E-5 37249 0 1.35881E-5
8-144886042-C-A p.Gly1063Gly synonymous SCRIB 1 75536 1.32387E-5 37768 0 NA
8-144886043-C-T p.Gly1063Glu missense SCRIB 1 75754 1.32006E-5 37877 0 NA
8-144886045-G-A p.Asn1062Asn synonymous SCRIB 4 76008 5.2626E-5 38004 0 3.19387E-5
8-144886048-C-A p.Val1061Val synonymous SCRIB 1 76758 1.3028E-5 38379 0 NA
8-144886062-G-A p.Arg1057Cys missense SCRIB 1 77906 1.2836E-5 38953 0 4.66858E-5
8-144886073-C-T p.Arg1053Gln missense SCRIB 1 78696 1.27071E-5 39348 0 3.19101E-5
8-144886074-G-A p.Arg1053Trp missense SCRIB 3 78606 3.8165E-5 39303 0 3.19183E-5
8-144886077-G-A p.Leu1052Leu synonymous SCRIB 3 78868 3.80382E-5 39434 0 0.00101523
8-144886080-C-T p.Gly1051Ser missense SCRIB 1 78992 1.26595E-5 39496 0 3.15876E-5
8-144886082-C-A p.Ser1050Ile missense SCRIB 1 79212 1.26243E-5 39606 0 NA
8-144886083-T-C p.Ser1050Gly missense SCRIB 1 79270 1.26151E-5 39635 0 4.76277E-6
8-144886085-C-T p.Arg1049His missense SCRIB 5 79272 6.3074E-5 39636 0 0.00101523
8-144886086-G-C p.Arg1049Gly missense SCRIB 1 79316 1.26078E-5 39658 0 3.19224E-5
8-144886086-G-A p.Arg1049Cys missense SCRIB 1 79316 1.26078E-5 39658 0 3.20338E-5
8-144886089-C-T p.Ala1048Thr missense SCRIB 1 79388 1.25964E-5 39694 0 1.29714E-4
8-144886090-G-A p.Ala1047Ala synonymous SCRIB 3 79630 3.76742E-5 39815 0 6.38081E-5
8-144886100-C-T p.Arg1044Gln missense SCRIB 6 80266 7.47514E-5 40133 0 1.34803E-4
8-144886101-G-A p.Arg1044Trp missense SCRIB 10 80260 1.24595E-4 40130 0 0.00101833
8-144886102-C-T p.Pro1043Pro synonymous SCRIB 3 80354 3.73348E-5 40177 0 6.25782E-4
8-144886107-G-A p.Leu1042Phe missense SCRIB 1 80706 1.23907E-5 40353 0 3.1902E-5
8-144886108-CACCTGTCAGGGAGGAGGGTGGCAGCTGGTGGCTGAGGCCGCGCTGACCTGCGCTGGTACCTGGGATGGGTGCACCTCTCACAGAACCGCCTGGATGGGCCGCCCT-C p.Val1041fs frameshift SCRIB 2 80684 2.47881E-5 40342 0 NA
8-144886115-CAGGGAGG-C c.3121-12_3121-6delCCTCCCT splice_region SCRIB 1 80900 1.23609E-5 40450 0 NA
8-144886208-C-T c.3120+8G>A splice_region SCRIB 2 82260 2.43132E-5 41130 0 3.18898E-5
8-144886210-C-A c.3120+6G>T splice_region SCRIB 2 82292 2.43037E-5 41146 0 NA
8-144886216-C-T p.Lys1040Lys splice_region+synonymous SCRIB 1 82438 1.21303E-5 41219 0 NA
8-144886217-T-G p.Lys1040Thr missense+splice_region SCRIB 4 82456 4.85107E-5 41228 0 9.5645E-5
8-144886220-G-A p.Ser1039Phe missense SCRIB 2 82476 2.42495E-5 41238 0 1.96048E-5
8-144886224-T-C p.Ile1038Val missense SCRIB 3 82514 3.63575E-5 41257 0 1.92912E-5
8-144886225-G-A p.Phe1037Phe synonymous SCRIB 1 82528 1.21171E-5 41264 0 3.18857E-5
8-144886234-A-G p.Pro1034Pro synonymous SCRIB 5 82548 6.05708E-5 41274 0 0.00100705
8-144886235-G-A p.Pro1034Leu missense SCRIB 2 82544 2.42295E-5 41272 0 2.01091E-5
8-144886236-G-C p.Pro1034Ala missense SCRIB 1 82530 1.21168E-5 41265 0 3.18756E-5
8-144886236-G-A p.Pro1034Ser missense SCRIB 2 82530 2.42336E-5 41265 0 1.60891E-5
8-144886243-G-A p.Val1031Val synonymous SCRIB 1 82584 1.21089E-5 41292 0 4.01419E-6
8-144886252-C-T p.Pro1028Pro synonymous SCRIB 5 82574 6.05517E-5 41287 0 6.25E-4
8-144886253-G-A p.Pro1028Leu missense SCRIB 1 82572 1.21106E-5 41286 0 3.18776E-5
8-144886255-G-A p.His1027His synonymous SCRIB 1 82582 1.21092E-5 41291 0 NA
8-144886265-T-C p.His1024Arg missense SCRIB 7 82578 8.47683E-5 41289 0 NA
8-144886269-C-T p.Asp1023Asn missense SCRIB 7 82544 8.48033E-5 41272 0 6.30701E-4
8-144886270-G-A p.Ser1022Ser synonymous SCRIB 3 82558 3.63381E-5 41279 0 0.0015121
8-144886271-G-C p.Ser1022Cys missense SCRIB 3 82576 3.63302E-5 41288 0 0.00100806
