Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
12-123459276-G-A n.49+1G>A splice_donor OGFOD2 1 3152 3.17259E-4 1576 0 9.55597E-4
12-123459427-G-T c.-439G>T 5_prime_UTR_premature_start_codon_gain OGFOD2 1 3058 3.27011E-4 1529 0 6.69003E-4
12-123459613-C-T c.-253C>T 5_prime_UTR_premature_start_codon_gain OGFOD2 1 25046 3.99265E-5 12523 0 NA
12-123459668-G-GATCCTGCGCAGCCGAGGCTGTGTTAGCGCCAA c.-198_-198+1insATCCTGCGCAGCCGAGGCTGTGTTAGCGCCAA splice_donor OGFOD2 1 47476 2.10633E-5 23738 0 NA
12-123459668-G-T c.-198G>T splice_region OGFOD2 1 47476 2.10633E-5 23738 0 NA
12-123459800-T-G p.Met1? start_lost OGFOD2 3 61570 4.8725E-5 30785 0 7.76735E-6
12-123459801-G-T p.Met1? start_lost OGFOD2 1 61574 1.62406E-5 30787 0 NA
12-123459804-G-A p.Ala2Ala synonymous OGFOD2 1 61458 1.62713E-5 30729 0 3.18512E-5
12-123459808-G-A p.Val4Met missense OGFOD2 1 61436 1.62771E-5 30718 0 NA
12-123459809-TG-T p.Ala6fs frameshift OGFOD2 6 61416 9.76944E-5 30708 0 NA
12-123459809-T-TG p.Ala6fs frameshift OGFOD2 1 61416 1.62824E-5 30708 0 NA
12-123459810-G-T p.Val4Val synonymous OGFOD2 1 61438 1.62766E-5 30719 0 NA
12-123459815-C-T p.Ala6Val missense OGFOD2 6 60770 9.87329E-5 30385 0 6.37877E-5
12-123459816-T-C p.Ala6Ala synonymous OGFOD2 15 60700 2.47117E-4 30350 0 5.83885E-4
12-123459820-C-T p.Arg8Trp missense OGFOD2 1 60696 1.64756E-5 30348 0 9.56694E-5
12-123459826-T-A p.Phe10Ile missense OGFOD2 5 60908 8.2091E-5 30454 0 3.18776E-5
12-123459828-C-G p.Phe10Leu missense OGFOD2 6 60896 9.85286E-5 30448 0 6.05636E-4
12-123459828-C-T p.Phe10Phe synonymous OGFOD2 1 60896 1.64214E-5 30448 0 6.37511E-5
12-123459829-T-C p.Cys11Arg missense OGFOD2 1 60924 1.64139E-5 30462 0 NA
12-123459830-G-A p.Cys11Tyr missense OGFOD2 1 60868 1.6429E-5 30434 0 7.3828E-6
12-123459831-C-T p.Cys11Cys synonymous OGFOD2 2 60832 3.28774E-5 30416 0 2.21428E-5
12-123459832-C-T p.Arg12Cys missense OGFOD2 3 60860 4.92935E-5 30430 0 6.63091E-5
12-123459839-C-CCTGCTT p.Phe16_Cys17dup conservative_inframe_insertion OGFOD2 1 60886 1.64241E-5 30443 0 NA
12-123459846-C-G p.Phe16Leu missense OGFOD2 3 60922 4.92433E-5 30461 0 1.4583E-5
12-123459850-A-G p.Thr18Ala missense OGFOD2 3 60834 4.93145E-5 30417 0 8.86263E-4
12-123459852-C-G p.Thr18Thr synonymous OGFOD2 1 60846 1.64349E-5 30423 0 7.36811E-5
12-123459854-A-G p.Asp19Gly missense OGFOD2 1 60828 1.64398E-5 30414 0 NA
12-123459858-C-T p.Asn20Asn synonymous OGFOD2 1 60790 1.64501E-5 30395 0 7.30108E-6
12-123459882-G-A p.Leu28Leu synonymous OGFOD2 1 60268 1.65926E-5 30134 0 NA
12-123459890-G-A p.Arg31His missense OGFOD2 9 60120 1.49701E-4 30060 0 7.33439E-6
12-123459895-C-A p.Arg33Arg synonymous OGFOD2 1 60164 1.66212E-5 30082 0 NA
12-123459896-G-A p.Arg33Gln missense OGFOD2 1 60146 1.66262E-5 30073 0 3.18674E-5
12-123459907-C-G p.Gln37Glu missense OGFOD2 1 60230 1.6603E-5 30115 0 6.37227E-5
12-123459913-C-T p.Arg39Cys missense OGFOD2 1 59982 1.66717E-5 29991 0 1.47894E-5
12-123459914-G-A p.Arg39His missense OGFOD2 8 59624 1.34174E-4 29812 0 2.97128E-5
12-123459915-C-T p.Arg39Arg synonymous OGFOD2 14 59956 2.33505E-4 29978 0 0.00125823
12-123459923-A-G p.Tyr42Cys missense OGFOD2 4 60094 6.65624E-5 30047 0 3.18654E-5
12-123459930-G-A p.Pro44Pro splice_region+synonymous OGFOD2 8 60064 1.33191E-4 30032 0 2.54777E-4
12-123459935-G-A c.132+5G>A splice_region OGFOD2 1 60110 1.66362E-5 30055 0 3.18451E-5
12-123460090-G-A n.80G>A splice_region OGFOD2 1 43816 2.28227E-5 21908 0 NA
12-123460356-A-C c.133-2A>C splice_acceptor OGFOD2 1 62134 1.60942E-5 31067 0 NA
