Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
17-73521908-T-TCTCCAGTGGGGGCTGCAGACTAAGCAAAATGAGGCG c.-31+2_-31+3insCTCCAGTGGGGGCTGCAGACTAAGCAAAATGAGGCG splice_region LLGL2 4 5224 7.65697E-4 2612 2 NA
17-73534718-G-GTCTCCAGTGGGGGCTGCAGAC c.-31+1_-31+2insTCTCCAGTGGGGGCTGCAGAC splice_donor LLGL2 1 22 0.0454545 11 0 NA
17-73538801-A-T c.-383A>T 5_prime_UTR_premature_start_codon_gain LLGL2 18 26 0.692308 13 7 0.827306
17-73539296-C-T c.-31+7C>T splice_region LLGL2 299 53520 0.0055867 26760 0 0.00407721
17-73539296-C-A c.-31+7C>A splice_region LLGL2 1 53544 1.86762E-5 26772 0 NA
17-73539297-G-A c.-31+8G>A splice_region LLGL2 243 53780 0.00451841 26890 0 0.00729392
17-73539363-C-T c.-145C>T 5_prime_UTR_premature_start_codon_gain LLGL2 4 69776 5.73263E-5 34888 0 3.18857E-5
17-73539367-G-C c.-141G>C 5_prime_UTR_premature_start_codon_gain LLGL2 54 70670 7.64115E-4 35335 0 0.00207218
17-73539378-C-A c.-130C>A 5_prime_UTR_premature_start_codon_gain LLGL2 4 73236 5.46179E-5 36618 0 1.91253E-4
17-73539413-T-G c.-95T>G 5_prime_UTR_premature_start_codon_gain LLGL2 2 78536 2.5466E-5 39268 0 6.37471E-5
17-73539418-C-T c.-90C>T 5_prime_UTR_premature_start_codon_gain LLGL2 5 79426 6.29517E-5 39713 0 6.37511E-5
17-73539428-C-T c.-80C>T 5_prime_UTR_premature_start_codon_gain LLGL2 1 80634 1.24017E-5 40317 0 NA
17-73539492-C-T c.-16C>T 5_prime_UTR_premature_start_codon_gain LLGL2 23 82702 2.78107E-4 41351 0 9.23685E-4
17-73539525-G-A p.Arg6Arg synonymous LLGL2 3 82922 3.61786E-5 41461 0 1.21193E-5
17-73539525-G-T p.Arg6Ser missense LLGL2 1 82922 1.20595E-5 41461 0 4.03975E-6
17-73539559-C-T p.Arg18Trp missense LLGL2 2 83020 2.40906E-5 41510 0 7.22404E-5
17-73539560-G-A p.Arg18Gln missense LLGL2 24 83038 2.89024E-4 41519 0 3.18512E-4
17-73539562-G-A p.Asp19Asn missense LLGL2 1 83040 1.20424E-5 41520 0 4.01323E-6
17-73539570-C-T p.Phe21Phe synonymous LLGL2 4 82986 4.82009E-5 41493 0 3.18634E-5
17-73539579-C-T p.Asn24Asn synonymous LLGL2 2 82922 2.41191E-5 41461 0 NA
17-73539581-A-AGAC p.Gln22delinsHisGlu disruptive_inframe_insertion LLGL2 2 82910 2.41225E-5 41455 1 NA
17-73539582-G-C p.Lys25Asn missense+splice_region LLGL2 11 82894 1.327E-4 41447 0 1.6744E-5
17-73539582-G-GACGGTGGAGCATGGCTTCCCGCACCAGCCCAGCGCCCTCGGCTACAGCCC c.75_75+1insACGGTGGAGCATGGCTTCCCGCACCAGCCCAGCGCCCTCGGCTACAGCCC splice_donor LLGL2 1 82896 1.20633E-5 41448 0 NA
17-73542235-G-A c.-92G>A 5_prime_UTR_premature_start_codon_gain LLGL2 1 972 0.00102881 486 0 3.18593E-5
17-73552120-G-A c.76-7G>A splice_region LLGL2 5 82274 6.07725E-5 41137 0 2.23143E-4
17-73552120-G-T c.76-7G>T splice_region LLGL2 1 82274 1.21545E-5 41137 0 2.26803E-4
17-73552128-C-T p.Thr26Met missense+splice_region LLGL2 62 82390 7.52519E-4 41195 0 0.00375
17-73552129-G-A p.Thr26Thr splice_region+synonymous LLGL2 10 82454 1.2128E-4 41227 0 6.25E-4
17-73552146-C-T p.Pro32Leu missense LLGL2 1 82804 1.20767E-5 41402 0 3.18817E-5
17-73552147-G-T p.Pro32Pro synonymous LLGL2 1 82768 1.2082E-5 41384 0 8.35757E-6
17-73552149-A-C p.His33Pro missense LLGL2 1 82784 1.20796E-5 41392 0 NA
17-73552150-C-A p.His33Gln missense LLGL2 3 82820 3.62231E-5 41410 0 4.04236E-6
17-73552150-C-T p.His33His synonymous LLGL2 1 82820 1.20744E-5 41410 0 NA
17-73552151-C-T p.Gln34* stop_gained LLGL2 2 82838 2.41435E-5 41419 0 NA
17-73552159-C-A p.Ser36Arg missense LLGL2 1 82858 1.20688E-5 41429 0 NA
17-73552165-C-T p.Leu38Leu synonymous LLGL2 1 82926 1.20589E-5 41463 0 1.66945E-5
17-73552166-G-A p.Gly39Ser missense LLGL2 1 82924 1.20592E-5 41462 0 NA
17-73552168-C-T p.Gly39Gly splice_region+synonymous LLGL2 1 82958 1.20543E-5 41479 0 2.01658E-5
17-73552172-A-G p.Ser41Gly missense LLGL2 1 82942 1.20566E-5 41471 0 8.06341E-6
17-73552176-C-T p.Pro42Leu missense LLGL2 26 82976 3.13344E-4 41488 0 0.001875
17-73552177-G-A p.Pro42Pro synonymous LLGL2 19 82962 2.29021E-4 41481 0 5.03525E-4
17-73552180-C-T p.Ser43Ser synonymous LLGL2 1 83000 1.20482E-5 41500 0 8.33181E-6
17-73552181-C-T p.Leu44Leu synonymous LLGL2 1 83004 1.20476E-5 41502 0 8.33069E-6
17-73552184-C-T p.Arg45Cys missense LLGL2 2 82982 2.41016E-5 41491 0 9.55962E-5
17-73552185-G-A p.Arg45His missense LLGL2 40963 82560 0.49616 41280 10854 0.609375
17-73552185-G-T p.Arg45Leu missense LLGL2 1 82984 1.20505E-5 41492 0 NA
17-73552196-A-T p.Ile49Phe missense LLGL2 1 83028 1.20441E-5 41514 0 8.3051E-6
17-73552198-C-T p.Ile49Ile synonymous LLGL2 5 83022 6.0225E-5 41511 0 1.66113E-5
17-73552199-G-A p.Gly50Ser missense LLGL2 2 83004 2.40952E-5 41502 0 5.03525E-4
17-73552203-C-T p.Thr51Ile missense LLGL2 1 83022 1.2045E-5 41511 0 NA
17-73552204-C-T p.Thr51Thr synonymous LLGL2 3 83050 3.61228E-5 41525 0 2.5481E-4
17-73552210-T-A p.Ser53Ser synonymous LLGL2 1 83022 1.2045E-5 41511 0 NA
17-73552215-C-T p.Ala55Val missense LLGL2 1 82984 1.20505E-5 41492 0 NA
17-73552224-T-TCTACGGAGCCCCAGGC c.173_173+1insCTACGGAGCCCCAGGC splice_donor LLGL2 2 82946 2.41121E-5 41473 1 NA
17-73552230-C-G c.173+6C>G splice_region LLGL2 1 82880 1.20656E-5 41440 0 NA
17-73554228-A-C c.174-8A>C splice_region LLGL2 6 81566 7.35601E-5 40783 0 NA
17-73554228-A-T c.174-8A>T splice_region LLGL2 1 81566 1.226E-5 40783 0 NA
17-73554228-A-G c.174-8A>G splice_region LLGL2 2 81566 2.452E-5 40783 0 NA
17-73554239-C-T p.Tyr59Tyr synonymous LLGL2 1 81714 1.22378E-5 40857 0 5.03525E-4
17-73554240-G-A p.Gly60Arg missense LLGL2 1 81662 1.22456E-5 40831 0 1.19445E-5
17-73554244-C-T p.Ala61Val missense LLGL2 2 81702 2.44792E-5 40851 0 8.25682E-6
17-73554248-A-G p.Pro62Pro synonymous LLGL2 1 81742 1.22336E-5 40871 0 NA
17-73554250-G-A p.Gly63Asp missense LLGL2 1 81768 1.22297E-5 40884 0 7.96204E-6
17-73554251-C-T p.Gly63Gly synonymous LLGL2 24 81742 2.93607E-4 40871 0 5.03641E-4
17-73554252-G-A p.Val64Met missense LLGL2 1 81788 1.22267E-5 40894 0 1.65128E-5
17-73554274-A-G p.Gln71Arg missense LLGL2 3 81800 3.66748E-5 40900 0 NA
17-73554278-G-A p.Glu72Glu synonymous LLGL2 1 81846 1.22181E-5 40923 0 3.98406E-6
17-73554284-C-T p.Asn74Asn synonymous LLGL2 703 81766 0.00859771 40883 5 0.0149687