8-144886272-A-T p.Ser1022Thr missense SCRIB 1 82566 1.21115E-5 41283 0 NA
8-144886275-C-T p.Gly1021Ser missense SCRIB 1 82544 1.21148E-5 41272 0 NA
8-144886279-G-A p.Val1019Val synonymous SCRIB 1 82540 1.21153E-5 41270 0 2.40865E-5
8-144886296-G-A p.Leu1014Leu synonymous SCRIB 2 82462 2.42536E-5 41231 0 3.18654E-5
8-144886296-G-C p.Leu1014Val missense SCRIB 1 82462 1.21268E-5 41231 0 NA
8-144886297-A-G p.Pro1013Pro synonymous SCRIB 1 82450 1.21286E-5 41225 0 NA
8-144886298-G-A p.Pro1013Leu missense SCRIB 9 82438 1.09173E-4 41219 0 5.2402E-5
8-144886301-C-T p.Gly1012Asp missense SCRIB 1 82374 1.21398E-5 41187 0 4.03916E-6
8-144886308-C-T p.Ala1010Thr missense SCRIB 1 82292 1.21518E-5 41146 0 1.21644E-5
8-144886309-T-C p.Arg1009Arg synonymous SCRIB 7 82278 8.50774E-5 41139 1 2.55379E-4
8-144886313-G-A p.Pro1008Leu missense SCRIB 1 82188 1.21672E-5 41094 0 NA
8-144886319-C-T p.Arg1006His missense SCRIB 3 82016 3.65782E-5 41008 0 2.16901E-5
8-144886320-G-A p.Arg1006Cys missense SCRIB 3 81974 3.6597E-5 40987 0 9.56511E-5
8-144886321-G-T p.Ile1005Ile synonymous SCRIB 1 81982 1.21978E-5 40991 0 1.43611E-4
8-144886324-C-T p.Glu1004Glu splice_region+synonymous SCRIB 2 81906 2.44182E-5 40953 0 6.37552E-5
8-144886754-C-T p.Gly998Glu missense SCRIB 4 60282 6.63548E-5 30141 0 1.91339E-4
8-144886758-C-G p.Glu997Gln missense SCRIB 1 60610 1.64989E-5 30305 0 8.40195E-5
8-144886762-C-T p.Ala995Ala synonymous SCRIB 3 60806 4.93372E-5 30403 0 NA
8-144886764-C-T p.Ala995Thr missense SCRIB 3 60840 4.93097E-5 30420 0 2.37982E-5
8-144886765-G-A p.Ala994Ala synonymous SCRIB 1 61150 1.63532E-5 30575 0 NA
8-144886779-TGGGGGCCAGGCTCGGCAACCCAGGCACCCC-T p.Gly980_Pro989del conservative_inframe_deletion SCRIB 2 62718 3.18888E-5 31359 0 NA
8-144886782-GG-TT p.AlaPro988AlaThr missense SCRIB 1 62792 1.59256E-5 31396 0 NA
8-144886793-G-C p.Pro985Arg missense SCRIB 2 63414 3.15388E-5 31707 0 5.84488E-5
8-144886794-G-A p.Pro985Ser missense SCRIB 1 63812 1.5671E-5 31906 0 NA
8-144886802-G-T p.Pro982His missense SCRIB 1 65198 1.53379E-5 32599 0 NA
8-144886804-C-T p.Val981Val synonymous SCRIB 146 65054 0.00224429 32527 2 9.23251E-4
8-144886807-C-G p.Gly980Gly synonymous SCRIB 3 65860 4.55512E-5 32930 0 3.19795E-5
8-144886809-C-T p.Gly980Arg missense SCRIB 4122 65818 0.0626272 32909 137 0.095625
8-144886810-G-A p.Pro979Pro synonymous SCRIB 4 66670 5.9997E-5 33335 0 6.39018E-5
8-144886812-G-C p.Pro979Ala missense SCRIB 1 67462 1.48232E-5 33731 0 NA
8-144886833-T-C p.Thr972Ala missense SCRIB 1 71488 1.39884E-5 35744 0 NA
8-144886842-C-T p.Val969Ile missense SCRIB 1 73038 1.36915E-5 36519 0 1.10877E-5
8-144886847-G-A p.Ala967Val missense SCRIB 1 73750 1.35593E-5 36875 0 1.11037E-4
8-144886849-G-A p.Thr966Thr synonymous SCRIB 2 73980 2.70343E-5 36990 0 1.10978E-5
8-144886853-G-A p.Pro965Leu missense SCRIB 1 74858 1.33586E-5 37429 0 1.10744E-5
8-144886854-G-T p.Pro965Thr missense SCRIB 2 74960 2.66809E-5 37480 0 NA
8-144886857-G-T p.Pro964Thr missense SCRIB 1 75284 1.3283E-5 37642 0 1.10644E-5
8-144886857-G-A p.Pro964Ser missense SCRIB 1 75286 1.32827E-5 37643 0 NA
8-144886868-G-A p.Pro960Leu missense SCRIB 5 76654 6.52282E-5 38327 0 0.00253036
8-144886868-G-C p.Pro960Arg missense SCRIB 1 76654 1.30456E-5 38327 0 NA
8-144886872-G-A p.Leu959Leu synonymous SCRIB 2 77112 2.59363E-5 38556 0 5.07099E-4
8-144886874-G-A p.Pro958Leu missense SCRIB 3 77314 3.88028E-5 38657 0 6.40164E-5
8-144886885-A-C p.Leu954Leu synonymous SCRIB 1 78284 1.2774E-5 39142 0 0.00101626
8-144886887-G-A p.Leu954Phe missense SCRIB 3 78560 3.81874E-5 39280 0 3.40337E-5
