Variant

<
Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
1-11167364-T-G n.1111A>C splice_region MTOR 3 80626 3.72088E-5 40313 0 3.18492E-5
1-11167365-CAACAGCAGCT-C n.1100_1109delAGCTGCTGTT splice_region MTOR 1 80690 1.23931E-5 40345 0 NA
1-11167558-C-CAGCCAATATAGCACTGGCAGAGGTTTTCATGGGATGTCGCTTGTT c.7635-2_7635-1insAACAAGCGACATCCCATGAAAACCTCTGCCAGTGCTATATTGGCT splice_acceptor MTOR 2 83190 2.40414E-5 41595 1 NA
1-11167558-C-CAGCCAATATAGCACTGGCAGAGGTTTTCATGGGATGTCGCTTGT c.7635-2_7635-1insACAAGCGACATCCCATGAAAACCTCTGCCAGTGCTATATTGGCT splice_acceptor MTOR 2 83190 2.40414E-5 41595 1 NA
1-11167558-C-CAGCCAATATAGCACTGGCAGAGGTTTTCATGGGA c.7635-2_7635-1insTCCCATGAAAACCTCTGCCAGTGCTATATTGGCT splice_acceptor MTOR 2 83190 2.40414E-5 41595 1 NA
1-11167560-A-G c.7635-3T>C splice_region MTOR 1 83172 1.20233E-5 41586 0 8.24525E-6
1-11167562-G-C c.7635-5C>G splice_region MTOR 1 83162 1.20247E-5 41581 0 NA
1-11168232-A-G c.7634+6T>C splice_region MTOR 1 83170 1.20236E-5 41585 0 6.3804E-5
1-11168234-T-C c.7634+4A>G splice_region MTOR 3 83168 3.60716E-5 41584 0 6.25E-4
1-11168279-T-C p.Gln2531Gln synonymous MTOR 14 83328 1.68011E-4 41664 0 7.00905E-4
1-11168299-C-T p.Val2525Ile missense MTOR 2 83340 2.39981E-5 41670 0 3.18552E-5
1-11168311-C-T p.Val2521Ile missense MTOR 2 83332 2.40004E-5 41666 0 3.29511E-5
1-11168330-A-G p.Ser2514Ser synonymous MTOR 1 83312 1.20031E-5 41656 0 3.2962E-5
1-11168332-A-C p.Ser2514Ala missense MTOR 2 83318 2.40044E-5 41659 0 1.64834E-5
1-11168344-C-CAGTGAGCTTATCTCGAACCCTGTTAATAATCTGGATAGCTTTCTTATT c.7529-2_7529-1insAATAAGAAAGCTATCCAGATTATTAACAGGGTTCGAGATAAGCTCACT splice_acceptor MTOR 4 83282 4.80296E-5 41641 1 NA
1-11169366-C-T p.Arg2503Arg synonymous MTOR 2 83362 2.39917E-5 41681 0 1.59194E-5
1-11169379-T-C p.Gln2499Arg missense MTOR 8 83368 9.59601E-5 41684 0 9.06678E-5
1-11169420-G-A p.Asp2485Asp synonymous MTOR 280 83350 0.00335933 41675 3 0.00704935
1-11169427-A-G p.Ile2483Thr missense+splice_region MTOR 1 83348 1.19979E-5 41674 0 NA
1-11169699-A-C c.7447+7T>G splice_region MTOR 2 83316 2.4005E-5 41658 0 3.18431E-5
1-11169718-T-C p.Ile2479Val missense MTOR 1 83348 1.19979E-5 41674 0 1.64753E-5
1-11169745-T-G p.Lys2470Gln missense MTOR 1 83356 1.19967E-5 41678 0 NA
1-11169750-T-C p.His2468Arg missense MTOR 1 83364 1.19956E-5 41682 0 1.64758E-5
1-11169752-G-C p.Ala2467Ala synonymous MTOR 33 83358 3.95883E-4 41679 0 9.5645E-4
1-11169775-C-T p.Gly2460Ser missense MTOR 4 83344 4.79939E-5 41672 0 1.4019E-4
1-11169777-T-C p.Asp2459Gly missense MTOR 1 83342 1.19988E-5 41671 0 NA
1-11169782-A-C p.Ile2457Met missense MTOR 1 83334 1.19999E-5 41667 0 7.95444E-6
1-11169786-T-TCGA c.7367-1_7367insTCG splice_acceptor MTOR 1 83326 1.20011E-5 41663 0 NA
1-11169789-A-G c.7367-3T>C splice_region MTOR 63 83308 7.5623E-4 41654 0 0.00501253
1-11169792-G-A c.7367-6C>T splice_region MTOR 1 83294 1.20057E-5 41647 0 NA
1-11172933-AATCCGT-A p.Thr2446_Asp2447del conservative_inframe_deletion MTOR 4 83194 4.80804E-5 41597 0 NA
1-11172944-G-A p.Thr2444Met missense MTOR 1 83152 1.20262E-5 41576 0 8.23805E-6
1-11172948-G-T p.Arg2443Arg synonymous MTOR 2 83142 2.40552E-5 41571 0 5.03525E-4
1-11172959-T-C p.Asn2439Ser missense MTOR 1 83122 1.20305E-5 41561 0 NA
1-11172961-G-A p.Gly2438Gly synonymous MTOR 3 83130 3.60881E-5 41565 0 5.03525E-4
1-11172974-G-A p.Thr2434Ile missense+splice_region MTOR 1 83086 1.20357E-5 41543 0 NA
1-11174394-C-A p.Leu2427Leu synonymous MTOR 1 82746 1.20852E-5 41373 0 NA
1-11174403-G-A p.Asp2424Asp synonymous MTOR 16 82812 1.93209E-4 41406 0 0.00125
1-11174426-C-T p.Val2417Met missense MTOR 1 82892 1.20639E-5 41446 0 7.95969E-6
1-11174427-G-A p.Ala2416Ala synonymous MTOR 5 82914 6.03034E-5 41457 0 2.22497E-4
1-11174441-C-A p.Asp2412Tyr missense MTOR 1 82914 1.20607E-5 41457 0 NA
1-11174470-G-A p.Thr2402Ile missense MTOR 1 82866 1.20677E-5 41433 0 NA
1-11174487-G-A p.Tyr2396Tyr synonymous MTOR 2 82794 2.41563E-5 41397 0 3.18451E-5
1-11174503-C-A p.Gly2391Val missense MTOR 2 82628 2.42049E-5 41314 0 NA
1-11174504-C-G p.Gly2391Arg missense MTOR 1 82620 1.21036E-5 41310 0 NA
1-11174516-A-T c.7165-6T>A splice_region MTOR 1 82466 1.21262E-5 41233 0 9.90311E-5
1-11174867-C-T c.7164+3G>A splice_region MTOR 1 83326 1.20011E-5 41663 0 3.97763E-6
1-11174876-A-G p.Ala2386Ala synonymous MTOR 15 83346 1.79973E-4 41673 0 5.09814E-4
1-11174909-A-T p.Ile2375Ile synonymous MTOR 12 83360 1.43954E-4 41680 0 4.11882E-5
1-11174921-A-G p.Phe2371Phe synonymous MTOR 1 83352 1.19973E-5 41676 0 8.23791E-6
1-11174936-C-T p.Met2366Ile missense MTOR 1 83334 1.19999E-5 41667 0 3.97706E-6
1-11174946-T-TC c.7090-3_7090-2insG splice_region MTOR 1 83324 1.20013E-5 41662 0 NA
1-11174946-T-TCAAAGCAGTCCCCAAAGTCAATGTGCAGGATCTTCCC c.7090-3_7090-2insGGGAAGATCCTGCACATTGACTTTGGGGACTGCTTTG splice_region MTOR 1 83326 1.20011E-5 41663 0 NA
1-11174946-T-TCAAAGCAGTCCCCAAAGTCAATGTGCAGGATCTTCCCACTCAG c.7090-3_7090-2insCTGAGTGGGAAGATCCTGCACATTGACTTTGGGGACTGCTTTG splice_region MTOR 2 83326 2.40021E-5 41663 1 NA
1-11174949-A-G c.7090-5T>C splice_region MTOR 5 83306 6.00197E-5 41653 0 7.95551E-6
1-11175480-C-T p.Leu2354Leu synonymous MTOR 2 83362 2.39917E-5 41681 0 8.23669E-6
1-11175522-G-A p.His2340His synonymous MTOR 1 83354 1.1997E-5 41677 0 6.37064E-5
1-11175572-G-A c.-63C>T 5_prime_UTR_premature_start_codon_gain MTOR 28 82856 3.37936E-4 41428 0 8.93199E-4
1-11175586-A-G c.-77T>C 5_prime_UTR_premature_start_codon_gain MTOR 6 82398 7.28173E-5 41199 0 3.18492E-5
1-11175623-G-A c.-114C>T 5_prime_UTR_premature_start_codon_gain MTOR 6 78560 7.63747E-5 39280 0 3.18552E-5
1-11175625-T-C c.-116A>G 5_prime_UTR_premature_start_codon_gain MTOR 2 78176 2.55833E-5 39088 0 NA
1-11175658-C-T c.-149G>A 5_prime_UTR_premature_start_codon_gain MTOR 1 73604 1.35862E-5 36802 0 NA
1-11175693-C-T c.-184G>A 5_prime_UTR_premature_start_codon_gain MTOR 357 66002 0.00540893 33001 0 0.0109547
1-11177063-A-G p.Asp2338Asp splice_region+synonymous MTOR 1 83278 1.2008E-5 41639 0 NA
1-11177102-C-T p.Ala2325Ala synonymous MTOR 3 83352 3.59919E-5 41676 0 1.5969E-5
1-11177112-C-T p.Arg2322His missense MTOR 1 83362 1.19959E-5 41681 0 3.99227E-6
1-11177141-C-T p.Val2312Val splice_region+synonymous MTOR 1 83342 1.19988E-5 41671 0 8.26651E-6
1-11177144-C-CTCGGAGCTGGGGCTTTTCAGCCA c.6934-2_6934-1insTGGCTGAAAAGCCCCAGCTCCGA splice_acceptor MTOR 1 83336 1.19996E-5 41668 0 NA
1-11181306-G-T p.Ser2310Ser synonymous MTOR 2 82580 2.42189E-5 41290 0 NA
1-11181310-C-G p.Ser2309Thr missense MTOR 1 82636 1.21013E-5 41318 0 NA
1-11181327-C-T p.Leu2303Leu synonymous MTOR 21186 82360 0.257237 41180 3039 0.279672
1-11181330-C-A p.Leu2302Leu synonymous MTOR 1 82816 1.2075E-5 41408 0 NA
1-11181345-G-A p.Asp2297Asp synonymous MTOR 5 82924 6.02962E-5 41462 0 6.25E-4
1-11181354-T-C p.Thr2294Thr synonymous MTOR 1 83026 1.20444E-5 41513 0 NA
1-11181357-A-G p.Asn2293Asn synonymous MTOR 2 83014 2.40923E-5 41507 0 NA
1-11181361-T-C p.Asn2292Ser missense MTOR 2 83050 2.40819E-5 41525 0 6.36943E-5
1-11181366-G-A p.Ala2290Ala synonymous MTOR 3 83052 3.61219E-5 41526 0 5.76644E-5
1-11181412-T-C p.Tyr2275Cys missense MTOR 1 83046 1.20415E-5 41523 0 3.97747E-6
1-11181417-C-T p.Pro2273Pro synonymous MTOR 19 83002 2.2891E-4 41501 0 2.22887E-4
1-11182038-G-T p.Arg2270Arg splice_region+synonymous MTOR 1 83158 1.20253E-5 41579 0 NA
1-11182057-G-A p.Ile2263Ile synonymous MTOR 1 83288 1.20065E-5 41644 0 4.15731E-5
1-11182063-G-A p.Leu2261Leu synonymous MTOR 362 83312 0.00434511 41656 6 0.0103861
1-11182093-C-T p.Arg2251Arg synonymous MTOR 1 83346 1.19982E-5 41673 0 NA
1-11182095-G-A p.Arg2251Trp missense MTOR 1 83346 1.19982E-5 41673 0 NA
1-11182104-C-T p.Ala2248Thr missense MTOR 1 83356 1.19967E-5 41678 0 1.59095E-5
1-11182114-G-A p.Asp2244Asp synonymous MTOR 1 83370 1.19947E-5 41685 0 8.24484E-6
1-11182138-G-A p.Leu2236Leu synonymous MTOR 1 83346 1.19982E-5 41673 0 NA
1-11182147-G-A p.Asn2233Asn synonymous MTOR 2 83304 2.40085E-5 41652 0 3.97712E-6
1-11182153-C-T p.Ser2231Ser synonymous MTOR 7 83286 8.40477E-5 41643 0 8.24307E-6
1-11182171-G-A p.Tyr2225Tyr synonymous MTOR 10 83212 1.20175E-4 41606 0 3.70999E-4