17-73554286-C-T p.Ala75Val missense LLGL2 4 81778 4.89129E-5 40889 0 7.97378E-6
17-73554292-C-T p.Thr77Met missense LLGL2 152 81676 0.00186101 40838 2 0.0030624
17-73554293-G-A p.Thr77Thr synonymous LLGL2 8 81662 9.79648E-5 40831 0 9.56938E-5
17-73554300-C-T p.His80Tyr missense LLGL2 1 81654 1.22468E-5 40827 0 NA
17-73554308-G-T p.Leu82Leu synonymous LLGL2 9 81524 1.10397E-4 40762 0 8.80549E-5
17-73554308-G-A p.Leu82Leu synonymous LLGL2 9 81522 1.104E-4 40761 0 3.31691E-5
17-73554309-C-T p.Pro83Ser missense LLGL2 1 81500 1.22699E-5 40750 0 NA
17-73554311-C-T p.Pro83Pro synonymous LLGL2 28 81464 3.4371E-4 40732 0 2.32243E-4
17-73554312-G-C p.Gly84Arg missense LLGL2 1 81462 1.22757E-5 40731 0 2.49008E-5
17-73554312-G-A p.Gly84Ser missense LLGL2 6 81462 7.3654E-5 40731 0 2.23385E-4
17-73554313-G-T p.Gly84Val missense LLGL2 6 81422 7.36902E-5 40711 0 1.66022E-5
17-73554315-C-T p.Gln85* stop_gained LLGL2 1 81418 1.22823E-5 40709 0 NA
17-73554317-G-GTGCCAGCTGGTCACCCTGCTGGATGACAACAGCCTGCACCTTT c.255_255+1insTGCCAGCTGGTCACCCTGCTGGATGACAACAGCCTGCACCTTT splice_donor LLGL2 1 81410 1.22835E-5 40705 0 NA
17-73554318-G-T c.255+1G>T splice_donor LLGL2 1 81374 1.22889E-5 40687 0 4.00933E-6
17-73554325-A-G c.255+8A>G splice_region LLGL2 2 81264 2.46111E-5 40632 0 NA
17-73554585-C-T c.256-8C>T splice_region LLGL2 1 82006 1.21942E-5 41003 0 NA
17-73554588-G-A c.256-5G>A splice_region LLGL2 58 82020 7.07145E-4 41010 0 0.00140485
17-73554589-C-T c.256-4C>T splice_region LLGL2 3 82060 3.65586E-5 41030 0 4.05703E-4
17-73554598-G-A p.Gln87Gln synonymous LLGL2 1 82144 1.21737E-5 41072 0 NA
17-73554606-C-T p.Thr90Ile missense LLGL2 6 82242 7.29554E-5 41121 0 6.25E-4
17-73554611-C-G p.Leu92Val missense LLGL2 3 82298 3.64529E-5 41149 0 1.75871E-5
17-73554643-G-A p.Leu102Leu synonymous LLGL2 2 82424 2.42648E-5 41212 0 NA
17-73554648-T-C p.Val104Ala missense LLGL2 5 82382 6.06929E-5 41191 0 5.722E-5
17-73554653-G-A p.Gly106Ser missense LLGL2 1 82362 1.21415E-5 41181 0 NA
17-73554656-G-A p.Gly107Arg missense LLGL2 5 82346 6.07194E-5 41173 0 5.05561E-4
17-73554663-C-T p.Ser109Leu missense LLGL2 1 82252 1.21578E-5 41126 0 3.19305E-5
17-73554664-G-A p.Ser109Ser synonymous LLGL2 9 82246 1.09428E-4 41123 0 1.86593E-4
17-73554666-A-G p.Glu110Gly missense LLGL2 1 82266 1.21557E-5 41133 0 3.19509E-5
17-73554669-T-A p.Leu111Gln missense LLGL2 1 82250 1.21581E-5 41125 0 NA
17-73554688-C-G p.Phe117Leu missense LLGL2 1 81946 1.22032E-5 40973 0 NA
17-73554688-C-T p.Phe117Phe synonymous LLGL2 4 81946 4.88126E-5 40973 0 3.19346E-5
17-73554696-G-A p.Arg120His missense LLGL2 1 81760 1.22309E-5 40880 0 1.71347E-5
17-73554701-C-T p.Pro122Ser missense LLGL2 10 81678 1.22432E-4 40839 0 5.95415E-4
17-73554703-C-T p.Pro122Pro synonymous LLGL2 1 81660 1.22459E-5 40830 0 NA
17-73554704-C-T p.Pro123Ser missense LLGL2 1 81616 1.22525E-5 40808 0 4.42705E-6
17-73554714-G-C c.371+6G>C splice_region LLGL2 7 81224 8.61814E-5 40612 0 1.9162E-4
17-73555330-C-G c.372-3C>G splice_region LLGL2 1 82258 1.21569E-5 41129 0 NA
17-73555352-C-G p.Gln131Glu missense LLGL2 1 82434 1.21309E-5 41217 0 NA
17-73555358-A-G p.Thr133Ala missense LLGL2 1 82468 1.21259E-5 41234 0 NA
17-73555361-G-A p.Val134Met missense LLGL2 1 82556 1.2113E-5 41278 0 6.25E-4
17-73555374-A-G p.His138Arg missense LLGL2 1 82692 1.20931E-5 41346 0 NA
17-73555385-G-A p.Glu142Lys missense LLGL2 7 82722 8.46208E-5 41361 1 0.00100806
17-73555387-G-A p.Glu142Glu synonymous LLGL2 1 82716 1.20896E-5 41358 0 1.27421E-4
17-73555395-A-G p.Tyr145Cys missense LLGL2 2 82748 2.41698E-5 41374 0 3.18756E-5
17-73555399-G-T p.Leu146Leu synonymous LLGL2 1 82772 1.20814E-5 41386 0 NA
17-73555404-C-T p.Thr148Ile missense LLGL2 2 82750 2.41692E-5 41375 0 3.99049E-6
17-73555405-C-T p.Thr148Thr synonymous LLGL2 9 82742 1.08772E-4 41371 0 0.005
17-73555406-G-A p.Glu149Lys missense LLGL2 8 82762 9.66627E-5 41381 0 6.38351E-5
17-73555411-T-C p.Ser150Ser splice_region+synonymous LLGL2 2 82752 2.41686E-5 41376 0 NA
17-73555417-C-T p.Asn152Asn synonymous LLGL2 2 82726 2.41762E-5 41363 0 3.33528E-5
17-73555417-C-A p.Asn152Lys missense LLGL2 2 82726 2.41762E-5 41363 0 1.99407E-5
17-73555418-G-A p.Val153Met missense LLGL2 2 82730 2.4175E-5 41365 0 1.59528E-5
17-73555426-G-C p.Val156Val splice_region+synonymous LLGL2 1 82704 1.20913E-5 41352 0 7.97652E-6
17-73555429-G-T p.Val156Val synonymous LLGL2 1 82686 1.20939E-5 41343 0 NA
17-73555433-CTGCCAGCTTTTCGTGCG-C p.Leu158fs frameshift LLGL2 1 82680 1.20948E-5 41340 0 NA
17-73555435-G-A p.Leu158Leu synonymous LLGL2 4 82624 4.84121E-5 41312 0 6.25E-4
17-73555437-C-T p.Pro159Leu missense LLGL2 4 82610 4.84203E-5 41305 0 NA
17-73555444-T-C p.Phe161Phe synonymous LLGL2 1 82508 1.212E-5 41254 0 3.99103E-6
17-73555445-C-T p.Arg162Cys missense LLGL2 1 82468 1.21259E-5 41234 0 3.18715E-5
17-73555446-G-A p.Arg162His missense LLGL2 198 82412 0.00240256 41206 1 0.00583397
17-73555449-C-T p.Ala163Val missense LLGL2 1 82318 1.2148E-5 41159 0 8.36204E-6
17-73555457-G-A p.Asp166Asn missense LLGL2 1 82132 1.21755E-5 41066 0 NA
17-73555461-G-A p.Arg167Gln missense LLGL2 2 81910 2.4417E-5 40955 0 9.56084E-5
17-73555466-A-T p.Ile169Phe missense LLGL2 5 81768 6.11486E-5 40884 0 4.23277E-5
17-73555470-G-A p.Ser170Asn missense LLGL2 1 81576 1.22585E-5 40788 0 NA
17-73555473-C-T p.Ser171Leu missense LLGL2 1 81350 1.22926E-5 40675 0 5.66765E-5
17-73555474-G-A p.Ser171Ser synonymous LLGL2 4 81208 4.92562E-5 40604 0 9.72652E-5
17-73555477-C-T p.Asp172Asp synonymous LLGL2 7 80892 8.65351E-5 40446 0 2.86862E-4
17-73555478-G-A p.Ala173Thr missense LLGL2 60 80680 7.43679E-4 40340 0 0.0020141
17-73555479-C-T p.Ala173Val missense LLGL2 36 80548 4.46938E-4 40274 0 0.00100705
17-73555480-G-A p.Ala173Ala synonymous LLGL2 6 80492 7.45416E-5 40246 0 6.37349E-5
17-73555481-G-A p.Val174Met missense LLGL2 1 80416 1.24353E-5 40208 0 NA
17-73555483-G-T p.Val174Val synonymous LLGL2 4 80020 4.99875E-5 40010 0 5.03525E-4
17-73555490-C-T p.Arg177Trp missense+splice_region LLGL2 5 79022 6.32735E-5 39511 0 1.21387E-4