8-144886896-C-A p.Gly951Trp missense SCRIB 4 79230 5.04859E-5 39615 0 6.39795E-5
8-144886900-C-A p.Glu949Asp missense SCRIB 1 79506 1.25777E-5 39753 0 1.15356E-5
8-144886904-C-T p.Arg948Gln missense SCRIB 1 79900 1.25156E-5 39950 0 4.3352E-6
8-144886912-C-A p.Leu945Leu synonymous SCRIB 1 80374 1.24418E-5 40187 0 NA
8-144886917-G-A p.Leu944Leu synonymous SCRIB 1 80488 1.24242E-5 40244 0 3.19509E-5
8-144886920-C-T p.Ala943Thr missense SCRIB 1 80440 1.24316E-5 40220 0 2.54585E-5
8-144886920-C-A p.Ala943Ser missense SCRIB 3 80442 3.7294E-5 40221 0 2.23857E-4
8-144886921-G-A p.Ile942Ile synonymous SCRIB 9 80556 1.11724E-4 40278 0 3.50459E-5
8-144886926-T-TG p.Thr941fs frameshift SCRIB 1 80594 1.24079E-5 40297 0 NA
8-144886927-G-A p.Pro940Pro synonymous SCRIB 35 80652 4.33963E-4 40326 0 0.00124513
8-144886927-G-C p.Pro940Pro synonymous SCRIB 3 80652 3.71968E-5 40326 0 2.35999E-5
8-144886927-G-T p.Pro940Pro synonymous SCRIB 1 80650 1.23993E-5 40325 0 2.35999E-5
8-144886928-G-T p.Pro940His missense SCRIB 3 80658 3.71941E-5 40329 0 2.35593E-5
8-144886929-G-A p.Pro940Ser missense SCRIB 1 80706 1.23907E-5 40353 0 1.18915E-5
8-144886933-G-A p.Ala938Ala synonymous SCRIB 1 80756 1.2383E-5 40378 0 0.00152439
8-144886939-G-A p.Thr936Thr synonymous SCRIB 2 80768 2.47623E-5 40384 0 6.39223E-5
8-144886953-C-T p.Val932Ile missense SCRIB 2 80922 2.47152E-5 40461 0 3.20369E-5
8-144886955-G-A p.Ala931Val missense SCRIB 1 80916 1.23585E-5 40458 0 NA
8-144886956-C-T p.Ala931Thr missense SCRIB 1 80902 1.23606E-5 40451 0 6.5812E-5
8-144886957-G-A p.His930His synonymous SCRIB 2 80922 2.47152E-5 40461 0 1.44535E-4
8-144886972-C-G p.Glu925Asp missense SCRIB 5 80854 6.18399E-5 40427 0 7.25963E-5
8-144886974-C-T p.Glu925Lys missense SCRIB 1 80826 1.23723E-5 40413 0 NA
8-144886976-G-A p.Thr924Ile missense SCRIB 1 80800 1.23762E-5 40400 0 NA
8-144886995-TCTGTGAGAGCGTGCCCGAATCAGGGAGGCCCAAGGGCAGAAGGGGACAGAGGGCGCGGGGCGGGGCAGGGGGGATGGGTGGGTGGGGCGGGGCCCCATCCCCACTCAC-T c.2751+1_2752-1del splice_acceptor SCRIB 6 80416 7.4612E-5 40208 0 NA
8-144886995-TCTGTGAGAGCGTGCCCGAATCAGGGAGGCCCAAGGGCAGAAGGGGACAGAGGGCGCGGGGCGGGGCAGGGGGGATGGGTGGGTGGGGCGGGGCCCCATCCCCACTCACAGAGAGGACGCGGTCGCCAAC-T p.Val911_Ser917del splice_acceptor SCRIB 1 80418 1.2435E-5 40209 0 NA
8-144887000-G-A c.2752-5C>T splice_region SCRIB 1 80208 1.24676E-5 40104 0 3.21999E-5
8-144887002-G-A c.2752-7C>T splice_region SCRIB 1 80170 1.24735E-5 40085 0 NA
8-144887002-G-C c.2752-7C>G splice_region SCRIB 6 80170 7.4841E-5 40085 0 3.59234E-5
8-144887003-A-G c.2752-8T>C splice_region SCRIB 1 80090 1.2486E-5 40045 0 3.23646E-5
8-144887103-C-G c.2751+1G>C splice_donor SCRIB 1 73678 1.35726E-5 36839 0 NA
8-144887105-G-A p.Ser917Phe missense+splice_region SCRIB 1 73934 1.35256E-5 36967 0 NA
8-144887112-C-T p.Val915Ile missense SCRIB 13 74392 1.7475E-4 37196 0 0.00109361
8-144887113-G-A p.Arg914Arg synonymous SCRIB 1 74468 1.34286E-5 37234 0 5.32595E-5
8-144887114-C-A p.Arg914Leu missense SCRIB 1 74548 1.34142E-5 37274 0 3.14367E-4
8-144887118-C-T p.Asp913Asn missense SCRIB 1 74828 1.3364E-5 37414 0 1.12197E-5
8-144887119-G-A p.Gly912Gly synonymous SCRIB 1 74820 1.33654E-5 37410 0 NA
8-144887125-C-G p.Gln910His missense SCRIB 5 75388 6.63236E-5 37694 0 3.19795E-5
8-144887130-G-A p.Leu909Leu synonymous SCRIB 1 75512 1.32429E-5 37756 0 1.58044E-5
8-144887130-G-C p.Leu909Val missense SCRIB 8 75512 1.05943E-4 37756 0 1.05363E-5
8-144887134-G-A p.Gly907Gly synonymous SCRIB 14 75570 1.85259E-4 37785 0 1.88324E-4