1-11182189-G-A c.6663-6C>T splice_region MTOR 273 83054 0.00328702 41527 1 0.00777615
1-11184575-T-C p.Thr2214Thr synonymous MTOR 1 83364 1.19956E-5 41682 0 NA
1-11184585-T-C p.Asn2211Ser missense MTOR 3 83374 3.59824E-5 41687 0 NA
1-11184592-G-A p.Leu2209Leu synonymous MTOR 3 83370 3.59842E-5 41685 0 3.2956E-5
1-11184593-A-G p.Leu2208Leu synonymous MTOR 578 83364 0.00693345 41682 3 0.0225
1-11184599-G-A p.Asn2206Asn synonymous MTOR 1 83370 1.19947E-5 41685 0 8.23927E-6
1-11184611-G-A p.Phe2202Phe synonymous MTOR 4 83356 4.79869E-5 41678 0 3.97681E-5
1-11184632-A-G p.Asp2195Asp synonymous MTOR 3 83350 3.59928E-5 41675 0 1.39186E-4
1-11184691-C-CCATAAG c.6527-2_6527-1insCTTATG splice_acceptor MTOR 8 82848 9.65624E-5 41424 4 NA
1-11184698-G-C c.6527-8C>G splice_region MTOR 1 82728 1.20878E-5 41364 0 3.18715E-5
1-11186702-C-G p.Arg2168Thr missense MTOR 1 83388 1.19921E-5 41694 0 NA
1-11186731-C-T p.Pro2158Pro synonymous MTOR 1 83412 1.19887E-5 41706 0 1.64742E-5
1-11186732-G-A p.Pro2158Leu missense MTOR 1 83408 1.19893E-5 41704 0 1.64745E-5
1-11186743-C-T p.Gln2154Gln synonymous MTOR 1 83412 1.19887E-5 41706 0 9.55779E-5
1-11186744-T-C p.Gln2154Arg missense MTOR 1 83412 1.19887E-5 41706 0 NA
1-11186758-T-C p.Pro2149Pro synonymous MTOR 1 83406 1.19895E-5 41703 0 NA
1-11186764-G-A p.Asn2147Asn synonymous MTOR 3 83406 3.59686E-5 41703 0 7.95267E-6
1-11186770-G-A p.Asp2145Asp synonymous MTOR 1 83396 1.1991E-5 41698 0 NA
1-11186773-A-G p.Tyr2144Tyr synonymous MTOR 1 83400 1.19904E-5 41700 0 5.76578E-5
1-11186833-T-C p.Gln2124Gln synonymous MTOR 2 83368 2.399E-5 41684 0 6.37024E-5
1-11186839-C-T p.Glu2122Glu synonymous MTOR 1 83360 1.19962E-5 41680 0 1.99045E-5
1-11186851-G-A p.Leu2118Leu splice_region+synonymous MTOR 1 83336 1.19996E-5 41668 0 6.36943E-5
1-11187061-T-C c.6351+6A>G splice_region MTOR 2 83354 2.3994E-5 41677 0 NA
1-11187087-T-C p.Ile2111Val missense MTOR 1 83368 1.1995E-5 41684 0 3.18471E-5
1-11187088-T-A p.Arg2110Arg synonymous MTOR 2 83366 2.39906E-5 41683 0 NA
1-11187090-G-C p.Arg2110Gly missense MTOR 1 83368 1.1995E-5 41684 0 NA
1-11187097-C-T p.Val2107Val synonymous MTOR 4 83364 4.79823E-5 41682 0 6.36862E-5
1-11187124-G-A p.Thr2098Thr synonymous MTOR 1 83382 1.1993E-5 41691 0 1.64756E-5
1-11187124-G-C p.Thr2098Thr synonymous MTOR 1 83382 1.1993E-5 41691 0 NA
1-11187139-A-G p.Asn2093Asn synonymous MTOR 3 83368 3.5985E-5 41684 0 2.78354E-5
1-11187142-C-A p.Gly2092Gly synonymous MTOR 2 83358 2.39929E-5 41679 0 3.97646E-6
1-11187162-T-C p.Arg2086Gly missense MTOR 2 83356 2.39935E-5 41678 0 NA
1-11187193-A-G p.Gly2075Gly synonymous MTOR 1 83356 1.19967E-5 41678 0 NA
1-11187208-G-C c.6217-7C>G splice_region MTOR 1 83328 1.20008E-5 41664 0 9.55597E-5
1-11187728-T-C p.Met2057Val missense MTOR 3 83350 3.59928E-5 41675 0 3.97807E-6
1-11187729-A-T p.Ala2056Ala synonymous MTOR 1 83344 1.19985E-5 41672 0 NA
1-11187743-C-G p.Glu2052Gln missense MTOR 1 83342 1.19988E-5 41671 0 NA
1-11187744-C-T p.Leu2051Leu synonymous MTOR 1 83338 1.19993E-5 41669 0 2.47476E-5
1-11187767-C-T p.Val2044Met missense MTOR 2 83326 2.40021E-5 41663 0 3.18552E-5
1-11187768-G-A p.Asn2043Asn synonymous MTOR 117 83316 0.00140429 41658 0 0.00360102
1-11187777-C-T p.Gly2040Gly synonymous MTOR 1 83312 1.20031E-5 41656 0 7.42244E-5
1-11187783-G-A p.Tyr2038Tyr synonymous MTOR 1 83300 1.20048E-5 41650 0 NA
1-11187807-G-A p.Gly2030Gly synonymous MTOR 1 83258 1.20109E-5 41629 0 NA
1-11187825-A-G p.His2024His synonymous MTOR 1 83222 1.20161E-5 41611 0 3.98473E-6
1-11187858-G-A p.Ser2013Ser synonymous MTOR 2 83076 2.40743E-5 41538 0 6.36862E-5
1-11187861-C-T p.Val2012Val splice_region+synonymous MTOR 1 83076 1.20372E-5 41538 0 NA
1-11188054-G-A c.6033+7C>T splice_region MTOR 2 82920 2.41196E-5 41460 0 8.25123E-6
1-11188058-C-T c.6033+3G>A splice_region MTOR 21 82956 2.53146E-4 41478 0 0.0025
1-11188086-T-C p.Asn2003Ser missense MTOR 1 83054 1.20404E-5 41527 0 3.18492E-5
1-11188100-CAT-C p.Met1998fs frameshift MTOR 1 83130 1.20294E-5 41565 0 NA
1-11188104-T-C p.Asn1997Ser missense MTOR 1 83132 1.20291E-5 41566 0 NA
1-11188116-T-C p.Lys1993Arg missense MTOR 2 83160 2.405E-5 41580 0 6.36254E-5
1-11188124-T-C p.Ala1990Ala synonymous MTOR 1 83180 1.20221E-5 41590 0 3.29576E-5
1-11188135-G-A p.Arg1987Trp missense MTOR 1 83150 1.20265E-5 41575 0 8.24022E-6
1-11188142-C-T p.Thr1984Thr synonymous MTOR 29 83118 3.48902E-4 41559 0 0.001875
1-11188166-C-T p.Leu1976Leu synonymous MTOR 1 83098 1.2034E-5 41549 0 NA
1-11188188-G-C c.5911-5C>G splice_region MTOR 1 82868 1.20674E-5 41434 0 1.19983E-5
1-11188191-A-T c.5911-8T>A splice_region MTOR 2 82788 2.41581E-5 41394 0 3.18492E-5
1-11188524-C-T p.Arg1966Gln missense MTOR 1 83258 1.20109E-5 41629 0 3.97665E-6
1-11188538-G-A p.Leu1961Leu synonymous MTOR 1 83300 1.20048E-5 41650 0 8.2394E-6
1-11188558-G-A p.Arg1955Cys missense MTOR 1 83306 1.20039E-5 41653 0 3.97643E-6
1-11188577-C-T p.Thr1948Thr synonymous MTOR 2 83296 2.40108E-5 41648 0 9.94083E-5
1-11188578-G-A p.Thr1948Met missense MTOR 2 83300 2.40096E-5 41650 0 NA
1-11188615-A-G c.5812-6T>C splice_region MTOR 1 83092 1.20349E-5 41546 0 NA
1-11188905-T-C c.5811+7A>G splice_region MTOR 1 83160 1.2025E-5 41580 0 NA
1-11188917-G-A p.Leu1936Leu synonymous MTOR 4 83248 4.80492E-5 41624 0 4.40777E-5
1-11188924-A-G p.Asp1933Asp synonymous MTOR 3 83276 3.60248E-5 41638 0 1.9934E-5
1-11188936-G-A p.Ala1929Ala synonymous MTOR 1 83308 1.20036E-5 41654 0 3.98356E-6
1-11188964-T-C p.Asn1920Ser missense MTOR 6 83332 7.20012E-5 41666 0 6.8803E-5
1-11188969-A-G p.Asp1918Asp synonymous MTOR 1 83326 1.20011E-5 41663 0 NA
1-11188975-C-T p.Trp1916* stop_gained MTOR 1 83320 1.20019E-5 41660 0 NA
1-11188985-T-C p.Tyr1913Cys missense MTOR 1 83282 1.20074E-5 41641 0 NA
1-11189002-G-C p.Leu1907Leu synonymous MTOR 1 83242 1.20132E-5 41621 0 NA
1-11189012-A-AGTGTATCCTGGAGGTTGTTGCCTCGTGAC c.5715-5_5715-4insGTCACGAGGCAACAACCTCCAGGATACAC splice_region MTOR 5 83162 6.01236E-5 41581 2 NA
1-11189815-G-A p.Asn1898Asn synonymous MTOR 1 83252 1.20117E-5 41626 0 NA
1-11189822-C-T p.Arg1896Gln missense MTOR 1 83276 1.20083E-5 41638 0 1.98899E-5
1-11189831-G-A p.Ser1893Phe missense MTOR 1 83290 1.20062E-5 41645 0 NA
1-11189840-C-T p.Arg1890His missense MTOR 1 83294 1.20057E-5 41647 0 9.55231E-5
1-11189856-C-T p.Val1885Ile missense MTOR 69 83272 8.2861E-4 41636 0 0.00375
1-11189866-C-T p.Thr1881Thr synonymous MTOR 1 83266 1.20097E-5 41633 0 8.27623E-6
1-11189882-G-A p.Thr1876Ile missense MTOR 1 83214 1.20172E-5 41607 0 1.59142E-5
1-11189897-T-TCAGTGACCTTCTTCTGCAGCGGCGATGGGGTGGGGCTGTTCTC c.5614-3_5614-2insGAGAACAGCCCCACCCCATCGCCGCTGCAGAAGAAGGTCACTG splice_region MTOR 3 83158 3.60759E-5 41579 1 NA
1-11189899-T-G c.5614-4A>C splice_region MTOR 1 83128 1.20296E-5 41564 0 NA
1-11190580-G-A c.5613+6C>T splice_region MTOR 1 79608 1.25616E-5 39804 0 NA
1-11190583-T-A c.5613+3A>T splice_region MTOR 1 79662 1.2553E-5 39831 0 1.66789E-5
1-11190595-C-T p.Lys1868Lys synonymous MTOR 9 79880 1.12669E-4 39940 0 4.30806E-4
1-11190595-C-G p.Lys1868Asn missense MTOR 2 79880 2.50376E-5 39940 0 NA
1-11190596-T-G p.Lys1868Thr missense MTOR 1 79888 1.25175E-5 39944 0 8.27965E-6
1-11190608-G-A p.Pro1864Leu missense MTOR 5 79938 6.25485E-5 39969 0 3.3018E-5
1-11190609-G-T p.Pro1864Thr missense MTOR 5 79950 6.25391E-5 39975 0 3.18878E-5
1-11190610-C-T p.Ser1863Ser synonymous MTOR 1 79938 1.25097E-5 39969 0 3.19428E-5
1-11190611-G-A p.Ser1863Leu missense MTOR 1 79952 1.25075E-5 39976 0 3.18857E-5
1-11190618-T-A p.Thr1861Ser missense MTOR 2 79910 2.50282E-5 39955 0 6.37714E-5
1-11190630-C-T p.Glu1857Lys missense MTOR 5 79934 6.25516E-5 39967 0 2.01201E-5
1-11190631-G-A p.Thr1856Thr synonymous MTOR 4 79944 5.0035E-5 39972 0 3.18695E-5
1-11190632-G-A p.Thr1856Ile missense MTOR 2 79944 2.50175E-5 39972 0 1.20673E-5
1-11190639-C-T p.Glu1854Lys missense MTOR 4 79914 5.00538E-5 39957 0 2.47517E-5
1-11190640-G-A p.Ala1853Ala synonymous MTOR 8 79900 1.00125E-4 39950 0 1.23756E-4
1-11190646-G-A p.Ser1851Ser synonymous MTOR 20594 79348 0.25954 39674 3016 0.282488