17-73555491-GG-CC p.Arg177Pro splice_donor LLGL2 1 78820 1.26871E-5 39410 0 NA
17-73555497-C-T c.530+6C>T splice_region LLGL2 2 77830 2.5697E-5 38915 0 8.73424E-6
17-73559090-C-T c.531-7C>T splice_region LLGL2 1 81764 1.22303E-5 40882 0 1.62578E-5
17-73559113-C-T p.Arg183Cys missense LLGL2 1 82288 1.21524E-5 41144 0 5.1496E-5
17-73559117-A-G p.His184Arg missense LLGL2 2 82310 2.42984E-5 41155 0 4.02133E-6
17-73559119-C-T p.Arg185Trp missense LLGL2 1 82378 1.21392E-5 41189 0 1.60778E-5
17-73559120-G-A p.Arg185Gln missense LLGL2 2 82330 2.42925E-5 41165 0 3.40959E-5
17-73559123-G-A p.Arg186His missense LLGL2 2 82394 2.42736E-5 41197 0 0.00100705
17-73559123-G-T p.Arg186Leu missense LLGL2 1 82394 1.21368E-5 41197 0 NA
17-73559126-T-G p.Val187Gly missense LLGL2 1 82412 1.21342E-5 41206 0 4.01133E-6
17-73559130-C-T p.Phe188Phe synonymous LLGL2 5 82522 6.05899E-5 41261 0 9.55536E-5
17-73559131-G-A p.Glu189Lys missense LLGL2 2 82526 2.42348E-5 41263 0 6.7643E-5
17-73559161-C-T p.Arg199* stop_gained LLGL2 1 82768 1.2082E-5 41384 0 8.39109E-6
17-73559162-G-A p.Arg199Gln missense LLGL2 2 82750 2.41692E-5 41375 0 3.99703E-6
17-73559168-C-T p.Pro201Leu missense LLGL2 3 82820 3.62231E-5 41410 0 1.67639E-5
17-73559185-G-A p.Gly207Ser missense LLGL2 4 82790 4.8315E-5 41395 0 1.99965E-5
17-73559187-C-T p.Gly207Gly synonymous LLGL2 2 82774 2.41622E-5 41387 0 NA
17-73559191-A-G p.Ser209Gly missense LLGL2 2 82706 2.4182E-5 41353 0 1.19986E-5
17-73559191-A-T p.Ser209Cys missense LLGL2 1 82706 1.2091E-5 41353 0 2.51644E-5
17-73559192-G-A p.Ser209Asn missense LLGL2 24 82688 2.90248E-4 41344 0 2.60128E-4
17-73559195-G-A p.Arg210Gln missense LLGL2 1 82662 1.20975E-5 41331 0 8.39151E-6
17-73559199-C-A p.Gly211Gly synonymous LLGL2 1 82680 1.20948E-5 41340 0 NA
17-73559202-C-T p.Leu212Leu synonymous LLGL2 29 82676 3.50767E-4 41338 0 2.91953E-4
17-73559203-G-A p.Val213Ile missense LLGL2 5 82662 6.04873E-5 41331 0 6.37064E-5
17-73559210-T-G p.Ile215Ser missense LLGL2 1 82652 1.20989E-5 41326 0 NA
17-73559220-A-G p.Leu218Leu synonymous LLGL2 4 82614 4.84179E-5 41307 0 9.55718E-5
17-73559229-C-T p.Ser221Ser synonymous LLGL2 1 82520 1.21183E-5 41260 0 NA
17-73559230-C-T p.Arg222Cys missense LLGL2 2 82522 2.4236E-5 41261 0 1.60032E-5
17-73559231-G-A p.Arg222His missense LLGL2 2 82520 2.42365E-5 41260 0 8.4052E-6
17-73559233-G-A p.Val223Met missense LLGL2 422 82496 0.0051154 41248 2 0.00805639
17-73559252-G-A p.Ser229Asn missense LLGL2 1 82298 1.2151E-5 41149 0 1.68466E-5
17-73559257-CAGGTAGGCAGTGCCCAGGACATGGCAGGCGCCATGTTGCTCTCCCAGGGCCCCAAGTGGCACATACACACTGTGCAGAGGCATGGGGTGCAGGCGATGGGAACGCCGCCTCGGTCCAGCGTGCTGCCCTCTGTCCCTCTCCTCTTCCTCCAT-C c.693+1_694-1del splice_acceptor LLGL2 2 82270 2.43102E-5 41135 0 NA
17-73559264-G-A c.693+5G>A splice_region LLGL2 1 82070 1.21847E-5 41035 0 NA
17-73559405-T-C c.694-7T>C splice_region LLGL2 1 82346 1.21439E-5 41173 0 NA
17-73559408-A-G c.694-4A>G splice_region LLGL2 2 82412 2.42683E-5 41206 0 1.27453E-4
17-73559413-A-C p.Gln232Pro missense+splice_region LLGL2 1 82464 1.21265E-5 41232 0 NA
17-73559426-C-A p.Ile236Ile synonymous LLGL2 2 82468 2.42518E-5 41234 0 4.00991E-5
17-73559441-C-T p.Asp241Asp synonymous LLGL2 2155 82286 0.0261891 41143 35 0.0433031
17-73559442-G-A p.Gly242Ser missense LLGL2 1 82310 1.21492E-5 41155 0 5.10135E-5
17-73559444-C-A p.Gly242Gly synonymous LLGL2 1 82314 1.21486E-5 41157 0 NA
17-73559445-C-T p.Arg243Cys missense LLGL2 4 82340 4.85791E-5 41170 0 6.37186E-5
17-73559451-C-T p.Leu245Phe missense LLGL2 1 82378 1.21392E-5 41189 0 1.60648E-5
17-73559453-C-T p.Leu245Leu synonymous LLGL2 86 82364 0.00104415 41182 0 0.00181575
17-73559458-G-C p.Ser247Thr missense LLGL2 1 82376 1.21395E-5 41188 0 3.18492E-5
17-73559469-G-A p.Asp251Asn missense LLGL2 2 82458 2.42548E-5 41229 0 4.24153E-5
17-73559471-C-T p.Asp251Asp synonymous LLGL2 8 82438 9.70426E-5 41219 0 8.82283E-4
17-73559486-G-A p.Gln256Gln synonymous LLGL2 1 82498 1.21215E-5 41249 0 NA
17-73559492-C-T p.Pro258Pro synonymous LLGL2 1 82470 1.21256E-5 41235 0 2.00402E-5
17-73559493-G-A p.Val259Met missense LLGL2 984 82402 0.0119415 41201 24 0.0190813
17-73559493-G-T p.Val259Leu missense LLGL2 245 82420 0.00297258 41210 7 0.00446139
17-73559501-C-T p.Ser261Ser synonymous LLGL2 2 82372 2.42801E-5 41186 0 2.53306E-5
17-73559506-C-T p.Ala263Val missense LLGL2 2 82396 2.4273E-5 41198 0 NA
17-73559515-C-T p.Pro266Leu missense LLGL2 20 82326 2.42937E-4 41163 0 5.03525E-4
17-73559526-C-T p.Arg270Cys missense LLGL2 1 82122 1.2177E-5 41061 0 2.00386E-5
17-73559527-G-A p.Arg270His missense LLGL2 4 82010 4.87745E-5 41005 0 2.00552E-5
17-73559534-C-T p.Leu272Leu synonymous LLGL2 2 81910 2.4417E-5 40955 0 4.2234E-5
17-73559535-G-A p.Val273Met missense LLGL2 1 81764 1.22303E-5 40882 0 3.37975E-5
17-73559541-T-TA p.Tyr275fs frameshift LLGL2 1 81614 1.22528E-5 40807 0 NA
17-73559543-C-T p.Tyr275Tyr splice_region+synonymous LLGL2 56 81508 6.87049E-4 40754 0 2.89319E-4
17-73559543-CG-C c.826+1delG splice_donor LLGL2 1 81508 1.22687E-5 40754 0 NA
17-73559544-G-A p.Gly276Ser missense+splice_region LLGL2 10 81432 1.22802E-4 40716 0 7.23519E-5
17-73559545-G-A c.826+1G>A splice_donor LLGL2 1 81414 1.22829E-5 40707 0 NA
17-73559547-C-CCCTTTCCTTGCAA c.826+3_826+4insCCTTTCCTTGCAA splice_region LLGL2 1 81360 1.22911E-5 40680 0 NA
17-73559826-C-T c.827-7C>T splice_region LLGL2 1 83254 1.20114E-5 41627 0 3.18471E-5
17-73559834-T-A p.Gly276Gly splice_region+synonymous LLGL2 1 83276 1.20083E-5 41638 0 NA
17-73559847-A-C p.Lys281Gln missense LLGL2 4 83266 4.80388E-5 41633 0 5.03525E-4
17-73559852-G-A p.Ala282Ala synonymous LLGL2 25 83260 3.00264E-4 41630 0 2.90455E-4
17-73559857-C-T p.Thr284Ile missense LLGL2 2 83260 2.40211E-5 41630 0 3.97864E-6
17-73559863-T-C p.Ile286Thr missense LLGL2 2 83258 2.40217E-5 41629 0 1.65273E-5
17-73559872-T-C p.Leu289Pro missense LLGL2 2 83242 2.40263E-5 41621 0 3.18512E-5
17-73559874-A-T p.Thr290Ser missense LLGL2 2 83242 2.40263E-5 41621 0 3.9789E-6
17-73559880-A-G p.Arg292Gly missense LLGL2 3 83224 3.60473E-5 41612 0 2.48032E-5