12-123460360-C-A p.Ile45Ile splice_region+synonymous OGFOD2 2 62162 3.2174E-5 31081 0 NA
12-123460365-G-T p.Arg47Leu missense OGFOD2 3 62178 4.82486E-5 31089 0 NA
12-123460366-C-T p.Arg47Arg synonymous OGFOD2 4 62206 6.43025E-5 31103 0 7.03037E-5
12-123460370-C-G p.Arg49Gly missense OGFOD2 2 62228 3.21399E-5 31114 0 6.37267E-5
12-123460375-C-T c.-180C>T 5_prime_UTR_premature_start_codon_gain OGFOD2 2 62256 3.21254E-5 31128 0 7.88304E-5
12-123460384-C-T p.Ser53Ser synonymous OGFOD2 1 62292 1.60534E-5 31146 0 7.1662E-6
12-123460397-C-T p.Gln58* stop_gained OGFOD2 16 62322 2.56731E-4 31161 0 8.59907E-5
12-123460405-G-C p.Leu60Leu synonymous OGFOD2 1 62302 1.60508E-5 31151 0 7.16599E-6
12-123460414-G-A c.-658G>A 5_prime_UTR_premature_start_codon_gain OGFOD2 1 62286 1.6055E-5 31143 0 NA
12-123460793-C-T c.-140-7C>T splice_region OGFOD2 3 76264 3.9337E-5 38132 0 1.2566E-4
12-123460798-AGGCTGCTGCCAG-A p.Arg67_Ala70del conservative_inframe_deletion OGFOD2 9 77330 1.16384E-4 38665 0 5.04847E-4
12-123460799-G-A c.-140-1G>A splice_acceptor OGFOD2 2 77462 2.58191E-5 38731 0 NA
12-123460808-C-A p.Ala66Ala synonymous OGFOD2 1 78528 1.27343E-5 39264 0 7.21501E-5
12-123460813-C-A p.Ala68Asp missense OGFOD2 1 78930 1.26695E-5 39465 0 6.10724E-5
12-123460817-T-G p.Ala69Ala synonymous OGFOD2 2 79278 2.52277E-5 39639 0 3.18654E-5
12-123460819-C-T p.Ala70Val missense OGFOD2 1 79440 1.25881E-5 39720 0 4.76781E-5
12-123460822-C-T p.Pro71Leu missense OGFOD2 60 79840 7.51503E-4 39920 0 0.0019598
12-123460822-CA-TG p.Pro71Leu missense OGFOD2 21 79844 2.63013E-4 39922 0 NA
12-123460822-C-G p.Pro71Arg missense OGFOD2 1 79844 1.25244E-5 39922 0 NA
12-123460823-A-G p.Pro71Pro synonymous OGFOD2 43530 63264 0.688069 31632 14522 0.785987
12-123460826-CCCT-C p.Pro76del conservative_inframe_deletion OGFOD2 1 80368 1.24428E-5 40184 0 2.62909E-5
12-123460831-C-T p.Pro74Leu missense OGFOD2 3 80722 3.71646E-5 40361 0 1.83606E-5
12-123460836-C-G p.Pro76Ala missense OGFOD2 3 81074 3.70032E-5 40537 0 1.26049E-5
12-123460846-G-C p.Gly79Ala missense OGFOD2 3 81458 3.68288E-5 40729 0 4.68169E-5
12-123460849-T-C p.Val80Ala missense OGFOD2 1 81536 1.22645E-5 40768 0 6.25E-4
12-123460855-G-T p.Gly82Val missense OGFOD2 1 81800 1.22249E-5 40900 0 2.86679E-4
12-123460859-G-A p.Gly83Gly synonymous OGFOD2 1 81996 1.21957E-5 40998 0 NA
12-123460862-G-A p.Lys84Lys synonymous OGFOD2 1 82054 1.21871E-5 41027 0 NA
12-123460866-C-T p.Pro86Ser missense OGFOD2 2 82198 2.43315E-5 41099 0 4.09172E-5
12-123460868-C-T p.Pro86Pro synonymous OGFOD2 2 82262 2.43126E-5 41131 0 3.18573E-5
12-123460876-T-A p.Val89Asp missense OGFOD2 1 82444 1.21294E-5 41222 0 NA
12-123460880-C-G c.-60C>G 5_prime_UTR_premature_start_codon_gain OGFOD2 6 82590 7.2648E-5 41295 0 NA
12-123460885-A-G p.Asn92Ser missense OGFOD2 1 82670 1.20963E-5 41335 0 NA
12-123460903-T-G p.Leu98Arg missense OGFOD2 3 82890 3.61925E-5 41445 0 1.20778E-5
12-123460911-G-A p.Asp101Asn missense OGFOD2 1 82950 1.20555E-5 41475 0 NA
12-123460926-C-T c.-14C>T 5_prime_UTR_premature_start_codon_gain OGFOD2 3 83016 3.61376E-5 41508 0 1.37297E-4
12-123460928-G-C c.-12G>C 5_prime_UTR_premature_start_codon_gain OGFOD2 513 82996 0.00618102 41498 4 0.011875
12-123460937-C-T p.Pro109Pro synonymous OGFOD2 12 83052 1.44488E-4 41526 0 8.84458E-5
12-123460943-G-T p.Val2Phe missense OGFOD2 1 83054 1.20404E-5 41527 0 3.18431E-5
12-123460953-A-C c.9+5A>C splice_region OGFOD2 1 83048 1.20412E-5 41524 0 NA