1-11190653-C-T p.Ser1849Asn missense MTOR 1 79986 1.25022E-5 39993 0 NA
1-11190666-C-T p.Glu1845Lys missense MTOR 1 79926 1.25116E-5 39963 0 1.60786E-5
1-11190672-T-G p.Ser1843Arg missense MTOR 1 79928 1.25113E-5 39964 0 NA
1-11190676-AGTGGTGGTGGCAGTGGCGGCC-A p.Ala1835_Thr1841del disruptive_inframe_deletion MTOR 1 79926 1.25116E-5 39963 0 8.04046E-6
1-11190679-G-GGTGGTGGCAGTGGCGGCC p.Thr1840_Thr1841insAlaAlaThrAlaThrThr disruptive_inframe_insertion MTOR 4 79920 5.00501E-5 39960 0 2.34419E-4
1-11190684-T-C p.Thr1839Ala missense MTOR 1 79884 1.25182E-5 39942 0 3.18593E-5
1-11190684-T-TGGCAGTGGCGGCCGTGGTGGC p.Ala1838_Thr1839insAlaThrThrAlaAlaThrAla conservative_inframe_insertion MTOR 1 79884 1.25182E-5 39942 0 1.68682E-5
1-11190687-CAGTGGCGGCCGT-C p.Thr1834_Thr1837del conservative_inframe_deletion MTOR 1 79850 1.25235E-5 39925 0 2.55524E-5
1-11190688-AGTGGCGGCC-A p.Ala1835_Thr1837del disruptive_inframe_deletion MTOR 1 79858 1.25222E-5 39929 0 NA
1-11190693-C-T p.Ala1836Thr missense MTOR 4 79738 5.01643E-5 39869 0 0.00103842
1-11190693-C-A p.Ala1836Ser missense MTOR 1 79738 1.25411E-5 39869 0 6.37877E-5
1-11190694-G-A p.Ala1835Ala synonymous MTOR 11 79762 1.3791E-4 39881 1 5.23149E-5
1-11190697-CGTGGTGGCGGCA-C p.Ala1831_Thr1834del disruptive_inframe_deletion MTOR 44 79636 5.52514E-4 39818 0 0.0011097
1-11190697-C-T p.Thr1834Thr synonymous MTOR 1 79638 1.25568E-5 39819 0 6.98373E-5
1-11190698-G-A p.Thr1834Met missense MTOR 33 79626 4.14437E-4 39813 0 4.38397E-4
1-11190705-C-T p.Ala1832Thr missense MTOR 3 79640 3.76695E-5 39820 0 9.57304E-5
1-11190706-G-A p.Ala1831Ala synonymous MTOR 1 79666 1.25524E-5 39833 0 3.18817E-5
1-11190708-CAGTGGTGGCGTT-C p.Asn1827_Thr1830del conservative_inframe_deletion MTOR 2 79654 2.51086E-5 39827 0 NA
1-11190711-T-C p.Thr1830Ala missense MTOR 1 79664 1.25527E-5 39832 0 NA
1-11190713-G-C p.Thr1829Ser missense MTOR 2 79664 2.51054E-5 39832 0 1.22023E-5
1-11190717-C-T p.Ala1828Thr missense MTOR 1 79602 1.25625E-5 39801 0 3.19081E-5
1-11190718-G-A p.Asn1827Asn synonymous MTOR 1 79668 1.25521E-5 39834 0 6.37471E-5
1-11190726-T-C p.Ile1825Val missense MTOR 1 79752 1.25389E-5 39876 0 1.2294E-5
1-11190730-G-A p.Ala1823Ala synonymous MTOR 1416 79712 0.0177639 39856 33 0.0296836
1-11190736-G-A p.Ser1821Ser synonymous MTOR 1 79740 1.25408E-5 39870 0 2.26578E-5
1-11190737-C-G p.Ser1821Thr missense MTOR 2 79762 2.50746E-5 39881 0 1.2481E-5
1-11190746-C-T p.Arg1818His missense MTOR 5 79740 6.27038E-5 39870 0 2.47893E-4
1-11190748-C-T p.Leu1817Leu synonymous MTOR 1 79744 1.25401E-5 39872 0 NA
1-11190748-C-A p.Leu1817Leu synonymous MTOR 1 79744 1.25401E-5 39872 0 NA
1-11190751-TTTC-T p.Lys1816del disruptive_inframe_deletion MTOR 1 79774 1.25354E-5 39887 0 3.90533E-5
1-11190765-C-T p.Asp1812Asn missense MTOR 1 79706 1.25461E-5 39853 0 1.54669E-5
1-11190766-G-A p.Arg1811Arg synonymous MTOR 3 79676 3.76525E-5 39838 0 3.13529E-5
1-11190767-C-T p.Arg1811His missense MTOR 1 79658 1.25537E-5 39829 0 NA
1-11190796-C-T p.Val1801Val synonymous MTOR 3 79448 3.77605E-5 39724 0 NA
1-11190817-T-G p.Ala1794Ala synonymous MTOR 1 79112 1.26403E-5 39556 0 2.24964E-5
1-11190823-C-T c.-10G>A 5_prime_UTR_premature_start_codon_gain MTOR 2 78844 2.53665E-5 39422 0 1.27478E-4
1-11190836-T-TTGTACCAGCTGC c.5365-3_5365-2insGCAGCTGGTACA splice_region MTOR 4 78414 5.10113E-5 39207 1 NA
1-11190839-T-C c.5365-5A>G splice_region MTOR 2 78228 2.55663E-5 39114 0 3.18735E-5
1-11190907-G-A c.-94C>T 5_prime_UTR_premature_start_codon_gain MTOR 1 68554 1.4587E-5 34277 0 NA
1-11190992-T-A c.-179A>T 5_prime_UTR_premature_start_codon_gain MTOR 1 39534 2.52947E-5 19767 0 NA
1-11191043-T-C c.-230A>G 5_prime_UTR_premature_start_codon_gain MTOR 1 24836 4.02641E-5 12418 0 3.18512E-5
1-11191057-G-A c.-244C>T 5_prime_UTR_premature_start_codon_gain MTOR 1 22318 4.48069E-5 11159 0 3.18492E-5
1-11191237-G-C c.-424C>G 5_prime_UTR_premature_start_codon_gain MTOR 2 1542 0.00129702 771 0 NA
1-11193147-C-T p.Ser1785Asn missense MTOR 1 83070 1.2038E-5 41535 0 NA
1-11193150-C-T p.Arg1784His missense MTOR 1 83092 1.20349E-5 41546 0 4.11963E-5
1-11193151-G-A p.Arg1784Cys missense MTOR 2 83126 2.40599E-5 41563 0 6.37064E-5
1-11193154-C-T p.Asp1783Asn missense MTOR 1 83124 1.20302E-5 41562 0 3.97842E-6
1-11193155-G-A p.His1782His synonymous MTOR 3 83134 3.60863E-5 41567 0 2.4715E-5
1-11193156-T-C p.His1782Arg missense MTOR 2 83146 2.40541E-5 41573 0 8.23832E-6
1-11193166-C-T p.Ala1779Thr missense MTOR 7 83196 8.41387E-5 41598 0 0.00100705
1-11193167-G-A p.Ala1778Ala synonymous MTOR 5 83170 6.01178E-5 41585 0 9.55779E-5
1-11193169-C-T p.Ala1778Thr missense MTOR 1 83194 1.20201E-5 41597 0 8.23723E-6
1-11193170-G-A p.Ser1777Ser synonymous MTOR 2 83206 2.40367E-5 41603 0 1.98863E-5
1-11193173-GTAGTACTGCAGCACT-G p.Lys1771_Tyr1776delinsAsn disruptive_inframe_deletion MTOR 1 83238 1.20137E-5 41619 0 NA
1-11193177-T-C p.Tyr1775Cys missense MTOR 1 83230 1.20149E-5 41615 0 8.23696E-6
1-11193187-C-T p.Val1772Met missense MTOR 1 83278 1.2008E-5 41639 0 NA
1-11193207-T-C p.Asn1765Ser missense MTOR 1 83296 1.20054E-5 41648 0 NA
1-11193227-C-T p.Gln1758Gln synonymous MTOR 1 83328 1.20008E-5 41664 0 2.22424E-4
1-11193251-G-A p.Cys1750Cys synonymous MTOR 1 83312 1.20031E-5 41656 0 NA
1-11193258-G-A c.5247-4C>T splice_region MTOR 2 83262 2.40206E-5 41631 0 3.97703E-6
1-11193262-C-T c.5247-8G>A splice_region MTOR 3 83250 3.6036E-5 41625 0 1.40098E-4
1-11194399-GG-AC c.5246+8_5246+9delCCinsGT splice_region MTOR 483 82494 0.00585497 41247 6 NA
1-11194400-G-C c.5246+8C>G splice_region MTOR 14 82496 1.69705E-4 41248 2 0.00937602
1-11194410-G-T p.Ala1748Ala splice_region+synonymous MTOR 18 82694 2.1767E-4 41347 0 1.91107E-4
1-11194416-G-A p.Leu1746Leu synonymous MTOR 2 82814 2.41505E-5 41407 0 4.94813E-5
1-11194424-G-A p.His1744Tyr missense MTOR 1 82896 1.20633E-5 41448 0 1.59112E-5
1-11194425-C-T p.Leu1743Leu synonymous MTOR 2 82902 2.41249E-5 41451 0 8.24334E-6
1-11194427-G-C p.Leu1743Val missense MTOR 2 82920 2.41196E-5 41460 0 NA
1-11194438-T-C p.His1739Arg missense MTOR 1 82964 1.20534E-5 41482 0 NA
1-11194441-T-G p.Gln1738Pro missense MTOR 1 82986 1.20502E-5 41493 0 8.23968E-6
1-11194443-C-T p.Gln1737Gln synonymous MTOR 3 83008 3.61411E-5 41504 0 NA
1-11194457-C-T p.Ala1733Thr missense MTOR 7 83042 8.42947E-5 41521 0 1.40056E-4
1-11194467-C-A p.Gln1729His missense MTOR 18 83050 2.16737E-4 41525 0 5.41367E-4
1-11194483-A-G p.Met1724Thr missense MTOR 1 83046 1.20415E-5 41523 0 7.95342E-6
1-11194500-C-T p.Gln1718Gln synonymous MTOR 1 83008 1.2047E-5 41504 0 8.23954E-6
1-11194520-C-T p.Asp1712Asn missense MTOR 1 82858 1.20688E-5 41429 0 3.18492E-5
1-11194521-G-A p.Ile1711Ile splice_region+synonymous MTOR 12 82844 1.44851E-4 41422 0 6.25E-4
1-11199356-C-A c.5130+5G>T splice_region MTOR 3 83100 3.61011E-5 41550 0 NA
1-11199365-C-T p.Arg1709His missense MTOR 1 83222 1.20161E-5 41611 0 8.23683E-6
1-11199366-G-A p.Arg1709Cys missense MTOR 1 83228 1.20152E-5 41614 0 NA
1-11199369-C-T p.Ala1708Thr missense MTOR 1 83258 1.20109E-5 41629 0 NA
1-11199394-G-A p.Ala1699Ala synonymous MTOR 1 83322 1.20016E-5 41661 0 3.29571E-5
1-11199397-A-G p.Tyr1698Tyr synonymous MTOR 1 83330 1.20005E-5 41665 0 2.47145E-5
1-11199417-C-A p.Val1692Phe missense MTOR 2 83338 2.39987E-5 41669 0 3.98975E-6
1-11199439-T-G p.Gln1684His missense MTOR 3 83338 3.5998E-5 41669 0 5.03525E-4
1-11199439-T-C p.Gln1684Gln synonymous MTOR 2 83338 2.39987E-5 41669 0 8.23683E-6
1-11199443-C-T p.Arg1683Gln missense MTOR 1 83328 1.20008E-5 41664 0 8.23683E-6
1-11199444-G-A p.Arg1683Trp missense MTOR 1 83340 1.1999E-5 41670 0 9.55657E-5
1-11199448-C-T p.Pro1681Pro synonymous MTOR 474 83326 0.0056885 41663 7 0.0110892
1-11199471-C-G p.Val1674Leu missense MTOR 1 83338 1.19993E-5 41669 0 NA
1-11199473-A-G p.Leu1673Ser missense MTOR 1 83332 1.20002E-5 41666 0 0.00100705
1-11199475-A-G p.Thr1672Thr synonymous MTOR 2 83336 2.39992E-5 41668 0 5.03525E-4
1-11199491-GCCTTAAAAATAAGAGAAACTGGGTTATAGACAGAACTGGACAGCCCAGGGACACCATGGGGCCCTACCTGCCCATGTGGGTGGGTGGTTGTCACTCA-G p.Ala1667fs frameshift MTOR 12 83308 1.44044E-4 41654 5 NA