17-73559889-T-TTGCCCTTCACCATCTTCCAGGGTGGCATGCCACGGGCCAGCTACGGGG c.881+2_881+3insTGCCCTTCACCATCTTCCAGGGTGGCATGCCACGGGCCAGCTACGGGG splice_region LLGL2 1 83192 1.20204E-5 41596 0 NA
17-73559889-T-TTGCCCTTC c.881+2_881+3insTGCCCTTC splice_region LLGL2 2 83190 2.40414E-5 41595 0 NA
17-73560470-G-A p.Arg306Arg synonymous LLGL2 2 82792 2.41569E-5 41396 0 8.39095E-6
17-73560479-C-T p.Tyr309Tyr synonymous LLGL2 14 82836 1.69009E-4 41418 0 3.50519E-4
17-73560480-G-A p.Gly310Arg missense LLGL2 4 82902 4.82497E-5 41451 0 4.18193E-5
17-73560482-G-A p.Gly310Gly synonymous LLGL2 16 82916 1.92966E-4 41458 0 0.0020141
17-73560485-C-G p.Asp311Glu missense LLGL2 1 82988 1.20499E-5 41494 0 NA
17-73560487-G-A p.Arg312His missense LLGL2 1 83002 1.20479E-5 41501 0 7.99335E-6
17-73560509-C-T p.His319His synonymous LLGL2 31 83106 3.73018E-4 41553 0 0.00101924
17-73560510-G-A p.Asp320Asn missense LLGL2 9 83112 1.08288E-4 41556 0 1.99767E-4
17-73560523-C-T p.Thr324Met missense LLGL2 1 83094 1.20346E-5 41547 0 9.5584E-5
17-73560524-G-A p.Thr324Thr synonymous LLGL2 2 83090 2.40703E-5 41545 0 1.19688E-5
17-73560531-G-A p.Asp327Asn missense LLGL2 2 83090 2.40703E-5 41545 0 0.00125
17-73560531-G-T p.Asp327Tyr missense LLGL2 1 83090 1.20351E-5 41545 0 NA
17-73560536-C-T p.Phe328Phe synonymous LLGL2 1 83096 1.20343E-5 41548 0 3.18451E-5
17-73560543-C-T p.Arg331Cys missense LLGL2 5 83098 6.01699E-5 41549 0 3.18512E-5
17-73560544-G-A p.Arg331His missense LLGL2 1 83096 1.20343E-5 41548 0 1.27397E-4
17-73560549-A-G p.Ile333Val missense LLGL2 1 83070 1.2038E-5 41535 0 NA
17-73560551-C-T p.Ile333Ile synonymous LLGL2 3 83076 3.61115E-5 41538 0 1.67098E-5
17-73560553-G-C p.Gly334Ala missense LLGL2 1 83064 1.20389E-5 41532 0 3.18552E-5
17-73560561-G-C p.Val337Leu missense LLGL2 4 82864 4.82719E-5 41432 0 9.55475E-5
17-73560571-A-G p.Glu340Gly missense LLGL2 1 82786 1.20793E-5 41393 0 NA
17-73560587-C-T p.Ala345Ala splice_region+synonymous LLGL2 3 82782 3.62398E-5 41391 0 3.99754E-6
17-73560601-C-T p.Ser350Leu missense LLGL2 200 82624 0.0024206 41312 3 0.00618741
17-73560611-T-C p.Gly353Gly synonymous LLGL2 1 82362 1.21415E-5 41181 0 5.9317E-5
17-73560612-G-A p.Ala354Thr missense LLGL2 1 82352 1.2143E-5 41176 0 3.18918E-5
17-73560618-G-A p.Gly356Ser missense LLGL2 1 82284 1.2153E-5 41142 0 NA
17-73560803-G-A c.*180G>A splice_region LLGL2 8 48704 1.64258E-4 24352 0 4.46942E-4
17-73564551-C-T c.1037-6C>T splice_region LLGL2 2 82570 2.42219E-5 41285 0 8.85112E-6
17-73564553-C-G c.1037-4C>G splice_region LLGL2 1 82588 1.21083E-5 41294 0 3.18735E-5
17-73564560-T-C p.Phe347Ser missense LLGL2 1 82662 1.20975E-5 41331 0 NA
17-73564564-C-T p.Asp348Asp synonymous LLGL2 11 82706 1.33001E-4 41353 0 3.60726E-4
17-73564572-A-T p.Tyr351Phe missense LLGL2 2 82802 2.4154E-5 41401 0 NA
17-73564572-A-G p.Tyr351Cys missense LLGL2 2 82802 2.4154E-5 41401 0 3.19428E-5
17-73564576-C-A p.Ala352Ala synonymous LLGL2 1 82812 1.20755E-5 41406 0 NA
17-73564586-C-G p.Leu356Val missense LLGL2 1 82816 1.2075E-5 41408 0 NA
17-73564600-G-T p.Glu360Asp missense LLGL2 2 82858 2.41377E-5 41429 0 NA
17-73564603-G-T p.Leu361Leu synonymous LLGL2 1 82858 1.20688E-5 41429 0 3.99802E-6
17-73564612-T-G p.Ile364Met missense LLGL2 4 82848 4.82812E-5 41424 0 3.357E-5
17-73564615-C-T p.Asp365Asp synonymous LLGL2 2 82840 2.41429E-5 41420 0 0.00125
17-73564626-C-A p.Ala369Glu missense LLGL2 1 82810 1.20758E-5 41405 0 NA
17-73564629-G-T p.Gly370Val missense LLGL2 2 82784 2.41593E-5 41392 0 1.676E-5
17-73564638-C-T p.Pro373Leu missense LLGL2 14 82778 1.69127E-4 41389 0 5.03525E-4
17-73564639-G-A p.Pro373Pro synonymous LLGL2 5 82758 6.04171E-5 41379 0 3.19637E-5
17-73564655-C-G p.Leu379Val missense LLGL2 1 82818 1.20747E-5 41409 0 NA
17-73564674-C-A p.Ser385Tyr missense LLGL2 1 82792 1.20785E-5 41396 0 NA
17-73564675-C-T p.Ser385Ser synonymous LLGL2 1 82788 1.2079E-5 41394 0 2.79261E-5
17-73564691-C-T p.His391Tyr missense LLGL2 1 82814 1.20753E-5 41407 0 5.03525E-4
17-73564696-C-T p.His392His synonymous LLGL2 1 82796 1.20779E-5 41398 0 3.32806E-5
17-73564697-G-A p.Val393Ile missense LLGL2 2 82806 2.41528E-5 41403 0 1.66442E-5
17-73564703-A-G p.Asn395Asp missense LLGL2 1 82830 1.20729E-5 41415 0 NA
17-73564710-C-G p.Pro397Arg missense LLGL2 1 82824 1.20738E-5 41412 0 3.98654E-6
17-73564711-G-A c.188-7G>A splice_region LLGL2 3 82802 3.6231E-5 41401 0 5.03525E-4
17-73564719-T-C p.Leu400Pro missense LLGL2 3 82830 3.62188E-5 41415 0 2.79087E-5
17-73564727-C-T p.Arg403Trp missense LLGL2 6 82806 7.24585E-5 41403 0 3.32613E-5
17-73564728-G-A p.Arg403Gln missense LLGL2 10 82828 1.20732E-4 41414 0 6.25E-4
17-73564738-C-T p.Arg70Cys missense LLGL2 1 82750 1.20846E-5 41375 0 7.49738E-5
17-73564739-G-A p.Ala407Thr missense LLGL2 4 82726 4.83524E-5 41363 0 0.00151057
17-73564741-C-A p.Ala407Ala synonymous LLGL2 4 82766 4.8329E-5 41383 0 3.18593E-5
17-73564741-C-T p.Arg71Trp missense LLGL2 2 82766 2.41645E-5 41383 0 8.32251E-6
17-73564742-G-A p.Gly408Ser missense LLGL2 2 82770 2.41633E-5 41385 0 9.17241E-5
17-73564745-A-T p.Ser409Cys missense LLGL2 1 82772 1.20814E-5 41386 0 3.98638E-6
17-73564748-C-T p.Arg410Trp missense LLGL2 2 82766 2.41645E-5 41383 0 3.32618E-5
17-73564749-G-A p.Arg410Gln missense LLGL2 4 82754 4.8336E-5 41377 0 2.07897E-4
17-73564750-G-A p.Ala74Thr missense LLGL2 1 82736 1.20866E-5 41368 0 NA
17-73564754-A-G p.Asn412Asp missense LLGL2 1 82764 1.20825E-5 41382 0 3.98654E-6
17-73564756-C-T p.Arg76Cys missense LLGL2 8 82752 9.66744E-5 41376 0 5.03525E-4
17-73564757-G-A p.Ala413Thr missense LLGL2 5 82726 6.04405E-5 41363 0 5.58294E-5
17-73564761-A-C p.His414Pro missense LLGL2 6 82748 7.25093E-5 41374 0 NA
17-73564764-TCTC-T p.Leu79del disruptive_inframe_deletion LLGL2 2 82778 2.4161E-5 41389 0 NA
17-73564769-A-G p.Thr417Ala missense LLGL2 2 82754 2.4168E-5 41377 0 6.38447E-5
17-73564773-T-C p.Met418Thr missense+splice_region LLGL2 2 82770 2.41633E-5 41385 0 2.49975E-5