12-123461124-G-A c.339-7G>A splice_region OGFOD2 1 81956 1.22017E-5 40978 0 3.18471E-5
12-123461129-A-G c.339-2A>G splice_acceptor OGFOD2 1 82030 1.21907E-5 41015 0 3.18512E-5
12-123461136-T-C p.Phe115Ser missense OGFOD2 5 82028 6.09548E-5 41014 0 4.75116E-5
12-123461137-C-T p.Phe115Phe synonymous OGFOD2 2 82032 2.43807E-5 41016 0 4.20525E-6
12-123461140-C-T c.190-8C>T splice_region OGFOD2 3 82040 3.65675E-5 41020 0 4.60755E-5
12-123461142-G-C p.Cys117Ser missense OGFOD2 4 82092 4.87258E-5 41046 0 9.55718E-5
12-123461147-G-C c.190-1G>C splice_acceptor OGFOD2 3 82120 3.65319E-5 41060 0 NA
12-123461149-G-C p.Trp64Ser missense+splice_region OGFOD2 1 82170 1.21699E-5 41085 0 3.151E-5
12-123461151-C-T p.Ala120Val missense OGFOD2 2 82164 2.43416E-5 41082 0 1.64177E-5
12-123461169-C-G p.Ala126Gly missense OGFOD2 1 82402 1.21356E-5 41201 0 NA
12-123461170-C-T p.Pro71Leu missense OGFOD2 1 82442 1.21297E-5 41221 0 1.77961E-5
12-123461177-G-A p.Gly129Ser missense OGFOD2 2 82566 2.4223E-5 41283 0 4.04737E-6
12-123461185-C-T p.Thr76Ile missense OGFOD2 1 82632 1.21018E-5 41316 0 1.71432E-5
12-123461186-C-T p.Pro132Ser missense OGFOD2 1 82650 1.20992E-5 41325 0 4.03988E-6
12-123461205-A-G p.Glu65Gly missense OGFOD2 2 82806 2.41528E-5 41403 0 4.0318E-6
12-123461208-A-C p.Gln66Pro missense OGFOD2 1 82852 1.20697E-5 41426 0 8.46153E-6
12-123461220-G-A p.Arg70Gln missense OGFOD2 1 82884 1.20651E-5 41442 0 3.18695E-5
12-123461220-G-T p.Arg70Leu missense OGFOD2 1 82884 1.20651E-5 41442 0 3.18695E-5
12-123461222-C-T p.Arg71Trp missense OGFOD2 4 82884 4.82602E-5 41442 0 5.08535E-5
12-123461223-G-A p.Arg71Gln missense OGFOD2 32 82908 3.8597E-4 41454 0 5.09944E-4
12-123461229-G-A p.Arg73Gln missense OGFOD2 2 82780 2.41604E-5 41390 0 5.91636E-5
12-123461241-A-T p.Glu77Val missense OGFOD2 2 82712 2.41803E-5 41356 0 4.03281E-6
12-123461250-C-T p.Ala80Val missense OGFOD2 1 82868 1.20674E-5 41434 0 1.67766E-5
12-123461255-A-G p.Lys82Glu missense OGFOD2 1 82910 1.20613E-5 41455 0 NA
12-123461257-A-G p.Lys100Arg missense OGFOD2 2 82960 2.4108E-5 41480 0 8.38012E-6
12-123461264-A-G p.Ile85Val missense OGFOD2 5 82950 6.02773E-5 41475 0 7.54047E-5
12-123461266-C-T p.Ser103Leu missense OGFOD2 4 82974 4.82079E-5 41487 0 1.67558E-5
12-123461267-G-A p.Ala86Thr missense OGFOD2 22 82948 2.65226E-4 41474 0 7.32904E-4
12-123461268-C-T p.Arg104* stop_gained OGFOD2 3 82966 3.61594E-5 41483 0 9.56389E-5
12-123461269-G-A p.Arg104Gln missense OGFOD2 80 82976 9.64134E-4 41488 4 3.98054E-4
12-123461276-T-C p.Tyr89His missense OGFOD2 1 83026 1.20444E-5 41513 0 8.3797E-6
12-123461277-A-G p.Tyr89Cys missense OGFOD2 4 83008 4.81881E-5 41504 0 5.03525E-4
12-123461282-C-T p.Pro91Ser missense OGFOD2 2 83014 2.40923E-5 41507 0 NA
12-123461283-C-T p.Pro91Leu missense OGFOD2 1 83022 1.2045E-5 41511 0 3.35374E-5
12-123461284-G-A p.Arg109Gln missense OGFOD2 1890 82968 0.0227799 41484 13 0.036875
12-123461289-G-A p.Arg93Gln missense OGFOD2 1 82994 1.20491E-5 41497 0 8.38799E-6
12-123461289-G-T p.Arg93Leu missense OGFOD2 2 82994 2.40981E-5 41497 0 4.02291E-6
12-123461297-G-A p.Val96Ile missense OGFOD2 2 83022 2.409E-5 41511 0 NA
12-123461303-G-A p.Asp98Asn missense OGFOD2 175 82972 0.00210915 41486 0 0.0020141
12-123461308-A-G p.His117Arg missense OGFOD2 1 82968 1.20528E-5 41484 0 8.42858E-6
12-123461309-C-G p.Leu100Val missense OGFOD2 1 82992 1.20494E-5 41496 0 2.01758E-5
12-123461311-GCAGGTACCAGCCAGCCAGAGTGCTTGAAGGCCGGTACTGGAAAGAGGAGGTAGCATCCAGGGCTGGGGGTGCTGCCTGCCCCACAGCTGGTGTGTTTTGCTCC-G p.Gln101del splice_donor OGFOD2 6 82986 7.23014E-5 41493 0 NA