8-144887137-C-T p.Ala906Ala synonymous SCRIB 5 75656 6.60886E-5 37828 0 1.07296E-4
8-144887139-C-T p.Ala906Thr missense SCRIB 1 75578 1.32314E-5 37789 0 3.43289E-5
8-144887140-G-A p.Arg905Arg synonymous SCRIB 14 75642 1.85082E-4 37821 0 4.79417E-4
8-144887141-C-T p.Arg905His missense SCRIB 1 75676 1.32142E-5 37838 0 3.19673E-5
8-144887141-C-A p.Arg905Leu missense SCRIB 1 75676 1.32142E-5 37838 0 1.00637E-5
8-144887145-G-A p.His904Tyr missense SCRIB 1 75810 1.31909E-5 37905 0 NA
8-144887158-C-G p.Glu899Asp missense SCRIB 1 76034 1.3152E-5 38017 0 2.90293E-5
8-144887160-C-T p.Glu899Lys missense SCRIB 3 76024 3.94612E-5 38012 0 8.69817E-5
8-144887161-G-A p.Ala898Ala synonymous SCRIB 3 76072 3.94363E-5 38036 0 1.00176E-5
8-144887163-C-G p.Ala898Pro missense SCRIB 1 76134 1.31347E-5 38067 0 NA
8-144887175-C-T p.Val894Ile missense SCRIB 8 76194 1.04995E-4 38097 0 3.1957E-5
8-144887175-C-G p.Val894Leu missense SCRIB 6 76196 7.87443E-5 38098 0 NA
8-144887176-G-A p.Phe893Phe synonymous SCRIB 1 76242 1.31161E-5 38121 0 2.99796E-5
8-144887183-CCCTGCAGGGGAGGGTGGAGGAGGCAGGGCTGCCGGTGAGGCTGGAGTGCGGCTGTCAGCTCTAGAGCAGCCCTCCCCGGCCCTGGGCCCCAGCCTCA-C p.Gly891fs frameshift SCRIB 9 76266 1.18008E-4 38133 3 NA
8-144887189-A-G c.2671-5T>C splice_region SCRIB 1 76308 1.31048E-5 38154 0 2.36245E-4
8-144887283-G-A p.Ala890Val missense+splice_region SCRIB 1 76996 1.29877E-5 38498 0 0.00151668
8-144887285-A-G p.Asp889Asp synonymous SCRIB 67 77088 8.69137E-4 38544 0 8.82625E-4
8-144887288-A-G p.Gly888Gly synonymous SCRIB 1 77194 1.29544E-5 38597 0 4.00352E-5
8-144887296-T-G p.Arg886Arg synonymous SCRIB 1 77272 1.29413E-5 38636 0 3.80276E-5
8-144887322-G-A p.Ala877Val missense SCRIB 2 77292 2.58759E-5 38646 0 4.64831E-6
8-144887327-G-A p.Ser875Ser synonymous SCRIB 2 77276 2.58813E-5 38638 0 NA
8-144887328-C-G p.Ser875Thr missense SCRIB 2 77280 2.58799E-5 38640 0 NA
8-144887340-C-G p.Gly871Ala missense SCRIB 1 77100 1.29702E-5 38550 0 1.43059E-5
8-144887347-C-T p.Glu869Lys missense SCRIB 3 77014 3.8954E-5 38507 0 6.28669E-5
8-144887348-G-A p.Ser868Ser synonymous SCRIB 1 76958 1.29941E-5 38479 0 3.19734E-5
8-144887353-G-A p.Arg867Cys missense SCRIB 7 76924 9.09989E-5 38462 0 5.62414E-5
8-144887355-G-A p.Ala866Val missense SCRIB 2 76902 2.60071E-5 38451 0 NA
8-144887360-G-A p.Cys864Cys synonymous SCRIB 1 76842 1.30137E-5 38421 0 NA
8-144887366-C-T p.Val862Val synonymous SCRIB 1 76716 1.30351E-5 38358 0 NA
8-144887368-C-T p.Val862Met missense SCRIB 1 76654 1.30456E-5 38327 0 8.48148E-5
8-144887371-G-T p.His861Asn missense SCRIB 1 76612 1.30528E-5 38306 0 3.66515E-5
8-144887372-G-A p.Arg860Arg synonymous SCRIB 2 76578 2.61172E-5 38289 0 5.51005E-5
8-144887373-C-T p.Arg860His missense SCRIB 2 76530 2.61335E-5 38265 0 3.77644E-5
8-144887374-G-A p.Arg860Cys missense SCRIB 1 76506 1.30709E-5 38253 0 5.93049E-5
8-144887386-G-C p.Pro856Ala missense SCRIB 1 75950 1.31666E-5 37975 0 NA
8-144887387-C-A p.Gly855Gly synonymous SCRIB 2 75886 2.63553E-5 37943 0 NA
8-144887388-C-A p.Gly855Val missense SCRIB 1 75866 1.31811E-5 37933 0 NA
8-144887389-C-T p.Gly855Arg missense SCRIB 2 75738 2.64068E-5 37869 0 6.16059E-6
8-144887390-G-A p.Pro854Pro synonymous SCRIB 9 75716 1.18865E-4 37858 0 9.59632E-5
8-144887393-G-A p.Ser853Ser synonymous SCRIB 100 75388 0.00132647 37694 0 0.00265583
8-144887394-C-A p.Ser853Ile missense SCRIB 6 75362 7.96157E-5 37681 0 1.04728E-4
8-144887399-A-G p.Pro851Pro synonymous SCRIB 4 74812 5.34674E-5 37406 0 1.60514E-4
8-144887402-C-T p.Pro850Pro synonymous SCRIB 3 73936 4.05756E-5 36968 0 6.41931E-5