17-73564773-TGGTAGGTCTGGCCCTGGCCCCAGCCCCAGCCCCACCGCAAGCCAAACTCTCCCATGGACTTCTTGGTCTCTTTTTCTA-T p.Glu419fs frameshift LLGL2 13 82770 1.57062E-4 41385 6 NA
17-73564773-TG-T p.Phe415fs frameshift LLGL2 1 82770 1.20817E-5 41385 0 NA
17-73564863-T-C p.Ile422Thr missense LLGL2 7 82888 8.44513E-5 41444 0 2.86341E-5
17-73564874-A-G p.Thr426Ala missense LLGL2 1 82814 1.20753E-5 41407 0 9.56633E-5
17-73564878-G-C p.Ser427Thr missense LLGL2 2 82808 2.41523E-5 41404 0 NA
17-73564879-C-A p.Ser427Arg missense LLGL2 1 82808 1.20761E-5 41404 0 NA
17-73564895-C-T p.Pro433Ser missense LLGL2 1 82756 1.20837E-5 41378 0 NA
17-73564896-C-T p.Pro433Leu missense LLGL2 1 82750 1.20846E-5 41375 0 NA
17-73564904-G-T p.Asp436Tyr missense LLGL2 2 82712 2.41803E-5 41356 0 4.33351E-6
17-73564906-C-T p.Asp436Asp synonymous LLGL2 1 82704 1.20913E-5 41352 0 3.18573E-5
17-73564912-G-A p.Leu438Leu synonymous LLGL2 59 82654 7.13819E-4 41327 0 0.00453172
17-73564919-GGGTAGGGTACTTTGATGCTACCCCACCTCTTCCCAGTAGGATATGTGGGGTGGGAGCAGAGCCCTGAGGTGGACGAGCCAGCCCCTGGGCATCCCGGCTGGCATCCCTCTCACGCCTGGCAGGTGGGTTCTGCCCACA-G p.His442fs frameshift LLGL2 1 82602 1.21062E-5 41301 0 NA
17-73564921-G-GCACGAGGACGGCACGGTGCGGTTCTGGGATGCC c.1322+1_1322+2insCACGAGGACGGCACGGTGCGGTTCTGGGATGCC splice_donor LLGL2 3 82584 3.63266E-5 41292 1 NA
17-73564925-G-T c.1322+5G>T splice_region LLGL2 6 82538 7.26938E-5 41269 0 9.0986E-6
17-73565036-T-C c.21-6T>C splice_region LLGL2 2 82272 2.43096E-5 41136 0 NA
17-73565051-G-A c.1323-8G>A splice_region LLGL2 6 82318 7.28881E-5 41159 0 8.54506E-5
17-73565052-C-T p.Pro11Ser missense LLGL2 1 82322 1.21474E-5 41161 0 1.62872E-5
17-73565057-A-AG p.His442fs frameshift LLGL2 1 82364 1.21412E-5 41182 0 NA
17-73565062-C-T p.Thr14Met missense LLGL2 1 82338 1.21451E-5 41169 0 1.62033E-5
17-73565068-C-T p.Thr16Met missense LLGL2 10 82392 1.21371E-4 41196 0 6.25E-4
17-73565069-G-A p.Gly445Ser missense LLGL2 7 82376 8.49762E-5 41188 0 0.00125
17-73565073-C-T p.Thr446Met missense LLGL2 1 82380 1.21389E-5 41190 0 1.61612E-5
17-73565078-C-T p.Arg448Trp missense LLGL2 9 82412 1.09207E-4 41206 0 5.25689E-5
17-73565079-G-A p.Arg448Gln missense LLGL2 1 82422 1.21327E-5 41211 0 4.03327E-6
17-73565094-C-T p.Ser453Leu missense LLGL2 1 82484 1.21236E-5 41242 0 4.03597E-6
17-73565095-G-A p.Arg25Gln missense LLGL2 3 82478 3.63733E-5 41239 1 3.18613E-5
17-73565108-C-T p.Arg458Trp missense LLGL2 89 82496 0.00107884 41248 1 0.00137004
17-73565109-G-A p.Arg458Gln missense LLGL2 2 82526 2.42348E-5 41263 0 4.0475E-5
17-73565123-C-T p.Leu463Phe missense LLGL2 3 82512 3.63583E-5 41256 0 2.29131E-4
17-73565135-C-T p.Arg467Cys missense LLGL2 1 82544 1.21148E-5 41272 0 1.21631E-5
17-73565137-C-T p.Ala39Val missense LLGL2 1 82554 1.21133E-5 41277 0 5.29185E-5
17-73565148-C-T p.Thr471Ile missense LLGL2 8 82622 9.68265E-5 41311 0 2.82819E-5
17-73565149-C-T p.Pro43Leu missense LLGL2 2 82614 2.4209E-5 41307 0 1.21218E-5
17-73565150-G-A p.Asp472Asn missense LLGL2 1 82606 1.21057E-5 41303 0 3.18532E-5
17-73565154-C-T p.Thr473Met missense LLGL2 11 82656 1.33082E-4 41328 0 1.59236E-4
17-73565155-G-A p.Arg45Gln missense LLGL2 1 82624 1.2103E-5 41312 0 3.18492E-5
17-73565160-CCAA-C p.Thr48del disruptive_inframe_deletion LLGL2 6 82706 7.25461E-5 41353 0 8.72981E-5
17-73565163-A-G p.Asn476Ser missense LLGL2 2 82682 2.41891E-5 41341 0 2.0118E-5
17-73565163-A-C p.Asn476Thr missense LLGL2 1 82682 1.20945E-5 41341 0 NA
17-73565164-C-T p.Thr48Met missense LLGL2 916 82658 0.0110818 41329 18 0.030715
17-73565165-G-A p.Glu477Lys missense LLGL2 4 82674 4.83828E-5 41337 0 6.37146E-5
17-73565171-T-C p.Phe479Leu missense LLGL2 35166 82354 0.42701 41177 8288 0.493005
17-73565178-C-T p.Ala481Val missense LLGL2 1 82696 1.20925E-5 41348 0 3.18573E-5
17-73565181-A-C p.Gln482Pro missense LLGL2 1 82700 1.20919E-5 41350 0 3.18613E-5
17-73565181-A-G p.Gln482Arg missense LLGL2 12 82700 1.45103E-4 41350 0 4.14197E-4
17-73565191-C-T p.Thr57Met missense LLGL2 1 82718 1.20893E-5 41359 0 8.51847E-6
17-73565194-G-A p.Ser58Asn missense LLGL2 4 82740 4.83442E-5 41370 0 3.18552E-5
17-73565197-G-GC p.Leu490fs frameshift LLGL2 1 82696 1.20925E-5 41348 0 8.50427E-6
17-73565200-C-T p.Pro60Leu missense LLGL2 550 82694 0.00665103 41347 17 0.0144641
17-73565207-C-T p.Arg491Cys missense LLGL2 2 82682 2.41891E-5 41341 0 7.64448E-5
17-73565208-G-T p.Arg491Leu missense LLGL2 4 82648 4.8398E-5 41324 0 1.69999E-5
17-73565208-G-A p.Arg491His missense LLGL2 1 82648 1.20995E-5 41324 0 8.03181E-6
17-73565210-AAGGTGAGGCCAGGAGCCTGGGACCCAGGAAGGGCAGAGGCCAGCTGGGTCCTGTCCCCGTGGCTGCTCACAGGGCCCCTCCCCTTCTCC-A p.Lys492fs frameshift LLGL2 14 82672 1.69344E-4 41336 7 NA
17-73565212-G-A p.Arg64Lys missense+splice_region LLGL2 1 82680 1.20948E-5 41340 0 3.18532E-5
17-73565307-C-T p.Ala66Val missense LLGL2 36 82894 4.3429E-4 41447 0 6.05558E-4
17-73565326-G-T p.Asp501Tyr missense LLGL2 2 82920 2.41196E-5 41460 0 8.29518E-6
17-73565327-A-C p.Asp501Ala missense LLGL2 10 82920 1.20598E-4 41460 0 6.37959E-5
17-73565335-C-T p.Arg504Trp missense LLGL2 1 82914 1.20607E-5 41457 0 1.19479E-5
17-73565336-G-A p.Arg504Gln missense LLGL2 3 82892 3.61917E-5 41446 0 8.29394E-6
17-73565342-G-A p.Gly506Asp missense LLGL2 1 82892 1.20639E-5 41446 0 4.77935E-5
17-73565347-CAGA-C p.Lys509del disruptive_inframe_deletion LLGL2 1 82900 1.20627E-5 41450 0 NA
17-73565367-G-T p.Lys514Asn missense LLGL2 3 82806 3.62293E-5 41403 0 8.31463E-6
17-73565374-G-A p.Gly517Ser missense LLGL2 3 82710 3.62713E-5 41355 0 1.6677E-5
17-73565377-T-C p.Tyr518His missense LLGL2 1 82642 1.21004E-5 41321 0 6.37227E-5
17-73565396-C-T p.Thr524Met missense LLGL2 3 81964 3.66014E-5 40982 0 8.0309E-6
17-73565406-G-A p.Arg99Lys missense+splice_region LLGL2 3 81536 3.67936E-5 40768 0 NA
17-73565413-G-T c.1581+7G>T splice_region LLGL2 1 81272 1.23044E-5 40636 0 NA
17-73566040-G-T c.1582-4G>T splice_region LLGL2 1 78838 1.26842E-5 39419 0 NA
17-73566051-T-C p.Val530Ala missense LLGL2 2 79212 2.52487E-5 39606 0 4.21745E-6
17-73566056-G-A p.Trp103* stop_gained LLGL2 3 79414 3.77767E-5 39707 0 3.18857E-5