1-11199495-TA-T c.4999-4delT splice_region MTOR 2 83294 2.40113E-5 41647 0 4.11875E-5
1-11199590-C-T p.Leu1666Leu splice_region+synonymous MTOR 1 83244 1.20129E-5 41622 0 NA
1-11199600-C-T p.Ser1663Asn missense MTOR 2 83310 2.40067E-5 41655 0 1.19308E-5
1-11199608-G-A p.Cys1660Cys synonymous MTOR 12 83294 1.44068E-4 41647 0 5.03525E-4
1-11199616-T-C p.Ser1658Gly missense MTOR 2 83312 2.40061E-5 41656 0 NA
1-11199647-A-C p.His1647Gln missense MTOR 29 83320 3.48056E-4 41660 0 3.82312E-4
1-11199652-G-A p.Pro1646Ser missense MTOR 2 83314 2.40056E-5 41657 0 5.03525E-4
1-11199652-G-C p.Pro1646Ala missense MTOR 1 83314 1.20028E-5 41657 0 NA
1-11199666-G-A p.Ser1641Phe missense MTOR 3 83314 3.60084E-5 41657 0 6.36943E-5
1-11199674-C-T p.Met1638Ile missense MTOR 2 83298 2.40102E-5 41649 0 NA
1-11199680-G-A p.Ile1636Ile synonymous MTOR 32 83286 3.84218E-4 41643 0 2.86697E-4
1-11199692-G-A p.Asp1632Asp synonymous MTOR 7 83290 8.40437E-5 41645 0 7.41559E-5
1-11199698-T-C p.Val1630Val synonymous MTOR 5 83260 6.00528E-5 41630 0 6.37024E-5
1-11199701-G-A p.Ile1629Ile synonymous MTOR 1 83242 1.20132E-5 41621 0 4.12113E-5
1-11199703-T-G p.Ile1629Leu missense MTOR 1 83226 1.20155E-5 41613 0 3.97823E-6
1-11199704-A-C p.Arg1628Arg synonymous MTOR 30 83220 3.6049E-4 41610 0 6.37105E-4
1-11199705-C-T p.Arg1628His missense MTOR 2 83220 2.40327E-5 41610 0 8.24362E-6
1-11204710-G-A p.Leu1623Leu synonymous MTOR 1 83186 1.20213E-5 41593 0 8.25314E-6
1-11204725-T-A p.Ile1618Phe missense MTOR 1 83296 1.20054E-5 41648 0 NA
1-11204731-G-A p.Arg1616Cys missense MTOR 4 83316 4.801E-5 41658 0 2.86697E-4
1-11204736-A-G p.Ile1614Thr missense MTOR 16 83342 1.9198E-4 41671 0 2.63791E-4
1-11204740-C-T p.Glu1613Lys missense MTOR 2 83356 2.39935E-5 41678 0 1.19326E-5
1-11204742-C-T p.Arg1612Gln missense MTOR 2 83352 2.39946E-5 41676 0 8.24389E-6
1-11204749-C-T p.Glu1610Lys missense MTOR 9 83352 1.07976E-4 41676 0 9.56145E-5
1-11204750-G-A p.Pro1609Pro synonymous MTOR 2 83352 2.39946E-5 41676 0 1.98957E-5
1-11204754-A-C p.Val1608Gly missense MTOR 1 83362 1.19959E-5 41681 0 NA
1-11204774-C-G p.Glu1601Asp missense MTOR 2 83376 2.39877E-5 41688 0 NA
1-11204782-G-C p.Leu1599Val missense MTOR 1 83374 1.19941E-5 41687 0 3.18532E-5
1-11204782-G-A p.Leu1599Leu synonymous MTOR 1 83374 1.19941E-5 41687 0 7.97277E-6
1-11204792-C-T p.Met1595Ile missense MTOR 1 83370 1.19947E-5 41685 0 NA
1-11204810-G-A p.Ala1589Ala splice_region+synonymous MTOR 1 83352 1.19973E-5 41676 0 NA
1-11204811-GCCTGATGGAAGCAAATCGCATTCCAAACTAATTACTGCACGAACAATCCAAAAGACAGGATTAATTTAAATCATTCCTTCTGGTGTCAGGGTATCTGCCGATCAGAGAAAACAGGCATGTTTCCAGCAGCCTGTAAGTTCTCAATAGCCCATTCTGAAAAAAGTATGGAAATAAGCCTCAAAAATGACAATGTGCAGAATAGTTGACACTTA-G p.Ala1589fs frameshift MTOR 2 83348 2.39958E-5 41674 0 NA
1-11205039-T-A p.Ser1584Cys missense MTOR 1 83276 1.20083E-5 41638 0 8.239E-6
1-11205049-T-C p.Gly1580Gly synonymous MTOR 1 83244 1.20129E-5 41622 0 0.0015121
1-11205058-C-T p.Ala1577Ala synonymous MTOR 53209 82956 0.641412 41478 18374 0.686875
1-11205079-C-A p.Leu1570Leu synonymous MTOR 2 83206 2.40367E-5 41603 0 NA
1-11205085-C-T p.Arg1568Arg synonymous MTOR 1 83176 1.20227E-5 41588 0 NA
1-11205091-C-T p.Lys1566Lys synonymous MTOR 21 83148 2.52562E-4 41574 0 1.23316E-4
1-11206739-T-C p.Ala1560Ala synonymous MTOR 4 82840 4.82859E-5 41420 0 6.37186E-5
1-11206742-C-T p.Leu1559Leu synonymous MTOR 1 82866 1.20677E-5 41433 0 NA
1-11206852-TAC-T c.4571-6_4571-5delGT splice_region MTOR 1 82664 1.20972E-5 41332 0 3.30147E-5
1-11206852-T-TACAC c.4571-5_4571-4insGTGT splice_region MTOR 1 82672 1.2096E-5 41336 0 NA
1-11206856-C-T c.4571-8G>A splice_region MTOR 1 82668 1.20966E-5 41334 0 8.2511E-6
1-11210178-T-C c.4570+5A>G splice_region MTOR 3 82618 3.63117E-5 41309 0 1.99065E-5
1-11210211-C-G p.Arg1514Arg synonymous MTOR 1 83136 1.20285E-5 41568 0 NA
1-11210238-A-G p.Asn1505Asn synonymous MTOR 1 83192 1.20204E-5 41596 0 1.59106E-5
1-11210240-T-C p.Asn1505Asp missense MTOR 1 83196 1.20198E-5 41598 0 NA
1-11210244-C-T p.Leu1503Leu synonymous MTOR 1 83192 1.20204E-5 41596 0 3.18634E-5
1-11210246-G-A p.Leu1503Leu synonymous MTOR 1 83174 1.2023E-5 41587 0 NA
1-11210278-T-C p.Gln1492Arg missense MTOR 3 83048 3.61237E-5 41524 0 1.09308E-4
1-11210284-C-CATTCCCCCAAGGCCTCGAGGCAGCGCA c.4470-2_4470-1insTGCGCTGCCTCGAGGCCTTGGGGGAAT splice_acceptor MTOR 3 83012 3.61394E-5 41506 1 NA
1-11210286-G-A c.4470-3C>T splice_region MTOR 19 82956 2.29037E-4 41478 0 2.5481E-4
1-11217231-A-G p.Cys1483Arg missense MTOR 1 83112 1.2032E-5 41556 0 NA
1-11217233-C-T p.Arg1482His missense MTOR 3 83124 3.60907E-5 41562 0 8.07207E-6
1-11217234-G-A p.Arg1482Cys missense MTOR 1 83122 1.20305E-5 41561 0 NA
1-11217254-T-A p.Glu1475Val missense MTOR 1 83206 1.20184E-5 41603 0 NA
1-11217262-G-A p.Asp1472Asp synonymous MTOR 68 83212 8.1719E-4 41606 1 0.00210271
1-11217269-T-C p.Asn1470Ser missense MTOR 1 83236 1.2014E-5 41618 0 3.18552E-5
1-11217281-T-A p.Lys1466Ile missense MTOR 1 83242 1.20132E-5 41621 0 NA
1-11217308-T-A p.Glu1457Val missense MTOR 1 83274 1.20085E-5 41637 0 NA
1-11227540-C-T p.Ala1430Thr missense MTOR 1 83046 1.20415E-5 41523 0 NA
1-11227541-C-T p.Ala1429Ala synonymous MTOR 1 83042 1.20421E-5 41521 0 3.18552E-5
1-11227551-G-A p.Pro1426Leu missense MTOR 1 82978 1.20514E-5 41489 0 8.23927E-6
1-11227566-T-C p.Asn1421Ser missense MTOR 1 82918 1.20601E-5 41459 0 NA
1-11227568-A-G p.Asn1420Asn synonymous MTOR 64 82914 7.71884E-4 41457 3 0.00317764
1-11227577-G-A c.4254-3C>T splice_region MTOR 1 82838 1.20718E-5 41419 0 NA
1-11227578-A-ATGAGAGATTCTAGAATGGCAGGGGTGGGGCCTTTCTG c.4254-5_4254-4insCAGAAAGGCCCCACCCCTGCCATTCTAGAATCTCTCA splice_region MTOR 1 82812 1.20755E-5 41406 0 NA
1-11259326-T-C p.Glu1414Glu synonymous MTOR 1 83278 1.2008E-5 41639 0 NA
1-11259338-A-G p.Pro1410Pro synonymous MTOR 1 83244 1.20129E-5 41622 0 3.97798E-6
1-11259348-C-T p.Gly1407Asp missense MTOR 1 83202 1.20189E-5 41601 0 NA
1-11259367-C-T p.Glu1401Lys missense MTOR 1 83248 1.20123E-5 41624 0 NA
1-11259404-G-A p.Ala1388Ala synonymous MTOR 10 83224 1.20158E-4 41612 0 1.43212E-4
1-11259413-C-G p.Glu1385Asp missense MTOR 2 83200 2.40385E-5 41600 0 NA
1-11259416-A-T p.Gly1384Gly synonymous MTOR 1 83202 1.20189E-5 41601 0 NA
1-11259440-A-C p.Asp1376Glu missense MTOR 6 83200 7.21154E-5 41600 0 3.97852E-6
1-11259458-G-A p.Gly1370Gly splice_region+synonymous MTOR 1 83184 1.20215E-5 41592 0 8.2371E-6
1-11259622-A-G p.Ala1361Ala synonymous MTOR 1 83316 1.20025E-5 41658 0 3.97757E-6
1-11259643-T-C p.Thr1354Thr synonymous MTOR 1 83290 1.20062E-5 41645 0 NA
1-11259655-G-A p.Ile1350Ile synonymous MTOR 58 83264 6.9658E-4 41632 0 0.00184737
1-11259692-A-C p.Ile1338Ser missense MTOR 1 83238 1.20137E-5 41619 0 NA
1-11259694-G-A p.Leu1337Leu synonymous MTOR 1 83224 1.20158E-5 41612 0 3.97795E-6
1-11259696-G-A p.Leu1337Phe missense MTOR 1 83208 1.20181E-5 41604 0 NA
1-11259709-A-T p.Asp1332Glu missense MTOR 1 83196 1.20198E-5 41598 0 3.18552E-5
1-11259710-T-A p.Asp1332Val missense MTOR 2 83192 2.40408E-5 41596 0 3.97836E-6
1-11259715-A-G p.Asn1330Asn synonymous MTOR 3 83180 3.60664E-5 41590 0 NA
1-11259727-C-A p.Trp1326Cys missense MTOR 1 83120 1.20308E-5 41560 0 NA
1-11259733-G-C p.Ser1324Ser synonymous MTOR 1 83110 1.20322E-5 41555 0 NA
1-11259741-A-AGAAC p.Phe1322fs frameshift MTOR 1 83058 1.20398E-5 41529 0 NA
1-11259742-T-C p.Ala1321Ala synonymous MTOR 1 83054 1.20404E-5 41527 0 3.98016E-6
1-11259744-C-G p.Ala1321Pro missense MTOR 1 83044 1.20418E-5 41522 0 NA
1-11259759-C-T p.Asp1316Asn missense+splice_region MTOR 2 82928 2.41173E-5 41464 0 NA
1-11259763-G-GGCC c.3945-4_3945-3insGGC splice_region MTOR 7 82912 8.44269E-5 41456 1 NA
1-11264577-TCTATGTGCTGATCTTCTCCACCCGCCCTGACACA-T c.3944+7_3944+40delTGTGTCAGGGCGGGTGGAGAAGATCAGCACATAG splice_region MTOR 1 81842 1.22187E-5 40921 0 3.1839E-5
1-11264610-C-G c.3944+8G>C splice_region MTOR 1 82658 1.2098E-5 41329 0 NA
1-11264614-A-G c.3944+4T>C splice_region MTOR 1 82674 1.20957E-5 41337 0 8.31532E-6
1-11264625-T-C p.Met1313Val missense MTOR 2 82712 2.41803E-5 41356 0 NA