12-123461313-A-G p.Gln101Arg missense+splice_region OGFOD2 11 82988 1.32549E-4 41494 0 1.68873E-5
12-123461410-G-A c.304-8G>A splice_region OGFOD2 1 83072 1.20378E-5 41536 0 8.62798E-6
12-123461422-C-T p.Gln121* stop_gained OGFOD2 1 83092 1.20349E-5 41546 0 4.08814E-6
12-123461435-C-T p.Pro125Leu missense OGFOD2 5 83096 6.01714E-5 41548 0 3.1556E-4
12-123461436-G-A p.Glu108Lys missense OGFOD2 45 83090 5.41581E-4 41545 0 0.00140306
12-123461437-A-C p.Glu108Ala missense OGFOD2 1 83088 1.20354E-5 41544 0 1.21417E-5
12-123461438-G-A p.Ser126Asn missense OGFOD2 6 83080 7.22195E-5 41540 0 3.40298E-5
12-123461447-C-T p.Pro129Leu missense OGFOD2 14 83096 1.6848E-4 41548 0 0.00100705
12-123461448-G-A p.Val112Met missense OGFOD2 4 83100 4.81348E-5 41550 0 5.0758E-5
12-123461459-C-T p.Tyr115Tyr synonymous OGFOD2 1 83108 1.20325E-5 41554 0 4.02567E-6
12-123461462-C-T p.Ser116Ser synonymous OGFOD2 7 83098 8.42379E-5 41549 0 6.25E-4
12-123461463-G-A p.Val117Met missense OGFOD2 1 83110 1.20322E-5 41555 0 3.18654E-5
12-123461474-C-T c.-133C>T 5_prime_UTR_premature_start_codon_gain OGFOD2 68 83074 8.18547E-4 41537 0 0.00210271
12-123461475-G-A p.Ala121Thr missense OGFOD2 14 83066 1.68541E-4 41533 0 5.03525E-4
12-123461484-A-G p.Lys124Glu missense OGFOD2 1 83050 1.20409E-5 41525 0 NA
12-123461489-C-T p.Gly125Gly synonymous OGFOD2 1 83034 1.20433E-5 41517 0 NA
12-123461491-T-G p.Leu126Arg missense OGFOD2 1 83046 1.20415E-5 41523 0 8.04007E-6
12-123461499-C-T p.Arg129Trp missense OGFOD2 5 82960 6.027E-5 41480 0 2.27265E-4
12-123461500-G-T p.Arg129Leu missense OGFOD2 1 82978 1.20514E-5 41489 0 4.02324E-6
12-123461507-G-C p.Glu131Asp missense OGFOD2 1 82900 1.20627E-5 41450 0 NA
12-123461510-A-G n.491A>G splice_region OGFOD2 2 82870 2.41342E-5 41435 0 NA
12-123461513-A-G n.491+3A>G splice_region OGFOD2 1 82846 1.20706E-5 41423 0 NA
12-123461515-C-G p.Ser134Trp missense+splice_region OGFOD2 1 82794 1.20782E-5 41397 0 1.61223E-5
12-123461516-G-C p.Ser134Ser splice_region+synonymous OGFOD2 1 82790 1.20788E-5 41395 0 NA
12-123461522-G-A c.403+5G>A splice_region OGFOD2 74 82674 8.95082E-4 41337 0 0.00172661
12-123461526-C-T c.-394C>T 5_prime_UTR_premature_start_codon_gain OGFOD2 1 82636 1.21013E-5 41318 0 NA
12-123461576-G-A c.-344G>A 5_prime_UTR_premature_start_codon_gain OGFOD2 1 80258 1.24598E-5 40129 0 NA
12-123461630-A-T c.-290A>T 5_prime_UTR_premature_start_codon_gain OGFOD2 2 72008 2.77747E-5 36004 0 9.55597E-5
12-123462519-C-G c.-399C>G 5_prime_UTR_premature_start_codon_gain OGFOD2 2 806 0.00248139 403 0 NA
12-123462607-A-G n.609+3A>G splice_region OGFOD2 1 574 0.00174216 287 0 NA
12-123462751-G-A c.-172+5G>A splice_region OGFOD2 1 21242 4.70765E-5 10621 0 NA
12-123462867-A-G n.492-5A>G splice_region OGFOD2 2 67252 2.97389E-5 33626 0 NA
12-123462871-G-A n.492-1G>A splice_acceptor OGFOD2 5 68426 7.30716E-5 34213 0 NA
12-123462872-C-A n.492C>A splice_region OGFOD2 8 68746 1.1637E-4 34373 0 1.27421E-4
12-123462874-C-T c.-204C>T 5_prime_UTR_premature_start_codon_gain OGFOD2 2 69730 2.86821E-5 34865 0 NA
12-123462906-G-A c.-171-1G>A splice_acceptor OGFOD2 1 78450 1.2747E-5 39225 0 NA
12-123462909-G-A c.-169G>A splice_region OGFOD2 2 78874 2.53569E-5 39437 0 NA
12-123462942-C-T c.-136C>T 5_prime_UTR_premature_start_codon_gain OGFOD2 3 81804 3.6673E-5 40902 0 5.09649E-4
12-123462949-C-T c.-129C>T 5_prime_UTR_premature_start_codon_gain OGFOD2 12 82120 1.46128E-4 41060 0 8.6448E-4