17-73566063-A-G p.Asn534Ser missense LLGL2 1 79572 1.25672E-5 39786 0 6.25E-4
17-73566067-C-T p.Asp535Asp synonymous LLGL2 5 79604 6.28109E-5 39802 0 3.64259E-5
17-73566075-C-CGGAGCAGGCTGT p.Ala541_Gln544dup disruptive_inframe_insertion LLGL2 2 79738 2.50821E-5 39869 0 NA
17-73566076-G-A p.Ala538Ala synonymous LLGL2 12 79834 1.50312E-4 39917 0 0.00125
17-73566085-T-C p.Ala541Ala synonymous LLGL2 1 79990 1.25016E-5 39995 0 NA
17-73566094-G-C p.Gln544His missense LLGL2 643 80168 0.00802066 40084 14 0.0160704
17-73566101-G-A p.Ala547Thr missense LLGL2 3 80320 3.73506E-5 40160 0 2.50982E-4
17-73566103-C-T p.Ala547Ala synonymous LLGL2 2 80340 2.48942E-5 40170 0 7.79005E-5
17-73566106-C-T p.Asp548Asp synonymous LLGL2 12 80550 1.48976E-4 40275 0 6.25E-4
17-73566117-A-G p.Asp552Gly missense LLGL2 2 80970 2.47005E-5 40485 0 3.18817E-5
17-73566121-A-G p.Gln553Gln synonymous LLGL2 1 81262 1.23059E-5 40631 0 3.18776E-5
17-73566131-C-T p.Arg557Cys missense LLGL2 1 81516 1.22675E-5 40758 0 8.85881E-6
17-73566132-G-C p.Arg557Pro missense LLGL2 1 81576 1.22585E-5 40788 0 3.18776E-5
17-73566132-G-A p.Arg557His missense LLGL2 2 81576 2.4517E-5 40788 0 6.26286E-5
17-73566150-G-A p.Arg563His missense LLGL2 2 81898 2.44206E-5 40949 0 1.95408E-5
17-73566151-C-T p.Arg563Arg synonymous LLGL2 1 81912 1.22082E-5 40956 0 NA
17-73566161-C-T p.Arg567Cys missense LLGL2 1 81974 1.2199E-5 40987 0 7.37168E-5
17-73566162-G-A p.Arg567His missense LLGL2 3 81970 3.65988E-5 40985 0 4.10442E-6
17-73566165-C-T p.Ser568Leu missense LLGL2 1 82048 1.2188E-5 41024 0 8.22774E-6
17-73566172-C-T p.Pro570Pro synonymous LLGL2 2 82060 2.43724E-5 41030 0 1.66799E-5
17-73566173-G-A p.Val571Met missense LLGL2 2 82092 2.43629E-5 41046 0 0.00101317
17-73566176-C-A p.Arg572Ser missense LLGL2 1 82100 1.21803E-5 41050 0 NA
17-73566177-G-A p.Arg572His missense LLGL2 2 82112 2.4357E-5 41056 0 5.48186E-5
17-73566186-C-T p.Pro575Leu missense LLGL2 1 82176 1.2169E-5 41088 0 NA
17-73566209-G-A p.Val583Met missense LLGL2 1 82108 1.21791E-5 41054 0 1.47606E-5
17-73566211-G-A p.Val583Val synonymous LLGL2 1 82096 1.21809E-5 41048 0 1.20948E-4
17-73566223-C-T p.Pro587Pro synonymous LLGL2 1 82090 1.21818E-5 41045 0 NA
17-73566225-C-T p.Pro588Leu missense LLGL2 25 82064 3.0464E-4 41032 0 3.18674E-5
17-73566226-G-A p.Pro588Pro synonymous LLGL2 5 82030 6.09533E-5 41015 0 0.0010142
17-73566227-G-A p.Ala589Thr missense LLGL2 30 82046 3.65649E-4 41023 0 0.00101523
17-73566228-C-T p.Ala589Val missense LLGL2 1 82048 1.2188E-5 41024 0 4.87505E-6
17-73566235-C-T p.Val591Val synonymous LLGL2 13 82024 1.5849E-4 41012 0 6.05404E-4
17-73566247-C-T p.Ala595Ala synonymous LLGL2 1 81986 1.21972E-5 40993 0 1.67796E-5
17-73566254-T-C p.Ser598Pro missense LLGL2 1 81954 1.2202E-5 40977 0 NA
17-73566263-C-T p.Arg601Trp missense LLGL2 2 81742 2.44672E-5 40871 0 5.8223E-5
17-73566269-G-A p.Val603Met missense LLGL2 7 80422 8.70409E-5 40211 0 0.00256148
17-73566277-C-T p.Phe605Phe synonymous LLGL2 25 80468 3.10683E-4 40234 0 0.00153531
17-73566278-G-A p.Gly606Ser missense LLGL2 1 80392 1.2439E-5 40196 0 NA
17-73566282-C-T p.Thr607Ile missense LLGL2 1 80842 1.23698E-5 40421 0 4.66105E-6
17-73566283-C-A p.Thr607Thr synonymous LLGL2 1 80958 1.23521E-5 40479 0 3.18613E-5
17-73566288-A-G p.His609Arg missense LLGL2 5 81118 6.16386E-5 40559 0 1.65859E-5
17-73566291-G-A p.Gly610Asp missense LLGL2 1 81202 1.2315E-5 40601 0 4.4568E-6
17-73566298-C-A p.Gly612Gly synonymous LLGL2 1 81210 1.23138E-5 40605 0 NA
17-73566317-C-T p.Arg619Trp missense LLGL2 10 81140 1.23244E-4 40570 0 1.17443E-4
17-73566318-G-T p.Arg619Leu missense LLGL2 124 81144 0.00152815 40572 1 0.00910931
17-73566318-G-A p.Arg619Gln missense LLGL2 1 81150 1.23229E-5 40575 0 3.18878E-5
17-73566320-C-T p.Arg620Trp missense LLGL2 2 81138 2.46494E-5 40569 0 2.89788E-5
17-73566327-T-C p.Val622Ala missense LLGL2 1 81100 1.23305E-5 40550 0 8.75956E-6
17-73566332-G-A p.Val624Ile missense LLGL2 1 81192 1.23165E-5 40596 0 NA
17-73566336-AGTGAGCAGGGGCGGCTGGGTCCCGGGGCTGGGAGTGGGGCCCGCGAGGACTCCCAGGACCTAGCAGCACTGACAGCCTGCCATCCCCCCAAG-A c.1874+1_1875-1delGTGAGCAGGGGCGGCTGGGTCCCGGGGCTGGGAGTGGGGCCCGCGAGGACTCCCAGGACCTAGCAGCACTGACAGCCTGCCATCCCCCCAAG splice_acceptor LLGL2 8 81186 9.85392E-5 40593 0 NA
17-73566339-G-T c.1874+3G>T splice_region LLGL2 1 81164 1.23207E-5 40582 0 NA
17-73566424-C-G c.1875-5C>G splice_region LLGL2 656 82018 0.00799824 41009 17 0.0159378
17-73566424-C-T c.1875-5C>T splice_region LLGL2 16 82034 1.95041E-4 41017 0 5.10009E-4
17-73566424-C-A c.1875-5C>A splice_region LLGL2 6 82036 7.31386E-5 41018 0 3.18329E-5
17-73566425-C-G c.1875-4C>G splice_region LLGL2 1 82048 1.2188E-5 41024 0 3.18046E-5
17-73566429-G-C p.Lys625Asn missense+splice_region LLGL2 1 82058 1.21865E-5 41029 0 4.07814E-6
17-73566435-A-G p.Thr627Thr synonymous LLGL2 1 82082 1.21829E-5 41041 0 NA
17-73566441-C-T p.His629His synonymous LLGL2 5 82100 6.09013E-5 41050 1 1.91156E-4
17-73566442-C-T p.Pro630Ser missense LLGL2 2 82116 2.43558E-5 41058 0 9.55901E-5
17-73566446-G-T p.Ser631Ile missense LLGL2 1 82112 1.21785E-5 41056 0 NA
17-73566447-T-C p.Ser631Ser synonymous LLGL2 2 82118 2.43552E-5 41059 0 NA
17-73566450-C-T p.Asp632Asp synonymous LLGL2 1 82144 1.21737E-5 41072 0 5.05051E-4
17-73566469-C-T p.Pro639Ser missense LLGL2 249 82060 0.00303437 41030 3 0.0069471
17-73566477-C-T p.Ser641Ser synonymous LLGL2 1 82066 1.21853E-5 41033 0 NA
17-73566478-C-T p.Arg642Cys missense LLGL2 1 82040 1.21892E-5 41020 0 1.14419E-5
17-73566479-G-A p.Arg642His missense LLGL2 2 82004 2.43891E-5 41002 0 2.28697E-5
17-73566480-C-T p.Arg642Arg synonymous LLGL2 2 81998 2.43908E-5 40999 0 4.60437E-5
17-73566481-G-A p.Val643Ile missense LLGL2 2 81960 2.44021E-5 40980 0 2.47421E-5
17-73566484-A-T p.Lys644* stop_gained LLGL2 1 81920 1.2207E-5 40960 0 NA
17-73566486-G-A p.Lys644Lys synonymous LLGL2 5 81892 6.1056E-5 40946 0 NA
17-73566503-T-TG p.Arg651fs frameshift LLGL2 1 81568 1.22597E-5 40784 0 1.29186E-5
17-73566506-G-A p.Arg651His missense LLGL2 2 81502 2.45393E-5 40751 0 3.9792E-5