1-11264668-G-C p.Pro1298Pro synonymous MTOR 2 82680 2.41896E-5 41340 0 2.47971E-5
1-11264674-T-C p.Ser1296Ser synonymous MTOR 2 82654 2.41973E-5 41327 0 7.43531E-5
1-11264728-A-G p.Asp1278Asp synonymous MTOR 2 82810 2.41517E-5 41405 0 3.18735E-5
1-11264749-A-T p.Ala1271Ala synonymous MTOR 3 82730 3.62625E-5 41365 0 8.34014E-6
1-11264752-G-A p.Gly1270Gly synonymous MTOR 1 82626 1.21027E-5 41313 0 5.84668E-5
1-11264762-T-TTTTGGAGGTTGATGGTGCTGACGTGCAGTTTCTTCATGG c.3802-3_3802-2insCCATGAAGAAACTGCACGTCAGCACCATCAACCTCCAAA splice_region MTOR 2 82510 2.42395E-5 41255 1 NA
1-11264764-T-C c.3802-4A>G splice_region MTOR 13 82478 1.57618E-4 41239 0 3.50385E-4
1-11264765-G-A c.3802-5C>T splice_region MTOR 1 82484 1.21236E-5 41242 0 NA
1-11264768-C-A c.3802-8G>T splice_region MTOR 3 82442 3.63892E-5 41221 0 4.40095E-5
1-11264768-C-T c.3802-8G>A splice_region MTOR 1 82442 1.21297E-5 41221 0 NA
1-11269393-G-A p.His1259His synonymous MTOR 1 83396 1.1991E-5 41698 0 0.00100705
1-11269398-G-A p.Leu1258Leu synonymous MTOR 1 83388 1.19921E-5 41694 0 7.95399E-6
1-11269437-A-G p.Leu1245Leu synonymous MTOR 2 83392 2.39831E-5 41696 0 9.55475E-5
1-11269438-T-C p.Ala1244Ala synonymous MTOR 1 83398 1.19907E-5 41699 0 7.95361E-6
1-11269444-C-T p.Gly1242Gly synonymous MTOR 1 83398 1.19907E-5 41699 0 3.97674E-6
1-11269464-T-C p.Met1236Val missense MTOR 1 83362 1.19959E-5 41681 0 NA
1-11269464-T-G p.Met1236Leu missense MTOR 4 83362 4.79835E-5 41681 0 1.98837E-5
1-11269469-T-A p.His1234Leu missense MTOR 1 83356 1.19967E-5 41678 0 NA
1-11269471-C-T p.Gln1233Gln synonymous MTOR 1 83356 1.19967E-5 41678 0 8.23655E-6
1-11269488-C-A p.Asp1228Tyr missense MTOR 2 83356 2.39935E-5 41678 0 8.2371E-6
1-11269493-T-C p.Glu1226Gly missense MTOR 1 83352 1.19973E-5 41676 0 NA
1-11269497-C-T p.Glu1225Lys missense MTOR 1 83340 1.1999E-5 41670 0 NA
1-11269499-T-C p.Asp1224Gly missense MTOR 1 83344 1.19985E-5 41672 0 3.97725E-6
1-11269506-G-C p.Leu1222Val missense MTOR 2 83330 2.4001E-5 41665 0 3.1839E-5
1-11269507-T-C p.Thr1221Thr synonymous MTOR 1 83332 1.20002E-5 41666 0 NA
1-11269521-A-G c.3655-6T>C splice_region MTOR 1 83284 1.20071E-5 41642 0 NA
1-11269522-C-G c.3655-7G>C splice_region MTOR 5 83286 6.00341E-5 41643 0 9.55414E-5
1-11270874-G-A p.Val1217Val synonymous MTOR 1 82020 1.21921E-5 41010 0 8.32071E-5
1-11270876-C-G p.Val1217Leu missense MTOR 1 82052 1.21874E-5 41026 0 3.1835E-5
1-11270879-T-C p.Ile1216Val missense MTOR 8 82076 9.74706E-5 41038 0 5.03525E-4
1-11270880-T-C p.Arg1215Arg synonymous MTOR 1 82086 1.21823E-5 41043 0 NA
1-11270886-G-A p.Ile1213Ile synonymous MTOR 2 82160 2.43427E-5 41080 0 NA
1-11270895-A-G p.Asp1210Asp synonymous MTOR 22 82230 2.67542E-4 41115 0 0.00151057
1-11270897-C-T p.Asp1210Asn missense MTOR 6 82234 7.29625E-5 41117 0 2.39973E-5
1-11270901-G-A p.Arg1208Arg synonymous MTOR 1 82248 1.21584E-5 41124 0 4.15545E-5
1-11270902-C-T p.Arg1208His missense MTOR 9 82250 1.09422E-4 41125 0 2.00003E-5
1-11270903-G-C p.Arg1208Gly missense MTOR 1 82250 1.21581E-5 41125 0 8.00166E-6
1-11270903-G-A p.Arg1208Cys missense MTOR 1 82250 1.21581E-5 41125 0 9.55231E-5
1-11270908-T-C p.His1206Arg missense MTOR 1 82300 1.21507E-5 41150 0 NA
1-11270926-A-G p.Val1200Ala missense MTOR 1 82428 1.21318E-5 41214 0 7.99169E-6
1-11270927-C-A p.Val1200Leu missense MTOR 2 82428 2.42636E-5 41214 0 NA
1-11270938-T-C p.Asn1196Ser missense MTOR 2 82508 2.42401E-5 41254 0 NA
1-11270945-T-C p.Met1194Val missense MTOR 2 82572 2.42213E-5 41286 0 3.99482E-6
1-11270965-T-TTCTTCCCCAGCTGA c.3562-3_3562-2insTCAGCTGGGGAAGA splice_region MTOR 1 82490 1.21227E-5 41245 0 NA
1-11270965-T-TTCTTCCCCAGCTG c.3562-3_3562-2insCAGCTGGGGAAGA splice_region MTOR 1 82490 1.21227E-5 41245 0 NA
1-11272380-G-C p.Leu1184Val missense MTOR 1 82938 1.20572E-5 41469 0 3.99898E-5
1-11272393-T-C p.Ser1179Ser synonymous MTOR 3 83056 3.61202E-5 41528 0 1.99442E-5
1-11272399-C-T p.Leu1177Leu synonymous MTOR 2 83084 2.4072E-5 41542 0 8.25287E-6
1-11272404-T-A p.Thr1176Ser missense MTOR 1 83104 1.20331E-5 41552 0 NA
1-11272404-T-C p.Thr1176Ala missense MTOR 2 83104 2.40662E-5 41552 0 5.77262E-5
1-11272410-T-C p.Met1174Val missense MTOR 1 83142 1.20276E-5 41571 0 NA
1-11272416-T-C p.Thr1172Ala missense MTOR 1 83140 1.20279E-5 41570 0 3.18481E-5
1-11272422-G-A p.Arg1170Cys missense MTOR 2 83144 2.40547E-5 41572 0 1.64807E-5
1-11272448-C-T p.Arg1161Gln missense MTOR 1 83156 1.20256E-5 41578 0 8.23859E-6
1-11272449-G-C p.Arg1161Gly missense MTOR 7 83160 8.41751E-5 41580 0 6.37227E-5
1-11272453-A-G p.Ile1159Ile synonymous MTOR 1 83158 1.20253E-5 41579 0 NA
1-11272468-C-G p.Arg1154Arg synonymous MTOR 757 83140 0.00910512 41570 11 0.0198051
1-11272474-G-T p.Ala1152Ala synonymous MTOR 2 83154 2.40518E-5 41577 0 8.75559E-5
1-11272478-T-C p.Tyr1151Cys missense MTOR 29 83152 3.48759E-4 41576 0 2.06046E-4
1-11272481-T-C p.Asp1150Gly missense MTOR 1 83156 1.20256E-5 41578 0 NA
1-11272489-A-G p.Asp1147Asp synonymous MTOR 1 83150 1.20265E-5 41575 0 8.24688E-6
1-11272494-G-A p.Leu1146Leu synonymous MTOR 1 83146 1.2027E-5 41573 0 3.98061E-6
1-11272509-G-A p.Arg1141Cys missense MTOR 3 83096 3.61028E-5 41548 0 2.48381E-5
1-11272529-G-A p.Ala1134Val missense+splice_region MTOR 6 82906 7.23711E-5 41453 0 3.51606E-4
1-11272531-C-CTTTCGAGATGGCAGTGGAG c.3399-1_3399insCTCCACTGCCATCTCGAAA splice_acceptor MTOR 2 82894 2.41272E-5 41447 1 NA
1-11272856-C-T p.Arg1132Gln missense MTOR 1 82986 1.20502E-5 41493 0 3.97902E-6
1-11272871-G-A p.Ala1127Val missense MTOR 1 83106 1.20328E-5 41553 0 NA
1-11272873-T-C p.Glu1126Glu synonymous MTOR 3 83094 3.61037E-5 41547 0 NA
1-11272899-T-C p.Ile1118Val missense MTOR 1 83080 1.20366E-5 41540 0 3.57981E-5
1-11272924-G-A p.Asp1109Asp synonymous MTOR 1 83000 1.20482E-5 41500 0 NA
1-11272933-G-A p.Asn1106Asn synonymous MTOR 1 82886 1.20648E-5 41443 0 NA
1-11272950-GG-AA p.IleGln1100* stop_gained MTOR 1 82688 1.20937E-5 41344 0 NA
1-11272953-T-C p.Ile1100Val missense MTOR 1 82646 1.20998E-5 41323 0 3.29685E-5
1-11272968-G-A c.3286-3C>T splice_region MTOR 1 82354 1.21427E-5 41177 0 NA
1-11272970-A-G c.3286-5T>C splice_region MTOR 1 82318 1.2148E-5 41159 0 3.98521E-6
1-11272973-A-C c.3286-8T>G splice_region MTOR 1 82238 1.21598E-5 41119 0 8.25573E-6
1-11273451-C-T c.3285+5G>A splice_region MTOR 1 82124 1.21767E-5 41062 0 NA
1-11273465-G-A p.Val1092Val synonymous MTOR 3 82516 3.63566E-5 41258 0 5.82179E-5
1-11273470-T-C p.Ile1091Val missense MTOR 5 82622 6.05166E-5 41311 0 1.65868E-5
1-11273471-G-A p.Arg1090Arg synonymous MTOR 1 82616 1.21042E-5 41308 0 3.99211E-6
1-11273472-C-T p.Arg1090His missense MTOR 1 82642 1.21004E-5 41321 0 1.6581E-5
1-11273494-T-C p.Met1083Val missense MTOR 12 82992 1.44592E-4 41496 0 1.7315E-4
1-11273502-C-T p.Arg1080His missense MTOR 3 83016 3.61376E-5 41508 0 1.64864E-5
1-11273503-G-A p.Arg1080Cys missense MTOR 2 83026 2.40888E-5 41513 0 6.37186E-5
1-11273516-G-A p.Ile1075Ile synonymous MTOR 2 83092 2.40697E-5 41546 0 NA
1-11273521-G-A p.Leu1074Leu synonymous MTOR 1 83088 1.20354E-5 41544 0 8.2394E-6
1-11273549-C-T p.Gly1064Gly synonymous MTOR 2 83120 2.40616E-5 41560 0 3.18695E-5
1-11273588-C-T p.Thr1051Thr synonymous MTOR 17 83032 2.0474E-4 41516 0 5.41815E-4
1-11273589-G-A p.Thr1051Met missense MTOR 1 83028 1.20441E-5 41514 0 3.30038E-5
1-11273600-T-C p.Ser1047Ser synonymous MTOR 2 82952 2.41103E-5 41476 0 8.27007E-6
1-11273623-C-CTCTCATGAGGGTGACTATTTCATCCATATAAGGTCTGATGTGG c.3118-1_3118insCCACATCAGACCTTATATGGATGAAATAGTCACCCTCATGAGA splice_acceptor MTOR 1 82702 1.20916E-5 41351 0 NA
1-11273623-C-CTCTCATGAGGGTGACTATTTCATCCATATAAGGT c.3118-1_3118insACCTTATATGGATGAAATAGTCACCCTCATGAGA splice_acceptor MTOR 2 82702 2.41832E-5 41351 1 NA
1-11273623-C-CTCTCATGAGGGTGACTATTTCATCCATATAAGGTCTGATGTGGCT c.3118-1_3118insAGCCACATCAGACCTTATATGGATGAAATAGTCACCCTCATGAGA splice_acceptor MTOR 1 82702 1.20916E-5 41351 0 NA
1-11273628-A-G c.3118-5T>C splice_region MTOR 1 82586 1.21086E-5 41293 0 NA
1-11273629-AAG-A c.3118-8_3118-7delCT splice_region MTOR 1 82554 1.21133E-5 41277 0 4.01242E-6
1-11276244-G-A p.His1026His synonymous MTOR 1 83236 1.2014E-5 41618 0 3.98016E-6