12-123462997-C-T p.Arg138Cys missense OGFOD2 1 82918 1.20601E-5 41459 0 8.38139E-6
12-123462997-C-A p.Arg138Ser missense OGFOD2 1 82918 1.20601E-5 41459 0 NA
12-123462998-G-C p.Arg138Pro missense OGFOD2 1 82912 1.2061E-5 41456 0 4.02026E-6
12-123463006-C-T p.Arg141Trp missense OGFOD2 5 82962 6.02686E-5 41481 0 4.18746E-5
12-123463008-G-A p.Arg141Arg synonymous OGFOD2 19 82966 2.29009E-4 41483 0 2.22973E-4
12-123463026-G-A p.Ala147Ala synonymous OGFOD2 8 83008 9.63763E-5 41504 0 1.40626E-4
12-123463029-C-T p.Pro148Pro synonymous OGFOD2 1 83016 1.20459E-5 41508 0 NA
12-123463031-T-C p.Phe149Ser missense OGFOD2 17 83002 2.04814E-4 41501 0 0.00100705
12-123463034-G-A p.Cys150Tyr missense OGFOD2 1 83002 1.20479E-5 41501 0 NA
12-123463042-C-G p.Leu153Val missense OGFOD2 163 83008 0.00196367 41504 1 0.00398115
12-123463044-G-A p.Leu153Leu synonymous OGFOD2 2 82990 2.40993E-5 41495 0 3.18532E-5
12-123463045-C-T c.-33C>T 5_prime_UTR_premature_start_codon_gain OGFOD2 1 83004 1.20476E-5 41502 0 NA
12-123463052-A-G p.Glu156Gly missense OGFOD2 4 82996 4.81951E-5 41498 0 3.18695E-5
12-123463065-C-G p.Phe160Leu missense OGFOD2 2 82964 2.41068E-5 41482 0 NA
12-123463066-G-A p.Glu161Lys missense OGFOD2 2 82954 2.41097E-5 41477 0 8.364E-6
12-123463066-G-C p.Glu161Gln missense OGFOD2 2 82954 2.41097E-5 41477 0 3.18573E-5
12-123463073-C-T p.Ser163Leu missense OGFOD2 6 82956 7.23275E-5 41478 0 0.00151057
12-123463074-G-A p.Ser163Ser synonymous OGFOD2 17 82954 2.04933E-4 41477 0 1.91131E-4
12-123463075-G-A p.Asp164Asn missense OGFOD2 1 82958 1.20543E-5 41479 0 NA
12-123463075-G-C p.Asp164His missense OGFOD2 3 82958 3.61629E-5 41479 0 1.84048E-4
12-123463078-A-G p.Met1? start_lost OGFOD2 1 82944 1.20563E-5 41472 0 8.03897E-6
12-123463080-G-A p.Met1? start_lost OGFOD2 3 82926 3.61768E-5 41463 0 4.02007E-6
12-123463083-T-C p.Pro166Pro synonymous OGFOD2 1 82924 1.20592E-5 41462 0 2.51134E-5
12-123463101-C-A p.Thr172Thr synonymous OGFOD2 3 82894 3.61908E-5 41447 0 1.67681E-5
12-123463114-G-A p.Gly177Arg missense+splice_region OGFOD2 1 82744 1.20855E-5 41372 0 1.20896E-5
12-123463119-G-GCTGCTGCACGAGCTC c.531+3_531+4insCTGCTGCACGAGCTC splice_region OGFOD2 3 82760 3.62494E-5 41380 1 NA
12-123463295-C-G c.532-5C>G splice_region OGFOD2 1 81326 1.22962E-5 40663 0 NA
12-123463295-C-T c.532-5C>T splice_region OGFOD2 1 81326 1.22962E-5 40663 0 NA
12-123463298-A-G c.532-2A>G splice_acceptor OGFOD2 1 81214 1.23131E-5 40607 0 9.11344E-6
12-123463302-G-A p.Val178Val splice_region+synonymous OGFOD2 1 81152 1.23226E-5 40576 0 4.14453E-6
12-123463311-C-T p.His181His synonymous OGFOD2 5 80878 6.18215E-5 40439 0 3.18735E-5
12-123463314-G-T p.Glu182Asp missense OGFOD2 1 80816 1.23738E-5 40408 0 4.15038E-6
12-123463317-C-A p.Leu183Leu synonymous OGFOD2 105 80676 0.0013015 40338 0 0.00309252
12-123463318-G-A p.Gly184Arg missense OGFOD2 2 80926 2.47139E-5 40463 0 3.18593E-5
12-123463325-A-G p.Asp186Gly missense OGFOD2 5 80846 6.1846E-5 40423 0 0.00352467
12-123463326-C-G p.Asp186Glu missense OGFOD2 1 80780 1.23793E-5 40390 0 0.0543807
12-123463326-C-T p.Asp186Asp synonymous OGFOD2 1 80780 1.23793E-5 40390 0 5.4503E-5
12-123463329-GC-G p.Pro188fs frameshift OGFOD2 4 81722 4.89464E-5 40861 0 3.18532E-5
12-123463331-C-T p.Pro188Leu missense OGFOD2 2 81822 2.44433E-5 40911 0 1.63867E-5
12-123463336-A-T p.Met190Leu missense OGFOD2 1 81962 1.22008E-5 40981 0 2.04342E-4
12-123463338-G-A p.Met190Ile missense OGFOD2 2 81982 2.43956E-5 40991 0 3.67912E-5