17-73566520-C-T p.Arg656Trp missense LLGL2 11 80876 1.36011E-4 40438 0 3.50653E-4
17-73566521-G-A p.Arg656Gln missense LLGL2 1 80876 1.23646E-5 40438 0 3.18796E-5
17-73566526-C-T p.Arg658Cys missense LLGL2 3 80440 3.72949E-5 40220 0 0.00202224
17-73566529-C-T p.Arg659Trp missense LLGL2 1 80182 1.24716E-5 40091 0 4.64671E-6
17-73566530-G-A p.Arg659Gln missense LLGL2 2 80130 2.49594E-5 40065 0 5.15251E-5
17-73566535-C-T p.Arg661Trp missense LLGL2 5 79450 6.29327E-5 39725 0 3.18979E-5
17-73566536-G-A p.Arg661Gln missense LLGL2 1 79302 1.261E-5 39651 0 3.56672E-5
17-73566549-G-A p.Arg665Arg synonymous LLGL2 2 77824 2.5699E-5 38912 0 4.06322E-5
17-73566552-G-T p.Lys666Asn missense LLGL2 1 77352 1.29279E-5 38676 0 NA
17-73566554-G-A p.Arg667Gln missense LLGL2 57 76648 7.43659E-4 38324 0 0.00126103
17-73566560-C-T p.Pro669Leu missense LLGL2 2 75754 2.64012E-5 37877 0 3.23022E-5
17-73566561-G-A p.Pro669Pro synonymous LLGL2 11341 74668 0.151886 37334 759 0.263656
17-73566568-C-G p.Pro672Ala missense LLGL2 5 75308 6.6394E-5 37654 0 3.32204E-5
17-73566568-C-T p.Pro672Ser missense LLGL2 1 75308 1.32788E-5 37654 0 5.51803E-6
17-73566584-G-A c.2025+5G>A splice_region LLGL2 1 73536 1.35988E-5 36768 0 NA
17-73567040-G-A p.Gly679Arg missense LLGL2 100 81076 0.00123341 40538 1 0.00352467
17-73567042-G-T p.Gly679Gly synonymous LLGL2 5 81148 6.16158E-5 40574 0 5.03525E-4
17-73567042-G-A p.Gly679Gly synonymous LLGL2 1 81148 1.23232E-5 40574 0 6.37186E-5
17-73567046-G-A p.Ala681Thr missense LLGL2 28 81232 3.44692E-4 40616 0 0.00163028
17-73567049-A-C p.Lys682Gln missense LLGL2 1 81364 1.22904E-5 40682 0 NA
17-73567052-G-A p.Ala683Thr missense LLGL2 1 81424 1.22814E-5 40712 0 1.72798E-5
17-73567059-G-A p.Arg685Gln missense LLGL2 3 81636 3.67485E-5 40818 0 3.18715E-5
17-73567060-G-A p.Arg685Arg synonymous LLGL2 1 81678 1.22432E-5 40839 0 NA
17-73567064-G-A p.Gly687Ser missense LLGL2 1 81858 1.22163E-5 40929 0 NA
17-73567065-G-A p.Gly687Asp missense LLGL2 1 81834 1.22199E-5 40917 0 NA
17-73567076-A-G p.Met691Val missense LLGL2 1 82156 1.2172E-5 41078 0 NA
17-73567083-T-C p.Leu693Pro missense LLGL2 4 82276 4.86169E-5 41138 0 6.37064E-5
17-73567086-C-T p.Ala694Val missense LLGL2 1 82300 1.21507E-5 41150 0 4.20196E-5
17-73567097-C-T p.Arg698Cys missense LLGL2 52 82444 6.30731E-4 41222 0 6.69216E-4
17-73567098-G-A p.Arg698His missense LLGL2 1 82452 1.21283E-5 41226 0 6.37389E-5
17-73567099-C-T p.Arg698Arg synonymous LLGL2 8 82468 9.70073E-5 41234 0 3.99361E-6
17-73567105-C-T p.Ile700Ile synonymous LLGL2 1 82482 1.21239E-5 41241 0 1.6758E-5
17-73567112-C-T p.Arg703Cys missense LLGL2 1 82524 1.21177E-5 41262 0 1.67485E-5
17-73567113-G-C p.Arg703Pro missense LLGL2 1 82424 1.21324E-5 41212 0 5.03525E-4
17-73567116-C-T p.Ser704Leu missense LLGL2 1 82446 1.21292E-5 41223 0 NA
17-73567117-G-A p.Ser704Ser synonymous LLGL2 33 82442 4.00281E-4 41221 0 5.86068E-5
17-73567125-A-T p.Asp707Val missense LLGL2 1 82514 1.21192E-5 41257 0 NA
17-73567129-C-T p.Ser708Ser synonymous LLGL2 2 82546 2.42289E-5 41273 0 3.99339E-6
17-73567141-C-T p.Phe712Phe synonymous LLGL2 3 82494 3.63663E-5 41247 0 3.19081E-5
17-73567142-G-C p.Val713Leu missense LLGL2 1 82478 1.21244E-5 41239 0 NA
17-73567145-C-T p.Arg714Trp missense LLGL2 2 82480 2.42483E-5 41240 0 1.6751E-5
17-73567146-G-A p.Arg714Gln missense LLGL2 11 82414 1.33472E-4 41207 0 4.4677E-4
17-73567152-T-C p.Leu716Pro missense LLGL2 1 82410 1.21345E-5 41205 0 NA
17-73567160-G-A p.Ala719Thr missense LLGL2 4 82310 4.85968E-5 41155 0 1.59459E-4
17-73567171-C-T p.Tyr722Tyr synonymous LLGL2 1 82130 1.21758E-5 41065 0 4.02612E-6
17-73567172-C-T p.Leu723Leu synonymous LLGL2 2 82112 2.4357E-5 41056 0 3.22235E-5
17-73567174-GA-G p.Lys724fs frameshift LLGL2 1 82028 1.2191E-5 41014 0 NA
17-73567742-C-T c.2177-6C>T splice_region LLGL2 7 81528 8.58601E-5 40764 0 3.69446E-5
17-73567749-C-T p.Ser726Ser splice_region+synonymous LLGL2 14 81532 1.71712E-4 40766 0 3.18492E-4
17-73567749-C-A p.Ser726Arg missense+splice_region LLGL2 1 81532 1.22651E-5 40766 0 NA
17-73567751-C-T p.Ser727Phe missense LLGL2 80 81618 9.80176E-4 40809 0 0.00133775
17-73567753-C-T p.Arg728Trp missense LLGL2 8 81634 9.79984E-5 40817 0 1.62524E-4
17-73567754-G-A p.Arg728Gln missense LLGL2 1 81462 1.22757E-5 40731 0 3.18634E-5
17-73567767-G-A p.Ser732Ser synonymous LLGL2 1 81608 1.22537E-5 40804 0 1.27421E-4
17-73567782-C-T p.Thr737Thr synonymous LLGL2 2 82036 2.43795E-5 41018 0 8.4763E-6
17-73567784-A-C p.Asn738Thr missense LLGL2 5 82054 6.09355E-5 41027 0 6.77794E-5
17-73567784-A-G p.Asn738Ser missense LLGL2 2 82054 2.43742E-5 41027 0 0.00101523
17-73567797-C-T p.Ile742Ile synonymous LLGL2 20 82182 2.43362E-4 41091 0 4.04609E-5
17-73567801-G-A p.Ala744Thr missense LLGL2 740 82138 0.00900923 41069 3 0.00675699
17-73567801-G-T p.Ala744Ser missense LLGL2 2 82162 2.43422E-5 41081 0 NA
17-73567808-C-T p.Ser746Phe missense LLGL2 13 82220 1.58112E-4 41110 0 6.05134E-4
17-73567813-C-T p.Arg748Cys missense LLGL2 9 82136 1.09574E-4 41068 0 6.25E-4
17-73567814-G-A p.Arg748His missense LLGL2 146 82184 0.0017765 41092 1 0.00318573
17-73567823-C-T p.Pro751Leu missense LLGL2 1 82262 1.21563E-5 41131 0 2.53597E-5
17-73567824-C-T p.Pro751Pro synonymous LLGL2 11 82276 1.33696E-4 41138 0 8.1211E-5
17-73567825-G-A p.Ala752Thr missense LLGL2 3 82240 3.64786E-5 41120 0 6.25E-4
17-73567827-C-T p.Ala752Ala synonymous LLGL2 3 82260 3.64697E-5 41130 0 6.37105E-5
17-73567828-G-A p.Glu753Lys missense LLGL2 2 82278 2.43078E-5 41139 0 3.18715E-5
17-73567829-A-T p.Glu753Val missense LLGL2 3 82294 3.64547E-5 41147 0 1.62415E-5
17-73567831-C-T p.Arg754Trp missense LLGL2 2 82308 2.4299E-5 41154 0 3.18695E-5
17-73567832-G-A p.Arg754Gln missense LLGL2 16 82338 1.94321E-4 41169 0 4.4603E-4
17-73567845-G-A p.Glu758Glu synonymous LLGL2 1 82290 1.21521E-5 41145 0 4.07146E-6
17-73567846-C-T p.Pro759Ser missense LLGL2 24691 81808 0.301816 40904 3979 0.356495
17-73567851-G-A p.Val760Val synonymous LLGL2 1 82280 1.21536E-5 41140 0 NA
17-73567852-C-T p.Arg761Trp missense LLGL2 6 82256 7.2943E-5 41128 0 0.0015121