1-11276274-C-T p.Leu1016Leu synonymous MTOR 2 83222 2.40321E-5 41611 0 2.78629E-5
1-11276298-T-C c.3031-7A>G splice_region MTOR 1 83132 1.20291E-5 41566 0 8.34474E-6
1-11288721-T-C c.3030+4A>G splice_region MTOR 1 83222 1.20161E-5 41611 0 6.25E-4
1-11288729-C-T p.Arg1009Gln missense MTOR 1 83276 1.20083E-5 41638 0 3.18613E-5
1-11288740-A-AACATATAAAG p.Gly1006fs frameshift MTOR 1 83302 1.20045E-5 41651 0 NA
1-11288751-G-T p.Arg1002Arg synonymous MTOR 3 83308 3.60109E-5 41654 0 6.36902E-5
1-11288758-G-A p.Asn999Asn synonymous MTOR 54545 80052 0.68137 40026 19068 0.751232
1-11288767-C-T p.Thr996Thr synonymous MTOR 4 83278 4.80319E-5 41639 0 4.77555E-5
1-11288767-C-G p.Thr996Thr synonymous MTOR 2 83278 2.40159E-5 41639 0 6.25E-4
1-11288849-G-T p.Thr969Asn missense MTOR 1 83228 1.20152E-5 41614 0 1.59152E-5
1-11288880-A-G p.Phe959Leu missense MTOR 1 83306 1.20039E-5 41653 0 NA
1-11288884-C-G p.Arg957Arg synonymous MTOR 1 83310 1.20034E-5 41655 0 NA
1-11288892-G-A p.Leu955Leu synonymous MTOR 1 83318 1.20022E-5 41659 0 8.23737E-6
1-11288898-C-T p.Val953Met missense MTOR 3 83318 3.60066E-5 41659 0 1.59266E-4
1-11288950-C-T p.Leu935Leu synonymous MTOR 112 83232 0.00134564 41616 0 0.00352467
1-11288969-T-C p.Tyr929Cys missense MTOR 1 83172 1.20233E-5 41586 0 3.18593E-5
1-11288975-G-GAGGAATC c.2780-1_2780insGATTCCT splice_acceptor MTOR 2 83140 2.40558E-5 41570 1 NA
1-11288983-A-G c.2780-8T>C splice_region MTOR 2 83072 2.40755E-5 41536 0 8.28555E-6
1-11290979-T-C c.2779+3A>G splice_region MTOR 2 83166 2.40483E-5 41583 0 1.64745E-5
1-11290993-C-T p.Ser923Asn missense MTOR 1 83194 1.20201E-5 41597 0 NA
1-11290999-T-A p.Lys921Met missense MTOR 1 83170 1.20236E-5 41585 0 8.23669E-6
1-11290999-T-C p.Lys921Arg missense MTOR 2 83170 2.40471E-5 41585 0 NA
1-11291005-T-C p.Glu919Gly missense MTOR 5 83162 6.01236E-5 41581 0 3.97877E-6
1-11291014-C-T p.Ser916Asn missense MTOR 1 83168 1.20239E-5 41584 0 NA
1-11291031-C-T p.Arg910Arg synonymous MTOR 1 83172 1.20233E-5 41586 0 NA
1-11291052-A-G p.Ile903Ile synonymous MTOR 2 83226 2.4031E-5 41613 0 3.97795E-6
1-11291093-G-A p.Leu890Phe missense MTOR 1 83240 1.20135E-5 41620 0 NA
1-11291103-A-G p.Arg886Arg synonymous MTOR 1 83234 1.20143E-5 41617 0 NA
1-11291104-C-T p.Arg886His missense MTOR 1 83234 1.20143E-5 41617 0 2.38724E-5
1-11291106-G-A p.Ile885Ile synonymous MTOR 1 83218 1.20166E-5 41609 0 8.2375E-6
1-11291116-G-A c.2650-5C>T splice_region MTOR 2 83182 2.40437E-5 41591 0 3.58143E-5
1-11291119-G-A c.2650-8C>T splice_region MTOR 2 83180 2.40442E-5 41590 0 3.18552E-5
1-11291368-T-C p.Thr880Ala missense MTOR 1 83320 1.20019E-5 41660 0 8.23981E-6
1-11291376-T-C p.Asn877Ser missense MTOR 2 83316 2.4005E-5 41658 0 NA
1-11291384-A-G p.Thr874Thr synonymous MTOR 1 83298 1.20051E-5 41649 0 NA
1-11291395-A-T p.Phe871Ile missense MTOR 2 83284 2.40142E-5 41642 0 NA
1-11291413-G-C p.Leu865Val missense MTOR 3 83216 3.60508E-5 41608 0 NA
1-11291427-T-A p.Lys860Met missense MTOR 2 83168 2.40477E-5 41584 0 3.97915E-6
1-11291432-G-A p.Tyr858Tyr synonymous MTOR 1 83158 1.20253E-5 41579 0 NA
1-11291441-T-C p.Val855Val synonymous MTOR 1 83180 1.20221E-5 41590 0 3.18431E-5
1-11291450-G-C p.Gly852Gly synonymous MTOR 1 83150 1.20265E-5 41575 0 NA
1-11291483-CA-C p.Leu841fs frameshift MTOR 1 83118 1.20311E-5 41559 0 NA
1-11291495-G-T c.2515-4C>A splice_region MTOR 2 83088 2.40709E-5 41544 0 3.19129E-5
1-11292496-C-T p.Arg837Arg synonymous MTOR 2 83044 2.40836E-5 41522 0 3.29968E-5
1-11292500-T-C p.Lys836Arg missense MTOR 1 83042 1.20421E-5 41521 0 NA
1-11292520-C-T p.Gln829Gln synonymous MTOR 1 83080 1.20366E-5 41540 0 6.25E-4
1-11292535-G-A p.Ile824Ile synonymous MTOR 8 83146 9.62163E-5 41573 0 4.45775E-4
1-11292538-GATA-G p.Ile823del disruptive_inframe_deletion MTOR 2 83136 2.4057E-5 41568 0 NA
1-11292542-A-T p.Ile822Asn missense MTOR 1 83144 1.20273E-5 41572 0 3.97883E-6
1-11292555-C-A p.Asp818Tyr missense MTOR 2 83190 2.40414E-5 41595 0 3.97893E-6
1-11292566-C-T p.Arg814Lys missense MTOR 1 83222 1.20161E-5 41611 0 3.97909E-6
1-11292588-G-GTGCCAATTCTCCTATTGTTGCCAGGACATTATTGAT c.2422-4_2422-3insATCAATAATGTCCTGGCAACAATAGGAGAATTGGCA splice_region MTOR 2 83180 2.40442E-5 41590 0 NA
1-11293464-T-C p.Glu804Glu synonymous MTOR 95 83316 0.00114024 41658 0 0.00542063
1-11293465-T-C p.Glu804Gly missense MTOR 1 83312 1.20031E-5 41656 0 NA
1-11293472-T-C p.Ile802Val missense MTOR 1 83306 1.20039E-5 41653 0 1.19332E-5
1-11293485-A-G p.Asn797Asn synonymous MTOR 3 83302 3.60135E-5 41651 0 NA
1-11293491-G-A p.Ile795Ile synonymous MTOR 1 83304 1.20042E-5 41652 0 NA
1-11293500-TG-T p.Pro792fs frameshift MTOR 1 83296 1.20054E-5 41648 0 NA
1-11294212-C-T p.Glu773Glu synonymous MTOR 3 82914 3.61821E-5 41457 0 4.94381E-5
1-11294226-G-A p.Arg769Cys missense MTOR 1 82956 1.20546E-5 41478 0 1.64796E-5
1-11294230-G-A p.Leu767Leu synonymous MTOR 41 82968 4.94166E-4 41484 0 0.00151057
1-11294234-C-CG p.Arg766fs frameshift MTOR 1 82966 1.20531E-5 41483 0 NA
1-11294234-C-G p.Arg766Pro missense MTOR 1 82966 1.20531E-5 41483 0 NA
1-11294243-T-C p.Asn763Ser missense MTOR 1 82994 1.20491E-5 41497 0 8.24076E-6
1-11294246-G-A p.Ser762Phe missense MTOR 1 82994 1.20491E-5 41497 0 1.1938E-5
1-11294248-G-A p.Val761Val synonymous MTOR 2 82992 2.40987E-5 41496 0 6.25E-4
1-11294259-C-T p.Gly758Arg missense MTOR 1 83020 1.20453E-5 41510 0 3.98045E-6
1-11294266-G-A p.Arg755Arg synonymous MTOR 1 83054 1.20404E-5 41527 0 NA
1-11294267-C-T p.Arg755His missense MTOR 1 83056 1.20401E-5 41528 0 3.98251E-6
1-11294268-G-A p.Arg755Cys missense MTOR 2 83040 2.40848E-5 41520 0 3.18735E-5
1-11294299-A-G p.Ser744Ser synonymous MTOR 3 82990 3.61489E-5 41495 0 9.55353E-5
1-11294310-A-G p.Leu741Leu synonymous MTOR 2 82986 2.41005E-5 41493 0 8.38982E-6
1-11294325-G-GGATGAGCATCT c.2209-4_2209-3insAGATGCTCATC splice_region MTOR 1 82866 1.20677E-5 41433 0 NA
1-11294328-G-A c.2209-6C>T splice_region MTOR 2 82844 2.41418E-5 41422 0 NA
1-11297894-G-A c.2208+6C>T splice_region MTOR 2 70720 2.82805E-5 35360 0 4.85826E-5
1-11297951-A-G p.Ser719Ser synonymous MTOR 1 81442 1.22787E-5 40721 0 NA
1-11297958-C-T p.Arg717Gln missense MTOR 1 81676 1.22435E-5 40838 0 1.5975E-5
1-11297978-C-T p.Leu710Leu synonymous MTOR 1 82352 1.2143E-5 41176 0 2.79069E-5
1-11297980-G-C p.Leu710Val missense MTOR 1 82368 1.21406E-5 41184 0 1.59464E-5
1-11297990-C-G p.Glu706Asp missense MTOR 1 82630 1.21021E-5 41315 0 NA
1-11298005-A-G p.Asn701Asn synonymous MTOR 3 82794 3.62345E-5 41397 0 5.03525E-4
1-11298010-G-C p.Leu700Val missense MTOR 1 82840 1.20715E-5 41420 0 NA
1-11298025-C-T p.Ala695Thr missense MTOR 1 82852 1.20697E-5 41426 0 NA
1-11298035-C-T p.Glu691Glu synonymous MTOR 6 82806 7.24585E-5 41403 0 7.45576E-5
1-11298038-C-T p.Ala690Ala synonymous MTOR 57 82778 6.88589E-4 41389 0 7.70467E-4
1-11298046-C-T p.Ala688Thr missense MTOR 1 82750 1.20846E-5 41375 0 NA
1-11298049-G-A p.Leu687Leu synonymous MTOR 1 82754 1.2084E-5 41377 0 3.98051E-6
1-11298052-G-A p.His686Tyr missense MTOR 1 82712 1.20901E-5 41356 0 2.48538E-5
1-11298054-G-A p.Ala685Val missense MTOR 3 82672 3.6288E-5 41336 0 NA
1-11298057-T-C p.Asp684Gly missense MTOR 1 82652 1.20989E-5 41326 0 NA
1-11298063-C-T p.Arg682His missense MTOR 1 82450 1.21286E-5 41225 0 1.1948E-5
1-11298064-G-A p.Arg682Cys missense MTOR 3 82420 3.63989E-5 41210 0 1.65763E-5
1-11298067-C-T p.Glu681Lys missense MTOR 1 82326 1.21468E-5 41163 0 3.18532E-5
1-11298068-G-A p.Asp680Asp synonymous MTOR 4 82326 4.85873E-5 41163 0 6.37227E-5
1-11298073-G-A p.Leu679Leu synonymous MTOR 2 82246 2.43173E-5 41123 0 NA
1-11298077-C-A p.Ala677Ala synonymous MTOR 2 82114 2.43564E-5 41057 0 NA
1-11298077-C-T p.Ala677Ala synonymous MTOR 1 82114 1.21782E-5 41057 0 3.18512E-5
1-11298078-G-A p.Ala677Val missense MTOR 1 82040 1.21892E-5 41020 0 3.18431E-5
1-11298086-A-G p.Cys674Cys synonymous MTOR 3 81846 3.66542E-5 40923 0 7.57703E-5
1-11298460-A-G p.Pro667Pro splice_region+synonymous MTOR 1 82732 1.20872E-5 41366 0 NA
1-11298472-C-A p.Gly663Gly synonymous MTOR 1 82932 1.20581E-5 41466 0 NA
1-11298480-C-T p.Val661Ile missense MTOR 4 83104 4.81325E-5 41552 0 3.18532E-5