12-123463344-A-C p.Pro192Pro synonymous OGFOD2 4 81946 4.88126E-5 40973 0 NA
12-123463349-G-A p.Arg194Gln missense OGFOD2 1 82006 1.21942E-5 41003 0 0.00101215
12-123463351-G-A p.Glu195Lys missense OGFOD2 1 82000 1.21951E-5 41000 0 NA
12-123463354-C-T p.Arg196Cys missense OGFOD2 1 81930 1.22055E-5 40965 0 3.18654E-5
12-123463361-T-C p.Leu198Pro missense OGFOD2 1 82016 1.21927E-5 41008 0 1.63641E-5
12-123463367-C-T p.Pro200Leu missense OGFOD2 1 82052 1.21874E-5 41026 0 2.03962E-5
12-123463378-C-T p.Leu204Leu synonymous OGFOD2 1 82134 1.21752E-5 41067 0 4.07624E-6
12-123463380-G-GC p.Leu205fs frameshift OGFOD2 3 82130 3.65275E-5 41065 0 2.6442E-5
12-123463383-G-C p.Leu205Leu synonymous OGFOD2 9 82136 1.09574E-4 41068 0 0.00253293
12-123463387-CCT-C p.Pro207fs frameshift OGFOD2 1 82144 1.21737E-5 41072 0 4.40467E-5
12-123463396-G-C p.Gly210Arg missense OGFOD2 2 82048 2.4376E-5 41024 1 NA
12-123463398-C-T p.Gly210Gly synonymous OGFOD2 4 81996 4.87829E-5 40998 0 2.40287E-4
12-123463401-G-A p.Gly211Gly synonymous OGFOD2 6 81906 7.32547E-5 40953 0 5.06073E-4
12-123463403-G-T p.Gly212Val missense OGFOD2 2 81726 2.4472E-5 40863 0 2.08448E-5
12-123463405-C-T p.Arg213Trp missense OGFOD2 1 80452 1.24298E-5 40226 0 3.18939E-5
12-123463406-G-A p.Arg213Gln missense OGFOD2 2 80472 2.48534E-5 40236 0 1.25409E-5
12-123463410-C-T p.Leu214Leu synonymous OGFOD2 3 80422 3.73032E-5 40211 0 4.6203E-5
12-123463411-G-A p.Asp215Asn missense OGFOD2 59 80446 7.33411E-4 40223 0 7.3384E-4
12-123463414-A-G p.Ser216Gly missense OGFOD2 1 80802 1.23759E-5 40401 0 4.1423E-6
12-123463416-CCACCGGGCCTTTGTGGTCAAATACG-C p.Phe220fs frameshift OGFOD2 1 80780 1.23793E-5 40390 0 6.37755E-5
12-123463420-C-T p.Arg218Trp missense OGFOD2 3 81162 3.69631E-5 40581 0 6.37877E-5
12-123463420-C-CG p.Ala219fs frameshift OGFOD2 2 81162 2.46421E-5 40581 0 NA
12-123463421-G-A p.Arg218Gln missense OGFOD2 4 81208 4.92562E-5 40604 0 3.6673E-5
12-123463431-G-C p.Val221Val synonymous OGFOD2 1 81778 1.22282E-5 40889 0 NA
12-123463440-C-T p.Tyr224Tyr synonymous OGFOD2 2 81882 2.44254E-5 40941 0 6.37308E-5
12-123463441-G-A p.Ala225Thr missense OGFOD2 2 81866 2.44302E-5 40933 0 1.27462E-4
12-123463442-C-T p.Ala225Val missense OGFOD2 2 81918 2.44147E-5 40959 0 NA
12-123463445-C-T p.Pro226Leu missense OGFOD2 1 81986 1.21972E-5 40993 0 1.76769E-5
12-123463446-G-C p.Pro226Pro synonymous OGFOD2 1 82026 1.21913E-5 41013 0 2.64518E-5
12-123463455-C-T p.Asp229Asp synonymous OGFOD2 1 82220 1.21625E-5 41110 0 NA
12-123463457-T-A p.Leu230Gln missense OGFOD2 14 82238 1.70238E-4 41119 0 7.82377E-5
12-123463459-G-T p.Glu231* stop_gained OGFOD2 5 82282 6.07666E-5 41141 0 7.28999E-5
12-123463467-C-T p.Gly233Gly synonymous OGFOD2 9 82574 1.08993E-4 41287 0 9.55597E-5
12-123463474-T-C p.Tyr236His missense OGFOD2 2 82720 2.41779E-5 41360 0 3.40466E-5
12-123463474-T-A p.Tyr236Asn missense OGFOD2 1 82720 1.2089E-5 41360 0 8.51165E-6
12-123463475-A-C p.Tyr236Ser missense OGFOD2 1 82724 1.20884E-5 41362 0 8.50745E-6
12-123463482-T-C p.Asn238Asn synonymous OGFOD2 1 82780 1.20802E-5 41390 0 NA
12-123463484-C-T p.Ala239Val missense OGFOD2 2 82758 2.41668E-5 41379 0 8.49012E-6
12-123463485-C-T p.Ala239Ala synonymous OGFOD2 21 82760 2.53746E-4 41380 0 2.50006E-4
12-123463486-G-A p.Glu240Lys missense OGFOD2 2 82758 2.41668E-5 41379 0 4.43498E-5
12-123463489-C-T p.Leu241Phe missense OGFOD2 34 82784 4.10707E-4 41392 0 5.34188E-4
12-123463492-A-C p.Thr242Pro missense OGFOD2 1 82790 1.20788E-5 41395 0 8.4763E-6