8-144887403-G-A p.Pro850Leu missense SCRIB 1 74350 1.34499E-5 37175 0 0.00207039
8-144887413-G-C p.Pro847Ala missense SCRIB 1 72414 1.38095E-5 36207 0 3.20698E-5
8-144887416-G-A p.Leu846Leu synonymous SCRIB 6 71498 8.39184E-5 35749 0 0.00157233
8-144887418-C-T p.Arg845His missense SCRIB 2 69730 2.86821E-5 34865 0 NA
8-144887419-G-A p.Arg845Cys missense SCRIB 4 69160 5.78369E-5 34580 0 4.60723E-5
8-144887422-G-C p.Leu844Val missense SCRIB 1 68338 1.46331E-5 34169 0 0.0986141
8-144887422-G-A p.???141??? splice_region+synonymous SCRIB 3 68342 4.38969E-5 34171 0 2.33641E-5
8-144887426-C-T p.Gly842Gly synonymous SCRIB 1 69322 1.44254E-5 34661 0 NA
8-144887427-C-G p.Gly842Ala missense SCRIB 1 69182 1.44546E-5 34591 0 NA
8-144887428-C-T p.Gly842Arg missense SCRIB 11 68852 1.59763E-4 34426 0 5.13908E-4
8-144887429-T-C p.Gly841Gly synonymous SCRIB 12 66832 1.79555E-4 33416 0 0.262963
8-144887432-C-T p.Arg840Arg synonymous SCRIB 1 69848 1.43168E-5 34924 0 NA
8-144887433-C-T p.Arg840Gln missense SCRIB 4 69654 5.74267E-5 34827 0 3.75669E-5
8-144887434-G-A p.Arg840Trp missense SCRIB 2 71708 2.78909E-5 35854 0 1.62999E-4
8-144887436-C-T p.Arg839Gln missense SCRIB 2 71458 2.79885E-5 35729 0 0.00212766
8-144887437-G-A p.Arg839Trp missense SCRIB 3 74850 4.00802E-5 37425 0 5.40073E-5
8-144887442-C-T p.Arg837Gln missense SCRIB 3 75196 3.98957E-5 37598 0 5.27649E-5
8-144887444-G-A p.Pro836Pro synonymous SCRIB 2 75268 2.65717E-5 37634 0 NA
8-144887459-C-T p.Glu831Glu synonymous SCRIB 1 74590 1.34066E-5 37295 0 NA
8-144887462-G-A p.Pro830Pro synonymous SCRIB 3 73886 4.06031E-5 36943 0 5.17063E-4
8-144887466-C-T p.Arg829Gln missense SCRIB 3 73088 4.10464E-5 36544 0 1.32443E-5
8-144887467-G-T p.Arg829Arg synonymous SCRIB 1 72712 1.37529E-5 36356 0 NA
8-144887470-G-A p.Leu828Leu synonymous SCRIB 13 72342 1.79702E-4 36171 0 5.43166E-4
8-144887471-C-A p.Pro827Pro synonymous SCRIB 1 72002 1.38885E-5 36001 0 NA
8-144887471-C-T p.Pro827Pro synonymous SCRIB 1 72002 1.38885E-5 36001 0 NA
8-144887479-T-C p.Ile825Val missense SCRIB 2 70670 2.83006E-5 35335 0 NA
8-144887483-G-A p.Val823Val synonymous SCRIB 1 69752 1.43365E-5 34876 0 6.76471E-6
8-144887486-C-T p.Ala822Ala synonymous SCRIB 2 69074 2.89545E-5 34537 0 1.20453E-4
8-144887507-G-A p.Arg815Arg synonymous SCRIB 2 63914 3.1292E-5 31957 0 1.40176E-5
8-144887508-C-T p.Arg815His missense SCRIB 3 63668 4.71194E-5 31834 0 0.00312175
8-144887523-C-T p.Arg810Gln missense SCRIB 2 64838 3.08461E-5 32419 0 2.56203E-5
8-144887527-T-A p.Met809Leu missense SCRIB 1 64210 1.55739E-5 32105 0 5.68828E-5
8-144887528-C-A p.Gln808His missense SCRIB 5 64260 7.78089E-5 32130 0 1.71939E-4
8-144887533-C-T p.Val807Met missense SCRIB 2 63318 3.15866E-5 31659 0 2.39866E-4
8-144887534-G-A p.Ala806Ala synonymous SCRIB 7 63136 1.10872E-4 31568 0 1.18977E-4
8-144887538-G-A p.Thr805Ile missense SCRIB 1 62482 1.60046E-5 31241 0 NA
8-144887541-C-T p.Gly804Asp missense SCRIB 1 61514 1.62565E-5 30757 0 6.49857E-6
8-144887542-C-T p.Gly804Ser missense SCRIB 6 61136 9.81418E-5 30568 0 0.00206825
8-144887545-C-T p.Ala803Thr missense SCRIB 1 60516 1.65246E-5 30258 0 3.19081E-5
8-144887564-G-A p.Ala796Ala synonymous SCRIB 8 57122 1.40051E-4 28561 0 1.37061E-4
8-144887569-C-T p.Glu795Lys missense SCRIB 3 56078 5.34969E-5 28039 0 7.16846E-5
8-144887570-G-A p.His794His synonymous SCRIB 1 55872 1.78981E-5 27936 0 6.73673E-6
8-144887572-G-A p.His794Tyr missense SCRIB 1 55660 1.79662E-5 27830 0 NA
8-144887578-C-G p.Glu792Gln missense SCRIB 1 54308 1.84135E-5 27154 0 NA