1-11298481-G-A p.Leu660Leu synonymous MTOR 2 83122 2.4061E-5 41561 0 8.23683E-6
1-11298507-C-G p.Val652Leu missense MTOR 1 83300 1.20048E-5 41650 0 3.9764E-6
1-11298517-T-A p.Ala648Ala synonymous MTOR 1 83308 1.20036E-5 41654 0 3.97633E-6
1-11298519-C-T p.Ala648Thr missense MTOR 2 83302 2.4009E-5 41651 0 6.25E-4
1-11298523-C-G p.Gln646His missense MTOR 1 83310 1.20034E-5 41655 0 NA
1-11298531-C-T p.Val644Ile missense MTOR 1 83290 1.20062E-5 41645 0 4.11828E-5
1-11298541-A-G p.His640His synonymous MTOR 1 83288 1.20065E-5 41644 0 NA
1-11298549-T-C p.Ser638Gly missense MTOR 1 83304 1.20042E-5 41652 0 NA
1-11298552-T-C p.Ile637Val missense MTOR 44 83294 5.28249E-4 41647 0 0.00125
1-11298558-G-A p.His635Tyr missense MTOR 2 83278 2.40159E-5 41639 0 NA
1-11298565-G-A p.Pro632Pro synonymous MTOR 2 83284 2.40142E-5 41642 0 9.55231E-5
1-11298574-C-T p.Leu629Leu synonymous MTOR 9 83262 1.08093E-4 41631 0 3.50408E-4
1-11298579-G-A p.Arg628Cys missense MTOR 2 83256 2.40223E-5 41628 0 1.59082E-5
1-11298583-G-A p.Cys626Cys synonymous MTOR 452 83250 0.00542943 41625 8 0.0106037
1-11298590-C-T p.Arg624His missense MTOR 2 83218 2.40333E-5 41609 0 3.18593E-5
1-11298591-G-A p.Arg624Cys missense MTOR 6 83216 7.21015E-5 41608 0 6.37064E-5
1-11298593-G-T p.Ala623Asp missense MTOR 1 83206 1.20184E-5 41603 0 NA
1-11298603-T-C p.Met620Val missense MTOR 1 83210 1.20178E-5 41605 0 NA
1-11298606-G-A p.Arg619Cys missense MTOR 8 83202 9.61515E-5 41601 0 6.25E-4
1-11298607-G-T p.Ile618Ile synonymous MTOR 15 83196 1.80297E-4 41598 0 0.00125
1-11298614-T-C p.Lys616Arg missense MTOR 2 83184 2.40431E-5 41592 0 5.03525E-4
1-11298631-G-A p.Phe610Phe synonymous MTOR 169 83148 0.00203252 41574 1 0.0025
1-11298640-C-T p.Ala607Ala synonymous MTOR 22 83090 2.64773E-4 41545 1 0.00100705
1-11298650-C-T p.Arg604His missense MTOR 1 82974 1.2052E-5 41487 0 NA
1-11298658-T-C p.Gln601Gln synonymous MTOR 2 82898 2.4126E-5 41449 0 2.78479E-5
1-11298661-G-A p.Thr600Thr synonymous MTOR 5 82834 6.03617E-5 41417 0 3.18613E-5
1-11298661-G-C p.Thr600Thr synonymous MTOR 1 82834 1.20723E-5 41417 0 NA
1-11298665-A-G p.Leu599Pro missense MTOR 4 82768 4.83279E-5 41384 0 1.94458E-5
1-11298670-G-A p.His597His synonymous MTOR 1 82676 1.20954E-5 41338 0 4.02337E-6
1-11298676-T-TTCAAATTCAAAGCTGCCAAGCGTTC c.1787-3_1787-2insGAACGCTTGGCAGCTTTGAATTTGA splice_region MTOR 5 82552 6.05679E-5 41276 1 NA
1-11298679-A-G c.1787-5T>C splice_region MTOR 4 82430 4.8526E-5 41215 0 4.59116E-5
1-11298681-A-T c.1787-7T>A splice_region MTOR 2 82354 2.42854E-5 41177 0 4.83688E-5
1-11300357-T-C c.1786+3A>G splice_region MTOR 1 82978 1.20514E-5 41489 0 3.58918E-5
1-11300368-T-A p.Glu593Val missense MTOR 1 82928 1.20587E-5 41464 0 NA
1-11300382-C-T p.Thr588Thr synonymous MTOR 1 82980 1.20511E-5 41490 0 1.33491E-5
1-11300386-C-T p.Arg587Gln missense MTOR 1 82994 1.20491E-5 41497 0 1.73921E-5
1-11300414-C-T p.Asp578Asn missense MTOR 2 83330 2.4001E-5 41665 0 8.32584E-6
1-11300415-G-A p.Ser577Ser synonymous MTOR 1 83320 1.20019E-5 41660 0 8.4225E-5
1-11300419-G-C p.Ala576Gly missense MTOR 1 83332 1.20002E-5 41666 0 8.29449E-6
1-11300427-G-A p.Leu573Leu synonymous MTOR 1 83336 1.19996E-5 41668 0 NA
1-11300444-G-C p.Pro568Ala missense MTOR 1 83370 1.19947E-5 41685 0 3.9789E-6
1-11300493-G-C p.Pro551Pro synonymous MTOR 10 83392 1.19916E-4 41696 0 1.59256E-4
1-11300499-G-A p.His549His synonymous MTOR 2 83398 2.39814E-5 41699 0 NA
1-11300517-C-T p.Leu543Leu synonymous MTOR 55 83400 6.59472E-4 41700 0 0.00184702
1-11300519-G-A p.Leu543Leu synonymous MTOR 1 83402 1.19901E-5 41701 0 NA
1-11300532-C-G p.Gly538Gly synonymous MTOR 8 83398 9.59256E-5 41699 0 2.47109E-4
1-11300540-G-A p.Gln536* stop_gained MTOR 1 83400 1.19904E-5 41700 0 NA
1-11300546-C-T p.Asp534Asn missense MTOR 2 83380 2.39866E-5 41690 0 6.37186E-5
1-11300566-T-C p.Gln527Arg missense MTOR 1 83334 1.19999E-5 41667 0 NA
1-11300569-C-T p.Arg526His missense MTOR 2 83328 2.40015E-5 41664 0 3.18593E-5
1-11300570-G-A p.Arg526Cys missense MTOR 1 83312 1.20031E-5 41656 0 3.18552E-5
1-11300574-C-T p.Leu524Leu synonymous MTOR 1 83300 1.20048E-5 41650 0 NA
1-11300580-G-A p.Tyr522Tyr synonymous MTOR 15 83276 1.80124E-4 41638 0 2.39555E-4
1-11300586-C-T p.Val520Val synonymous MTOR 1 83262 1.20103E-5 41631 0 1.65396E-5
1-11300589-T-G p.Ala519Ala synonymous MTOR 1 83230 1.20149E-5 41615 0 3.18512E-5
1-11300589-T-C p.Ala519Ala synonymous MTOR 1 83230 1.20149E-5 41615 0 NA
1-11300591-C-T p.Ala519Thr missense MTOR 7 83208 8.41265E-5 41604 0 6.37064E-5
1-11300600-C-A p.Ala516Ser missense MTOR 1 83144 1.20273E-5 41572 0 NA
1-11300609-G-C c.1542-5C>G splice_region MTOR 2 83048 2.40825E-5 41524 0 3.99949E-6
1-11300609-G-A c.1542-5C>T splice_region MTOR 1 83048 1.20412E-5 41524 0 3.99949E-6
1-11300610-G-A c.1542-6C>T splice_region MTOR 1 83022 1.2045E-5 41511 0 2.40098E-5
1-11301626-G-T p.Leu509Met missense MTOR 1 81956 1.22017E-5 40978 0 3.98734E-6
1-11301650-T-C p.Ile501Val missense MTOR 2 82088 2.43641E-5 41044 0 NA
1-11301651-A-G p.Asp500Asp synonymous MTOR 4 82100 4.87211E-5 41050 1 5.03525E-4
1-11301655-T-A p.Gln499Leu missense MTOR 1 82096 1.21809E-5 41048 0 NA
1-11301682-G-C p.Ala490Gly missense MTOR 1 82234 1.21604E-5 41117 0 NA
1-11301713-C-A p.Ala480Ser missense MTOR 1 82332 1.21459E-5 41166 0 NA
1-11301714-A-G p.Asp479Asp synonymous MTOR 54801 81754 0.670316 40877 19212 0.733125
1-11301725-T-C p.Met476Val missense MTOR 5 82358 6.07106E-5 41179 0 5.57631E-5
1-11301733-T-G p.Gln473Pro missense MTOR 2 82314 2.42972E-5 41157 0 NA
1-11301736-C-CTCTTATGGGCGAAG p.Arg472fs frameshift MTOR 2 82310 2.42984E-5 41155 0 NA
1-11301738-C-CTTATGGG c.1413-1_1413insCCCATAA splice_acceptor MTOR 3 82314 3.64458E-5 41157 1 NA
1-11301738-C-CTTATGGGCGAAGTCCTTTGGGGGCAGGGCCGCTCGGATGATGTCCAG c.1413-1_1413insCTGGACATCATCCGAGCGGCCCTGCCCCCAAAGGACTTCGCCCATAA splice_acceptor MTOR 2 82314 2.42972E-5 41157 1 NA
1-11303163-G-A c.1412+8C>T splice_region MTOR 2 83152 2.40523E-5 41576 0 8.24606E-6
1-11303173-A-G p.His470His splice_region+synonymous MTOR 1 83280 1.20077E-5 41640 0 NA
1-11303178-C-T p.Ala469Thr missense MTOR 2 83290 2.40125E-5 41645 0 1.64834E-5
1-11303181-A-T p.Phe468Ile missense MTOR 3 83322 3.60049E-5 41661 0 3.18451E-5
1-11303188-T-C p.Pro465Pro synonymous MTOR 1 83344 1.19985E-5 41672 0 8.23981E-6
1-11303190-G-C p.Pro465Ala missense MTOR 3 83350 3.59928E-5 41675 0 6.36983E-5
1-11303195-A-G p.Leu463Pro missense MTOR 1 83350 1.19976E-5 41675 0 NA
1-11303200-C-T p.Ala461Ala synonymous MTOR 1 83354 1.1997E-5 41677 0 2.47145E-5
1-11303201-G-A p.Ala461Val missense MTOR 4 83358 4.79858E-5 41679 0 3.18654E-5
1-11303204-C-T p.Arg460Gln missense MTOR 2 83378 2.39871E-5 41689 0 3.97652E-6
1-11303205-G-C p.Arg460Gly missense MTOR 1 83382 1.1993E-5 41691 0 NA
1-11303221-G-A p.Arg454Arg synonymous MTOR 2 83386 2.39848E-5 41693 0 7.95267E-6
1-11303222-C-T p.Arg454His missense MTOR 1 83378 1.19936E-5 41689 0 8.23737E-6
1-11303226-G-A p.Pro453Ser missense MTOR 1 83386 1.19924E-5 41693 0 8.2371E-6
1-11303231-T-A p.Tyr451Phe missense MTOR 2 83390 2.39837E-5 41695 0 NA
1-11303235-C-T p.Val450Ile missense MTOR 5 83396 5.99549E-5 41698 0 3.29473E-5
1-11303244-C-T p.Glu447Lys missense MTOR 1 83392 1.19916E-5 41696 0 3.9763E-6
1-11303248-C-T p.Arg445Arg synonymous MTOR 1 83392 1.19916E-5 41696 0 3.18593E-5
1-11303251-C-T p.Val444Val synonymous MTOR 3 83398 3.59721E-5 41699 0 9.54312E-5
1-11303288-G-A p.Ala432Val missense MTOR 1 83400 1.19904E-5 41700 0 6.58935E-5
1-11303289-C-T p.Ala432Thr missense MTOR 1 83402 1.19901E-5 41701 0 3.29468E-5
1-11303299-C-T p.Lys428Lys synonymous MTOR 2 83404 2.39797E-5 41702 0 NA
1-11303302-C-T p.Glu427Glu synonymous MTOR 1 83406 1.19895E-5 41703 0 NA
1-11303305-C-T p.Lys426Lys synonymous MTOR 10 83406 1.19895E-4 41703 0 6.59011E-5
1-11303318-C-T p.Ser422Asn missense MTOR 1 83392 1.19916E-5 41696 0 NA
1-11303326-A-G p.His419His synonymous MTOR 4 83376 4.79754E-5 41688 0 9.54988E-5
1-11303334-T-C p.Met417Val missense MTOR 1 83362 1.19959E-5 41681 0 8.24321E-6
1-11303351-T-C p.Gln411Arg missense MTOR 2 83310 2.40067E-5 41655 0 NA