12-123463494-C-G p.Thr242Thr synonymous OGFOD2 2 82788 2.41581E-5 41394 0 8.47472E-6
12-123463494-C-A p.Thr242Thr synonymous OGFOD2 2 82788 2.41581E-5 41394 0 8.47472E-6
12-123463499-A-T p.Asn244Ile missense OGFOD2 7 82800 8.45411E-5 41400 0 4.03011E-5
12-123463499-A-G p.Asn244Ser missense OGFOD2 1 82800 1.20773E-5 41400 0 1.20903E-5
12-123463511-G-C p.Gly248Ala missense OGFOD2 1 82738 1.20863E-5 41369 0 1.69253E-5
12-123463514-A-G p.Lys249Arg missense OGFOD2 3 82750 3.62538E-5 41375 0 3.18796E-5
12-123463521-C-T p.Phe251Phe synonymous OGFOD2 4 82700 4.83676E-5 41350 0 8.4707E-6
12-123463523-CAG-C p.Gly254fs frameshift OGFOD2 1 82682 1.20945E-5 41341 0 3.18756E-5
12-123463529-G-A p.Gly254Asp missense OGFOD2 1 82584 1.21089E-5 41292 0 NA
12-123463530-C-T p.Gly254Gly synonymous OGFOD2 2 82586 2.42172E-5 41293 0 1.27551E-4
12-123463531-G-A p.Ala255Thr missense OGFOD2 3 82580 3.63284E-5 41290 1 3.18878E-5
12-123463532-C-T p.Ala255Val missense OGFOD2 2 82592 2.42154E-5 41296 0 3.22932E-5
12-123463540-T-C p.Phe258Leu missense OGFOD2 2 82596 2.42142E-5 41298 0 4.03959E-6
12-123463542-TGGG-T p.Gly260del disruptive_inframe_deletion OGFOD2 1 82558 1.21127E-5 41279 0 5.04032E-4
12-123463549-C-T p.Leu261Phe missense OGFOD2 1 82464 1.21265E-5 41232 0 3.63816E-5
12-123463554-CCAGGTGAGTGTGTGACCCATGCGGCAGGGCCTGGGGCAGCTGTGAGTGCCCAGGCCTGAGTCGTGCCATCTG-C p.Ala264fs frameshift OGFOD2 8 82384 9.71062E-5 41192 0 NA
12-123463599-A-AGTGCCCAGGCCTGAGTC c.790-25_790-9dupCAGGCCTGAGTCGTGCC splice_region OGFOD2 1 81922 1.22067E-5 40961 0 1.23303E-4
12-123463624-C-T c.790-6C>T splice_region OGFOD2 13 81960 1.58614E-4 40980 0 1.00163E-4
12-123463627-C-G c.790-3C>G splice_region OGFOD2 2 81906 2.44182E-5 40953 0 1.25723E-5
12-123463633-C-T p.Pro265Ser missense OGFOD2 16 81886 1.95394E-4 40943 1 9.62902E-5
12-123463633-C-A p.Pro265Thr missense OGFOD2 1 81886 1.22121E-5 40943 0 NA
12-123463638-A-G p.Thr266Thr synonymous OGFOD2 1 81908 1.22088E-5 40954 0 NA
12-123463646-C-T p.Thr269Met missense OGFOD2 1 81904 1.22094E-5 40952 0 8.75733E-6
12-123463649-AG-A p.Glu270fs frameshift OGFOD2 1 81920 1.2207E-5 40960 0 8.73637E-6
12-123463651-C-G p.Pro271Ala missense OGFOD2 1 81894 1.22109E-5 40947 0 NA
12-123463652-C-A p.Pro271His missense OGFOD2 1 81932 1.22052E-5 40966 0 NA
12-123463654-C-T p.Leu272Leu synonymous OGFOD2 12 81960 1.46413E-4 40980 0 4.46315E-4
12-123463665-G-A p.Glu275Glu synonymous OGFOD2 1 82000 1.21951E-5 41000 0 4.12286E-6
12-123463668-C-T p.His276His synonymous OGFOD2 44 82002 5.36572E-4 41001 0 0.00127149
12-123463669-G-A p.Val277Met missense OGFOD2 1 82012 1.21933E-5 41006 0 3.18817E-5
12-123463686-C-T p.Val282Val synonymous OGFOD2 1 82172 1.21696E-5 41086 0 4.08183E-6
12-123463694-G-A p.Arg285His missense OGFOD2 3 82194 3.6499E-5 41097 0 4.48175E-5
12-123463694-G-T p.Arg285Leu missense OGFOD2 2 82194 2.43327E-5 41097 0 8.57883E-6
12-123463696-G-C p.Gly286Arg missense OGFOD2 1 82260 1.21566E-5 41130 0 6.37471E-5
12-123463698-C-T p.Gly286Gly synonymous OGFOD2 6 82208 7.29856E-5 41104 0 0.00251762
12-123463699-G-A p.Gly287Ser missense OGFOD2 1 82254 1.21575E-5 41127 0 4.06802E-6
12-123463700-G-T p.Gly287Val missense OGFOD2 1 82258 1.21569E-5 41129 0 4.06957E-6
12-123463715-C-A p.Ala292Asp missense OGFOD2 2 82478 2.42489E-5 41239 0 NA
12-123463717-C-T p.Arg293Trp missense OGFOD2 11 82470 1.33382E-4 41235 0 0.00100705
12-123463718-G-A p.Arg293Gln missense OGFOD2 5 82482 6.06193E-5 41241 0 1.62121E-5