8-144887581-C-T p.Ala791Thr missense SCRIB 1 53526 1.86825E-5 26763 0 2.44738E-4
8-144887582-G-A p.Gly790Gly synonymous SCRIB 5 52850 9.46074E-5 26425 0 2.55145E-4
8-144887597-A-G p.Gly785Gly synonymous SCRIB 2 51418 3.88969E-5 25709 0 0.00260146
8-144887609-C-T c.2347-4G>A splice_region SCRIB 2 49180 4.06669E-5 24590 0 3.1902E-5
8-144887609-C-A c.2347-4G>T splice_region SCRIB 1 49180 2.03335E-5 24590 0 NA
8-144887610-G-A c.2347-5C>T splice_region SCRIB 3 49206 6.09682E-5 24603 0 1.21124E-4
8-144888569-C-T c.2346+8G>A splice_region SCRIB 2 81318 2.45948E-5 40659 0 3.18939E-5
8-144888570-G-A c.2346+7C>T splice_region SCRIB 5 81338 6.14719E-5 40669 0 4.07708E-4
8-144888580-C-T p.Leu781Leu synonymous SCRIB 39 81528 4.78363E-4 40764 0 0.00201816
8-144888599-C-T p.Arg775His missense SCRIB 3 81584 3.67719E-5 40792 0 1.71262E-5
8-144888600-G-A p.Arg775Cys missense SCRIB 1 81556 1.22615E-5 40778 0 3.18756E-5
8-144888611-C-T p.Arg771Gln missense SCRIB 3 81582 3.67728E-5 40791 0 2.71315E-4
8-144888612-G-A p.Arg771Trp missense SCRIB 1 81572 1.22591E-5 40786 0 5.14262E-5
8-144888614-G-A p.Ala770Val missense SCRIB 1 81582 1.22576E-5 40791 0 9.56023E-5
8-144888616-C-T p.Ala769Ala synonymous SCRIB 1 81568 1.22597E-5 40784 0 1.70631E-5
8-144888620-G-A p.Pro768Leu missense SCRIB 1 81554 1.22618E-5 40777 0 NA
8-144888630-C-T p.Glu765Lys missense SCRIB 2 81490 2.45429E-5 40745 0 2.17962E-5
8-144888631-G-A p.Ser764Ser synonymous SCRIB 13 81448 1.59611E-4 40724 0 5.6144E-4
8-144888634-C-T p.Val763Val synonymous SCRIB 27 81434 3.31557E-4 40717 0 0.00252611
8-144888637-C-T p.Arg762Arg synonymous SCRIB 1 81408 1.22838E-5 40704 0 1.92909E-5
8-144888655-C-G c.2269-1G>C splice_acceptor SCRIB 1 81184 1.23177E-5 40592 0 NA
8-144888659-G-A c.2269-5C>T splice_region SCRIB 1 81074 1.23344E-5 40537 0 6.37267E-5
8-144888660-G-A c.2269-6C>T splice_region SCRIB 2 81032 2.46816E-5 40516 0 2.32234E-5
8-144889091-C-T c.2268+3G>A splice_region SCRIB 1 81694 1.22408E-5 40847 0 5.89122E-5
8-144889096-C-T p.Glu756Lys missense+splice_region SCRIB 2 81800 2.44499E-5 40900 0 1.64178E-5
8-144889099-C-T p.Asp755Asn missense SCRIB 1 81860 1.2216E-5 40930 0 3.18674E-5
8-144889100-G-A p.Asp754Asp synonymous SCRIB 10 81886 1.22121E-4 40943 0 6.37714E-5
8-144889103-C-T p.Gly753Gly synonymous SCRIB 2 81996 2.43914E-5 40998 0 3.11798E-5
8-144889113-G-A p.Pro750Leu missense SCRIB 2 82082 2.43659E-5 41041 0 3.18776E-5
8-144889115-T-C p.Thr749Thr synonymous SCRIB 1 82028 1.2191E-5 41014 0 4.03388E-6
8-144889133-C-T p.Ala743Ala synonymous SCRIB 4 82144 4.8695E-5 41072 0 1.91131E-4
8-144889134-G-A p.Ala743Val missense SCRIB 3 82110 3.65364E-5 41055 0 4.02214E-6
8-144889136-A-G p.Ile742Ile synonymous SCRIB 1 82136 1.21749E-5 41068 0 3.18654E-5
8-144889138-T-C p.Ile742Val missense SCRIB 3 82140 3.6523E-5 41070 0 4.01577E-6
8-144889145-G-GC p.Ile740fs frameshift SCRIB 1 82140 1.21743E-5 41070 0 NA
8-144889145-G-A p.Gly739Gly synonymous SCRIB 1 82140 1.21743E-5 41070 0 NA
8-144889150-G-A p.Leu738Leu synonymous SCRIB 2 82120 2.43546E-5 41060 0 9.15081E-6
8-144889151-G-GCCC p.Gly737dup disruptive_inframe_insertion SCRIB 1 82094 1.21812E-5 41047 0 8.05121E-6
8-144889156-C-T p.Gly736Arg missense SCRIB 2 82082 2.43659E-5 41041 0 NA
8-144889157-A-G p.Thr735Thr synonymous SCRIB 1 82054 1.21871E-5 41027 0 9.11959E-6
8-144889164-C-G p.Arg733Pro missense SCRIB 1 82020 1.21921E-5 41010 0 NA
8-144889168-G-A p.Leu732Leu synonymous SCRIB 1 81980 1.21981E-5 40990 0 9.1083E-6