1-11303360-G-GTGAAGGCAGAAGGTCGGAATGC c.1226-4_1226-3insGCATTCCGACCTTCTGCCTTCA splice_region MTOR 1 83276 1.20083E-5 41638 0 NA
1-11303361-A-G c.1226-4T>C splice_region MTOR 1 83260 1.20106E-5 41630 0 2.48139E-5
1-11307709-C-T p.Ala400Thr missense MTOR 1 83404 1.19898E-5 41702 0 3.97633E-6
1-11307731-G-A p.Ile392Ile synonymous MTOR 1 83430 1.19861E-5 41715 0 1.64731E-5
1-11307733-T-C p.Ile392Val missense MTOR 1 83428 1.19864E-5 41714 0 4.11828E-5
1-11307739-T-C p.Met390Val missense MTOR 2 83430 2.39722E-5 41715 0 NA
1-11307750-G-C p.Ser386Trp missense MTOR 1 83422 1.19872E-5 41711 0 NA
1-11307756-T-C p.Lys384Arg missense MTOR 1 83420 1.19875E-5 41710 0 NA
1-11307759-C-T p.Ser383Asn missense MTOR 5 83422 5.99362E-5 41711 0 1.19286E-5
1-11307762-T-C p.Asn382Ser missense MTOR 39 83422 4.67503E-4 41711 0 3.18532E-4
1-11307788-CACCTGAGAGAGGAAGGATAAAGGGTTGGCAGGGGAAAAGTGAGGTGTGGAGCTTAGGAAAAGAGGGAAAGGGCCTCTCACCACTT-C p.Cys374fs frameshift MTOR 9 83410 1.07901E-4 41705 2 NA
1-11307795-G-A c.1117-5C>T splice_region MTOR 1 83394 1.19913E-5 41697 0 NA
1-11307880-T-A p.Asp371Val missense MTOR 1 83394 1.19913E-5 41697 0 NA
1-11307884-A-G p.Phe370Leu missense MTOR 2 83390 2.39837E-5 41695 0 NA
1-11307896-T-C p.Met366Val missense MTOR 1 83388 1.19921E-5 41694 0 NA
1-11307899-A-C p.Leu365Val missense MTOR 2 83386 2.39848E-5 41693 0 NA
1-11307911-A-T p.Cys361Ser missense MTOR 3 83378 3.59807E-5 41689 0 3.18776E-5
1-11307913-C-T p.Arg360Gln missense MTOR 2 83378 2.39871E-5 41689 0 3.97896E-6
1-11307927-G-A p.Thr355Thr synonymous MTOR 1 83386 1.19924E-5 41693 0 8.2447E-6
1-11307941-G-A p.Pro351Ser missense MTOR 7 83376 8.3957E-5 41688 0 0.00125
1-11307945-G-C p.Pro349Pro synonymous MTOR 5 83378 5.99679E-5 41689 0 8.24266E-6
1-11307947-G-T p.Pro349Thr missense MTOR 1 83384 1.19927E-5 41692 0 NA
1-11307956-C-A p.Gly346Trp missense MTOR 1 83380 1.19933E-5 41690 0 NA
1-11307960-T-C p.Gly344Gly synonymous MTOR 4 83376 4.79754E-5 41688 0 8.24185E-6
1-11307963-C-T p.Met343Ile missense MTOR 1 83386 1.19924E-5 41693 0 3.97674E-6
1-11307979-G-C p.Ser338Cys missense MTOR 1 83360 1.19962E-5 41680 0 3.18776E-5
1-11308007-C-T p.Ala329Thr missense MTOR 339 83334 0.00406797 41667 1 0.0115811
1-11308022-G-A p.Pro324Ser missense MTOR 1 83306 1.20039E-5 41653 0 NA
1-11308031-C-T p.Ala321Thr missense MTOR 2 83264 2.402E-5 41632 0 NA
1-11308062-A-G p.Pro310Pro synonymous MTOR 1 83182 1.20218E-5 41591 0 NA
1-11308074-G-A p.Phe306Phe synonymous MTOR 449 83166 0.00539884 41583 8 0.0104877
1-11308078-C-T p.Gly305Asp missense MTOR 1 83170 1.20236E-5 41585 0 NA
1-11308088-C-T p.Asp302Asn missense MTOR 1 83198 1.20195E-5 41599 0 8.29807E-6
1-11308094-A-G p.Cys300Arg missense MTOR 1 83188 1.2021E-5 41594 0 NA
1-11308099-T-C p.Lys298Arg missense MTOR 1 83192 1.20204E-5 41596 0 NA
1-11308103-C-T p.Asp297Asn missense MTOR 15 83194 1.80301E-4 41597 0 9.16911E-5
1-11308105-T-G p.His296Pro missense MTOR 1 83216 1.20169E-5 41608 0 3.18471E-5
1-11308117-T-C p.Gln292Arg missense MTOR 1 83238 1.20137E-5 41619 0 3.99584E-6
1-11308124-T-A p.Thr290Ser missense MTOR 8 83258 9.60869E-5 41629 0 2.00402E-5
1-11308140-T-C p.Glu284Glu synonymous MTOR 1 83288 1.20065E-5 41644 0 6.25E-4
1-11308150-C-T p.Arg281His missense+splice_region MTOR 12 83288 1.44078E-4 41644 0 7.37203E-5
1-11308157-T-C c.841-6A>G splice_region MTOR 2 83264 2.402E-5 41632 0 3.1841E-5
1-11308159-T-C c.841-8A>G splice_region MTOR 1 83250 1.2012E-5 41625 0 NA
1-11313905-C-A p.Met277Ile missense MTOR 3 83288 3.60196E-5 41644 0 2.82347E-4
1-11313929-G-A p.Asn269Asn synonymous MTOR 3 83364 3.59868E-5 41682 0 7.55515E-5
1-11313975-C-A p.Gly254Val missense MTOR 3 83400 3.59712E-5 41700 0 3.97627E-6
1-11313993-G-A p.Thr248Ile missense MTOR 2 83396 2.3982E-5 41698 0 5.03525E-4
1-11313993-G-T p.Thr248Asn missense MTOR 3 83396 3.59729E-5 41698 0 NA
1-11314014-G-A p.Ala241Val missense MTOR 1 83382 1.1993E-5 41691 0 NA
1-11314036-TAG-T c.706-8_706-7delCT splice_region MTOR 1 83322 1.20016E-5 41661 0 NA
1-11316079-C-T p.Pro225Pro synonymous MTOR 5 83172 6.01164E-5 41586 0 2.49087E-5
1-11316091-G-C p.Thr221Thr synonymous MTOR 138 83238 0.0016579 41619 0 0.00252781
1-11316092-G-A p.Thr221Ile missense MTOR 1 83248 1.20123E-5 41624 0 8.28075E-6
1-11316097-G-A p.Leu219Leu synonymous MTOR 2 83250 2.4024E-5 41625 0 6.36943E-5
1-11316112-A-T p.Arg214Arg synonymous MTOR 4 83250 4.8048E-5 41625 0 8.27623E-6
1-11316113-C-T p.Arg214His missense MTOR 1 83244 1.20129E-5 41622 0 7.95659E-6
1-11316121-G-A p.Ala211Ala synonymous MTOR 7 83250 8.40841E-5 41625 0 6.37146E-5
1-11316148-T-C p.Lys202Lys synonymous MTOR 1 83268 1.20094E-5 41634 0 7.95716E-6
1-11316153-G-A p.Pro201Ser missense MTOR 1 83268 1.20094E-5 41634 0 NA
1-11316163-G-A p.Ala197Ala synonymous MTOR 3 83272 3.60265E-5 41636 0 3.58072E-5
1-11316187-G-A p.Pro189Pro synonymous MTOR 1 83276 1.20083E-5 41638 0 NA
1-11316189-G-C p.Pro189Ala missense MTOR 2 83276 2.40165E-5 41638 1 NA
1-11316190-T-C p.Gln188Gln synonymous MTOR 1 83272 1.20088E-5 41636 0 1.66937E-5
1-11316202-G-A p.Phe184Phe synonymous MTOR 4 83268 4.80377E-5 41634 0 NA
1-11316244-C-G p.Leu170Leu synonymous MTOR 302 83034 0.00363706 41517 3 0.00420623
1-11316249-C-CAGCTGCATGTCTCCGGCCCTCATTGCGGTCAGCA c.505-1_505insTGCTGACCGCAATGAGGGCCGGAGACATGCAGCT splice_acceptor MTOR 1 82960 1.2054E-5 41480 0 NA
1-11316249-C-CAGCTGCATGTCTCCGGCCCTCATTGCGGTCAG c.505-1_505insCTGACCGCAATGAGGGCCGGAGACATGCAGCT splice_acceptor MTOR 1 82960 1.2054E-5 41480 0 NA
1-11316255-G-GAAA c.505-7_505-6insTTT splice_region MTOR 2 82888 2.41289E-5 41444 0 3.19142E-5
1-11316257-A-T c.505-8T>A splice_region MTOR 13 82844 1.56921E-4 41422 0 1.59185E-4
1-11316997-T-A p.His166Leu missense MTOR 1 82946 1.2056E-5 41473 0 NA
1-11317000-C-T p.Arg165Lys missense MTOR 2 82974 2.41039E-5 41487 0 6.37146E-5
1-11317012-T-C p.Asn161Ser missense MTOR 17 83102 2.04568E-4 41551 0 2.23044E-4
1-11317014-G-T p.Arg160Arg synonymous MTOR 3 83108 3.60976E-5 41554 0 1.27453E-4
1-11317015-C-T p.Arg160His missense MTOR 1 83102 1.20334E-5 41551 0 8.66686E-6
1-11317016-G-A p.Arg160Cys missense MTOR 1 83116 1.20314E-5 41558 0 NA
1-11317049-C-T p.Val149Met missense MTOR 1 83262 1.20103E-5 41631 0 1.99046E-5
1-11317062-G-A p.Tyr144Tyr synonymous MTOR 1 83274 1.20085E-5 41637 0 3.18959E-5
1-11317071-G-A p.Thr141Thr synonymous MTOR 59 83290 7.08368E-4 41645 0 0.00181644
1-11317079-T-C p.Thr139Ala missense MTOR 1 83294 1.20057E-5 41647 0 NA
1-11317099-C-T p.Arg132His missense MTOR 6 83326 7.20063E-5 41663 0 3.33845E-5
1-11317100-G-A p.Arg132Cys missense MTOR 1 83328 1.20008E-5 41664 0 8.34516E-6
1-11317127-T-C p.Met123Val missense MTOR 1 83342 1.19988E-5 41671 0 NA
1-11317146-G-A p.Pro116Pro synonymous MTOR 5 83322 6.00082E-5 41661 0 5.03525E-4
1-11317148-G-A p.Pro116Ser missense MTOR 3 83322 3.60049E-5 41661 0 NA
1-11317154-G-C p.Leu114Val missense MTOR 1 83308 1.20036E-5 41654 0 7.95995E-6
1-11317160-G-A p.Arg112Trp missense MTOR 2 83288 2.40131E-5 41644 1 NA
1-11317185-T-A p.Arg103Arg synonymous MTOR 1 83232 1.20146E-5 41616 0 NA
1-11317195-T-C p.Asn100Ser missense MTOR 1 83168 1.20239E-5 41584 0 NA
1-11317205-C-T p.Glu97Lys missense MTOR 1 83132 1.20291E-5 41566 0 NA
1-11317223-C-CTA c.272-2_272-1insTA splice_acceptor MTOR 1 83014 1.20462E-5 41507 0 NA
1-11317224-T-TATGGCCAAGATGCCACCTTTCCTCTCATTGGCATCTGAGCTG c.272-3_272-2insCAGCTCAGATGCCAATGAGAGGAAAGGTGGCATCTTGGCCAT splice_region MTOR 1 83000 1.20482E-5 41500 0 NA
1-11317224-T-TATGGCCAAGATGCCACCTTTCCTCTCATTG c.272-3_272-2insCAATGAGAGGAAAGGTGGCATCTTGGCCAT splice_region MTOR 1 83000 1.20482E-5 41500 0 NA
1-11317226-CAA-C c.272-6_272-5delTT splice_region MTOR 2 82960 2.4108E-5 41480 0 3.20082E-5
1-11318558-A-G p.Gly85Gly synonymous MTOR 1 83174 1.2023E-5 41587 0 8.25219E-6
1-11318652-T-TCTCGGAGTTCCATGGTGACATAGTGCTGGAGCTCCTTGGCG c.163-3_163-2insCGCCAAGGAGCTCCAGCACTATGTCACCATGGAACTCCGAG splice_region MTOR 4 83164 4.80977E-5 41582 1 NA
1-11318652-T-TCTCGGAGTTCCATGGTGACATAGTGCTGGAGCTCCTTG c.163-3_163-2insCAAGGAGCTCCAGCACTATGTCACCATGGAACTCCGAG splice_region MTOR 6 83164 7.21466E-5 41582 3 NA