12-123463720-C-G p.Pro294Ala missense OGFOD2 2 82504 2.42412E-5 41252 0 1.69529E-5
12-123463726-G-A p.Gly296Ser missense OGFOD2 2 82534 2.42324E-5 41267 0 8.09585E-6
12-123463738-C-T p.Arg300Cys missense OGFOD2 2 82530 2.42336E-5 41265 0 NA
12-123463739-G-A p.Arg300His missense OGFOD2 9 82596 1.08964E-4 41298 0 5.03525E-4
12-123463744-AACCTTGTC-A p.Asn302fs frameshift OGFOD2 1 82660 1.20978E-5 41330 0 NA
12-123463747-C-T p.Leu303Phe missense OGFOD2 1 82696 1.20925E-5 41348 0 NA
12-123463750-G-C p.Val304Leu missense OGFOD2 12 82682 1.45134E-4 41341 0 5.03525E-4
12-123463752-C-T p.Val304Val synonymous OGFOD2 4 82650 4.83969E-5 41325 0 6.87458E-5
12-123463763-G-C p.Arg308Pro missense OGFOD2 2 82704 2.41826E-5 41352 0 2.01868E-5
12-123463771-G-A p.Ala311Thr missense OGFOD2 135 82760 0.00163122 41380 1 9.47978E-4
12-123463774-G-C p.Val312Leu missense OGFOD2 2 82770 2.41633E-5 41385 0 8.41524E-6
12-123463778-G-A p.Arg313His missense OGFOD2 1 82762 1.20828E-5 41381 0 9.56328E-5
12-123463787-T-A p.Leu316His missense OGFOD2 1 82870 1.20671E-5 41435 0 4.02638E-6
12-123463803-C-T p.Cys321Cys synonymous OGFOD2 1 82868 1.20674E-5 41434 0 NA
12-123463805-G-A p.Arg322His missense OGFOD2 4 82868 4.82695E-5 41434 0 4.19992E-5
12-123463807-G-C p.Glu323Gln missense OGFOD2 1 82876 1.20662E-5 41438 0 3.18654E-5
12-123463812-C-T p.Pro160Pro splice_region+synonymous OGFOD2 1723 82822 0.0208037 41411 78 0.0421341
12-123463813-G-C p.Asp325His missense OGFOD2 3 82816 3.62249E-5 41408 0 2.52058E-5
12-123463813-G-A p.Asp325Asn missense OGFOD2 2 82816 2.41499E-5 41408 0 1.68039E-5
12-123463813-G-T p.Asp325Tyr missense OGFOD2 1 82816 1.2075E-5 41408 0 NA
12-123463822-G-T p.Asp328Tyr missense OGFOD2 1 82796 1.20779E-5 41398 0 6.36983E-5
12-123463824-C-T p.Asp328Asp synonymous OGFOD2 1 82768 1.2082E-5 41384 0 3.18593E-5
12-123463836-C-T p.Phe332Phe synonymous OGFOD2 1 82698 1.20922E-5 41349 0 1.68483E-5
12-123463836-C-A p.Phe332Leu missense OGFOD2 1 82698 1.20922E-5 41349 0 NA
12-123463837-G-A p.Gly333Ser missense OGFOD2 6 82716 7.25374E-5 41358 0 5.05544E-5
12-123463852-C-T p.Arg338* stop_gained OGFOD2 1 82540 1.21153E-5 41270 0 2.02265E-5
12-123463853-G-A p.Arg338Gln missense OGFOD2 8 82556 9.69039E-5 41278 0 5.03525E-4
12-123463853-G-C p.Arg338Pro missense OGFOD2 1 82556 1.2113E-5 41278 0 8.48868E-6
12-123463855-G-C p.Glu339Gln missense OGFOD2 3 82554 3.63399E-5 41277 0 6.25E-4
12-123463856-A-C p.Glu339Ala missense OGFOD2 2 82510 2.42395E-5 41255 0 0.00125
12-123463858-G-A p.Glu340Lys missense OGFOD2 3 82540 3.6346E-5 41270 0 3.18471E-5
12-123463861-C-A p.Pro341Thr missense OGFOD2 2 82464 2.4253E-5 41232 0 NA
12-123463864-GCCACGGTGGATGT-G p.Ala342fs frameshift OGFOD2 2 82406 2.42701E-5 41203 0 1.71256E-5
12-123463867-A-G p.Thr343Ala missense OGFOD2 2 82356 2.42848E-5 41178 0 8.11247E-6
12-123463868-C-T p.Thr343Met missense OGFOD2 4 82336 4.85814E-5 41168 0 1.28811E-4
12-123463869-G-A p.Thr343Thr synonymous OGFOD2 5 82320 6.07386E-5 41160 0 2.57794E-5
12-123463874-A-T p.Asp345Val missense OGFOD2 1 82228 1.21613E-5 41114 0 NA
12-123463876-G-GT p.Cys347fs frameshift OGFOD2 2 82236 2.43202E-5 41118 0 5.04032E-4
12-123463883-C-T p.Ala348Val missense OGFOD2 2 82050 2.43754E-5 41025 0 5.2325E-5
12-123463884-G-A p.Ala348Ala synonymous OGFOD2 12 82006 1.46331E-4 41003 0 4.45973E-4
12-123463890-C-T p.Thr350Thr synonymous OGFOD2 2 81886 2.44242E-5 40943 0 4.40102E-5
12-123463983-G-A c.*90G>A splice_region OGFOD2 1 66498 1.5038E-5 33249 0 NA