8-144889172-A-G p.Thr730Thr synonymous SCRIB 68269 76818 0.888711 38409 30456 0.928125
8-144889179-G-A p.Thr728Ile missense SCRIB 5 81820 6.11098E-5 40910 0 3.97106E-4
8-144889182-A-C p.Leu727Arg missense+splice_region SCRIB 1 81770 1.22294E-5 40885 0 1.10295E-5
8-144889183-G-T p.Leu727Met missense+splice_region SCRIB 1 81760 1.22309E-5 40880 0 3.3177E-5
8-144889186-G-A c.2179-3C>T splice_region SCRIB 1 81684 1.22423E-5 40842 0 NA
8-144889734-A-G p.Ile722Ile synonymous SCRIB 1 83162 1.20247E-5 41581 0 NA
8-144889738-C-T p.Arg721His missense SCRIB 1 83172 1.20233E-5 41586 0 NA
8-144889738-C-A p.Arg721Leu missense SCRIB 1 83172 1.20233E-5 41586 0 NA
8-144889740-A-G p.Ala720Ala synonymous SCRIB 6 83176 7.21362E-5 41588 0 6.25E-4
8-144889747-T-C p.Glu718Gly missense SCRIB 1 83182 1.20218E-5 41591 0 NA
8-144889758-G-A p.Asn714Asn synonymous SCRIB 2 83186 2.40425E-5 41593 0 3.19142E-5
8-144889767-C-T p.Gln711Gln synonymous SCRIB 1 83174 1.2023E-5 41587 0 NA
8-144889767-C-A p.Gln711His missense SCRIB 2 83174 2.4046E-5 41587 0 8.24416E-6
8-144889768-T-C p.Gln711Arg missense SCRIB 1 83174 1.2023E-5 41587 0 3.97709E-6
8-144889769-G-A p.Gln711* stop_gained SCRIB 1 83178 1.20224E-5 41589 0 NA
8-144889776-C-T p.Ser708Ser synonymous SCRIB 2 83134 2.40575E-5 41567 0 NA
8-144890780-T-C p.Lys705Arg missense+splice_region SCRIB 1 79594 1.25638E-5 39797 0 3.19081E-5
8-144890785-A-G p.Ser703Ser synonymous SCRIB 1 79722 1.25436E-5 39861 0 5.89699E-6
8-144890789-G-A p.Pro702Leu missense SCRIB 10 79788 1.25332E-4 39894 0 0.00101833
8-144890790-G-A p.Pro702Ser missense SCRIB 3 79840 3.75752E-5 39920 0 9.07573E-6
8-144890791-C-T p.Ala701Ala synonymous SCRIB 53 79778 6.64344E-4 39889 0 0.003125
8-144890792-G-A p.Ala701Val missense SCRIB 4 79808 5.01203E-5 39904 0 4.70207E-5
8-144890802-C-T p.Val698Met missense SCRIB 4 80002 4.99988E-5 40001 0 4.10167E-5
8-144890802-C-G p.Val698Leu missense SCRIB 2 80002 2.49994E-5 40001 0 5.09165E-4
8-144890803-G-A p.Ala697Ala synonymous SCRIB 1 79982 1.25028E-5 39991 0 1.17363E-5
8-144890809-C-T p.Glu695Glu synonymous SCRIB 7 80172 8.73123E-5 40086 0 NA
8-144890811-CCTT-C p.Lys694del conservative_inframe_deletion SCRIB 3 80244 3.7386E-5 40122 0 9.56816E-5
8-144890811-C-CCTTG p.Glu695fs frameshift SCRIB 1 80244 1.2462E-5 40122 0 NA
8-144890814-T-C p.Lys694Glu missense SCRIB 4 80286 4.98219E-5 40143 0 1.91351E-4
8-144890815-GTCC-G p.Glu692del disruptive_inframe_deletion SCRIB 5 80300 6.22665E-5 40150 0 1.27608E-4
8-144890817-C-T p.Asp693Asn missense SCRIB 3 80320 3.73506E-5 40160 0 1.72927E-5
8-144890818-C-T p.Glu692Glu synonymous SCRIB 1 80362 1.24437E-5 40181 0 NA
8-144890824-C-T p.Glu690Glu synonymous SCRIB 21 80452 2.61025E-4 40226 0 5.06073E-4
8-144890831-C-T p.Ser688Asn missense SCRIB 3 80556 3.72412E-5 40278 0 NA
8-144890836-C-T p.Glu686Glu synonymous SCRIB 1 80618 1.24042E-5 40309 0 NA
8-144890849-G-A p.Ala682Val missense SCRIB 3 80650 3.71978E-5 40325 0 1.81567E-5
8-144890850-C-T p.Ala682Thr missense SCRIB 1 80624 1.24033E-5 40312 0 6.3743E-5
8-144890852-C-T p.Arg681Lys missense SCRIB 7 80698 8.67432E-5 40349 0 3.18898E-5
8-144890857-TTCC-T p.Glu679del disruptive_inframe_deletion SCRIB 37 80658 4.58727E-4 40329 0 0.0010533
8-144890858-TCCTCCTCCTCCTCTA-T p.Val674_Glu678del disruptive_inframe_deletion SCRIB 13 80678 1.61134E-4 40339 0 1.72831E-4
8-144890858-T-C p.Glu679Gly missense SCRIB 1 80678 1.2395E-5 40339 0 1.59197E-5
8-144890859-C-T p.Glu679Lys missense SCRIB 1 80638 1.24011E-5 40319 0 NA
8-144890863-C-CTCCTCCTCT p.Glu677_Glu678insGluGluGlu disruptive_inframe_insertion SCRIB 1 80672 1.23959E-5 40336 0 9.0782E-6
8-144890866-C-T p.Glu676Glu synonymous SCRIB 3 80668 3.71895E-5 40334 0 3.06909E-5
8-144890867-TCCTCTACCTCCTCCTCCTGAGGACTAC-T p.Gly667_Glu675del disruptive_inframe_deletion SCRIB 7 80646 8.67991E-5 40323 0 1.83193E-4
8-144890868-C-G p.Glu676Gln missense SCRIB 1 80686 1.23937E-5 40343 0 3.18695E-5
8-144890869-C-T p.Glu675Glu synonymous SCRIB 2 80694 2.4785E-5 40347 0 9.07738E-6
8-144890872-T-C p.Val674Val synonymous SCRIB 1 80616 1.24045E-5 40308 0 4.98519E-6
8-144890872-TACC-T p.Val674del disruptive_inframe_deletion SCRIB 2 80618 2.48084E-5 40309 0 9.07968E-6
8-144890872-TACCTCCTCCTCCTGAGGACTACCCTCTTCCTCCTCC-T p.Glu663_Val674del disruptive_inframe_deletion SCRIB 1 80618 1.24042E-5 40309 0 NA
8-144890873-A-T p.Val674Glu missense SCRIB 70710 70750 0.999435 35375 35338 0.999904
8-144890873-A-C p.Val674Gly missense SCRIB 3 80548 3.72449E-5 40274 0 3.4623E-5
8-144890877-C-T p.Glu673Lys missense SCRIB 1 80578 1.24103E-5 40289 0 9.55977E-6
8-144890895-C-T p.Gly667Ser missense SCRIB 13 80374 1.61744E-4 40187 0 6.28141E-4
8-144890898-C-T p.Glu666Lys missense SCRIB 1 80420 1.24347E-5 40210 0 3.18573E-5
8-144890899-TTCC-T p.Glu665del disruptive_inframe_deletion SCRIB 11 79736 1.37955E-4 39868 0 0.00242091
8-144890899-T-TTCC p.Glu665dup disruptive_inframe_insertion SCRIB 44 80404 5.47236E-4 40202 0 8.036E-4
8-144890899-TTCCTCC-T p.Glu664_Glu665del disruptive_inframe_deletion SCRIB 6 80406 7.46213E-5 40203 0 9.03326E-6
8-144890907-C-T p.Glu663Lys missense SCRIB 2 80460 2.48571E-5 40230 0 1.34575E-4
8-144890911-C-T p.Glu661Glu synonymous SCRIB 2 80496 2.4846E-5 40248 0 8.75933E-6
8-144890913-C-T p.Glu661Lys missense SCRIB 1 80498 1.24227E-5 40249 0 NA
8-144890916-C-T p.Glu660Lys missense SCRIB 1 80504 1.24217E-5 40252 0 6.3743E-5
8-144890919-T-C p.Lys659Glu missense SCRIB 1 80444 1.2431E-5 40222 0 NA
8-144890924-G-A p.Ala657Val missense SCRIB 1 80242 1.24623E-5 40121 0 8.29545E-6
8-144890927-C-T p.Arg656Gln missense SCRIB 11 80372 1.36864E-4 40186 0 2.23271E-4
8-144890928-G-A p.Arg656Trp missense SCRIB 2 80400 2.48756E-5 40200 0 3.29913E-5
8-144890931-G-A p.Pro655Ser missense SCRIB 1 80430 1.24332E-5 40215 0 8.22531E-6
8-144890933-G-A p.Ala654Val missense SCRIB 2 80530 2.48355E-5 40265 0 1.23064E-5
8-144890940-G-C p.Pro652Ala missense SCRIB 1 80556 1.24137E-5 40278 0 8.63304E-6
8-144890943-C-T p.Ala651Thr missense SCRIB 5 80480 6.21272E-5 40240 0 8.98818E-5
8-144890944-G-A p.His650His synonymous SCRIB 1 80596 1.24076E-5 40298 0 3.66703E-5
8-144890944-G-C p.His650Gln missense SCRIB 1 80596 1.24076E-5 40298 0 NA
8-144890946-G-A p.His650Tyr missense SCRIB 1 80772 1.23805E-5 40386 0 4.07077E-6
8-144890947-G-A p.Pro649Pro synonymous SCRIB 1 80784 1.23787E-5 40392 0 NA
8-144890948-G-T p.Pro649His missense SCRIB 18 80762 2.22877E-4 40381 0 2.22954E-4
8-144890953-A-G p.Asn647Asn synonymous SCRIB 435 80964 0.00537276 40482 1 0.00531806
8-144890954-T-C p.Asn647Ser missense SCRIB 1 80984 1.23481E-5 40492 0 2.56441E-5
8-144890955-T-G p.Asn647His missense SCRIB 17 80974 2.09944E-4 40487 0 6.90838E-5
8-144890957-T-A p.His646Leu missense SCRIB 6 80948 7.41217E-5 40474 0 3.18979E-4
8-144890961-A-G p.Trp645Arg missense SCRIB 2 81014 2.46871E-5 40507 0 NA
8-144890962-G-A p.Gly644Gly synonymous SCRIB 1 80976 1.23493E-5 40488 0 8.5282E-6
8-144890963-C-A p.Gly644Val missense SCRIB 6 81062 7.40174E-5 40531 0 1.53411E-4
8-144890965-C-G p.Gly643Gly synonymous SCRIB 1 81196 1.23159E-5 40598 0 NA
8-144890967-C-T p.Gly643Arg