17-73567854-G-C p.Arg761Arg synonymous LLGL2 1 82268 1.21554E-5 41134 0 NA
17-73567863-GGGTGAGTGCTGGGCAGGGAGAGCAGAGGGTGCTCGGGCTGCCTGGGCTGGGTCCAGGGAGTGGCTCCAGCCCTGCCACCCCCTCACCAGCCCCAACACCCACCTCCTCCCCCTA-G p.Ala765fs frameshift LLGL2 1 82216 1.21631E-5 41108 0 NA
17-73567971-C-T c.2294-8C>T splice_region LLGL2 3 82172 3.65088E-5 41086 0 4.06293E-6
17-73567973-C-T c.2294-6C>T splice_region LLGL2 1 82214 1.21634E-5 41107 0 2.02863E-5
17-73567975-CT-C c.2294-3delT splice_region LLGL2 54 82212 6.56838E-4 41106 0 3.56853E-4
17-73567979-C-T p.Ala765Val missense+splice_region LLGL2 1 82260 1.21566E-5 41130 0 NA
17-73568003-G-A p.Arg773Gln missense LLGL2 2 82556 2.4226E-5 41278 0 8.57765E-6
17-73568005-G-C p.Ala774Pro missense LLGL2 1 82590 1.2108E-5 41295 0 1.71248E-5
17-73568006-C-T p.Ala774Val missense LLGL2 1 82574 1.21103E-5 41287 0 6.37796E-5
17-73568007-G-A p.Ala774Ala synonymous LLGL2 4 82586 4.84344E-5 41293 0 1.91461E-4
17-73568009-C-T p.Pro775Leu missense LLGL2 2 82600 2.42131E-5 41300 0 1.71025E-5
17-73568010-G-A p.Pro775Pro synonymous LLGL2 8 82624 9.68242E-5 41312 0 0.00100705
17-73568013-G-A p.Val776Val synonymous LLGL2 1 82642 1.21004E-5 41321 0 NA
17-73568028-G-A p.Val781Val synonymous LLGL2 1 82674 1.20957E-5 41337 0 6.25E-4
17-73568031-C-T p.Leu782Leu synonymous LLGL2 1291 82648 0.0156205 41324 37 0.0239357
17-73568031-C-A p.Leu782Leu synonymous LLGL2 1 82656 1.20983E-5 41328 0 NA
17-73568032-G-A p.Asp783Asn missense LLGL2 3 82662 3.62924E-5 41331 0 3.18898E-5
17-73568034-C-T p.Asp783Asp synonymous LLGL2 1 82680 1.20948E-5 41340 0 4.2434E-5
17-73568035-G-A p.Gly784Arg missense LLGL2 1 82682 1.20945E-5 41341 0 1.20342E-5
17-73568043-C-T p.Ser786Ser synonymous LLGL2 2 82682 2.41891E-5 41341 0 3.60982E-5
17-73568044-G-A p.Val787Ile missense LLGL2 2 82666 2.41937E-5 41333 0 3.18959E-5
17-73568050-C-T p.Leu789Phe missense LLGL2 2 82672 2.4192E-5 41336 0 NA
17-73568052-T-G p.Leu789Leu synonymous LLGL2 1 82634 1.21016E-5 41317 0 NA
17-73568055-C-T p.Pro790Pro synonymous LLGL2 19455 82456 0.235944 41228 2278 0.257398
17-73568061-C-A p.Pro792Pro synonymous LLGL2 1 82670 1.20963E-5 41335 0 NA
17-73568062-CTC-TTT p.Leu793Phe missense LLGL2 3 82680 3.62845E-5 41340 0 NA
17-73568065-G-A p.Glu794Lys missense LLGL2 2 82646 2.41996E-5 41323 0 1.2024E-5
17-73568067-A-G p.Glu794Glu synonymous LLGL2 1 82664 1.20972E-5 41332 0 8.01276E-6
17-73568068-G-A p.Val795Met missense LLGL2 1 82664 1.20972E-5 41332 0 6.37267E-5
17-73568070-G-A p.Val795Val synonymous LLGL2 7 82650 8.46945E-5 41325 0 1.27453E-4
17-73568084-C-T p.Ser800Leu missense LLGL2 7 82636 8.47088E-5 41318 0 1.27575E-4
17-73568085-G-A p.Ser800Ser synonymous LLGL2 6 82630 7.26128E-5 41315 0 3.18837E-5
17-73568113-C-T p.Gln810* stop_gained LLGL2 1 82456 1.21277E-5 41228 0 NA
17-73568113-C-G p.Gln810Glu missense LLGL2 1 82456 1.21277E-5 41228 0 NA
17-73568125-G-A p.Val814Ile missense LLGL2 28 82172 3.40749E-4 41086 0 0.003125
17-73568144-A-G p.Lys820Arg missense+splice_region LLGL2 2 81716 2.4475E-5 40858 0 9.01339E-6
17-73569087-G-A c.2461-8G>A splice_region LLGL2 2 80230 2.49283E-5 40115 0 8.86745E-6
17-73569102-C-T p.Thr823Met missense LLGL2 2 80460 2.48571E-5 40230 0 2.60227E-5
17-73569103-G-A p.Thr823Thr synonymous LLGL2 1 80444 1.2431E-5 40222 0 8.13742E-6
17-73569112-G-A p.Lys826Lys synonymous LLGL2 1 80556 1.24137E-5 40278 0 4.04514E-6
17-73569115-G-A p.Val827Val synonymous LLGL2 12 80532 1.49009E-4 40266 0 1.21331E-5
17-73569139-G-T p.Leu835Leu synonymous LLGL2 2 80966 2.47017E-5 40483 0 3.35773E-5
17-73569139-G-A p.Leu835Leu synonymous LLGL2 1 80966 1.23509E-5 40483 0 8.39433E-6
17-73569142-G-A p.Thr836Thr synonymous LLGL2 1 80992 1.23469E-5 40496 0 3.18918E-5
17-73569158-A-C p.Arg842Arg synonymous LLGL2 99 81324 0.00121735 40662 1 0.00352467
17-73569159-G-C p.Arg842Thr missense LLGL2 1 81336 1.22947E-5 40668 0 3.18756E-5
17-73569164-C-G p.Arg844Gly missense LLGL2 2 81192 2.4633E-5 40596 0 NA
17-73569164-C-T p.Arg844Trp missense LLGL2 2 81192 2.4633E-5 40596 0 6.25E-4
17-73569165-G-A p.Arg844Gln missense LLGL2 1 81272 1.23044E-5 40636 0 6.38203E-5
17-73569167-C-T p.Arg845Trp missense LLGL2 1 81186 1.23174E-5 40593 0 2.01875E-5
17-73569168-G-A p.Arg845Gln missense LLGL2 2 81326 2.45924E-5 40663 0 5.6515E-5
17-73569170-G-A p.Val846Ile missense LLGL2 1 81000 1.23457E-5 40500 0 4.0348E-6
17-73569176-G-A p.Val848Met missense LLGL2 3 80228 3.73934E-5 40114 0 3.63775E-5
17-73569176-G-T p.Val848Leu missense LLGL2 1 80230 1.24642E-5 40115 0 NA
17-73569187-C-T p.Phe851Phe synonymous LLGL2 3 80512 3.72615E-5 40256 0 5.06586E-4
17-73569188-G-A p.Gly852Ser missense LLGL2 8 80648 9.91965E-5 40324 0 6.75756E-5
17-73569190-C-T p.Gly852Gly synonymous LLGL2 1 80680 1.23946E-5 40340 0 NA
17-73569192-G-T p.Ser853Ile missense LLGL2 2 80834 2.47421E-5 40417 0 NA
17-73569194-C-T p.Arg854Cys missense LLGL2 2 80904 2.47207E-5 40452 0 2.4155E-5
17-73569195-G-A p.Arg854His missense LLGL2 2 81088 2.46646E-5 40544 0 3.19122E-5
17-73569197-C-T p.Arg855* stop_gained LLGL2 4 81184 4.92708E-5 40592 0 8.04305E-6
17-73569198-G-A p.Arg855Gln missense LLGL2 2 81504 2.45387E-5 40752 0 4.01181E-5
17-73569211-C-T p.Tyr859Tyr synonymous LLGL2 25 82140 3.04358E-4 41070 0 0.00151362
17-73569212-G-C p.Gly860Arg missense LLGL2 6 82144 7.30425E-5 41072 0 6.25E-4
17-73569213-G-T p.Gly860Val missense LLGL2 1 82186 1.21675E-5 41093 0 NA
17-73569213-G-C p.Gly860Ala missense LLGL2 1 82186 1.21675E-5 41093 0 1.27494E-4
17-73569214-G-A p.Gly860Gly synonymous LLGL2 1 82200 1.21655E-5 41100 0 1.34576E-4
17-73569215-G-A p.Glu861Lys missense LLGL2 1 82200 1.21655E-5 41100 0 6.3743E-5
17-73569218-C-T p.His862Tyr missense LLGL2 1 82142 1.2174E-5 41071 0 NA
17-73569228-C-A p.Ala865Glu missense LLGL2 4 82380 4.85555E-5 41190 0 1.68084E-5
17-73569233-C-G p.Leu867Val missense LLGL2 2 82434 2.42618E-5 41217 0 8.40364E-6
17-73569247-C-T p.Gly871Gly synonymous LLGL2 6 82348 7.28615E-5 41174 0 1.26131E-4
17-73569248-G-A p.Asp872Asn missense LLGL2 2 82384 2.42766E-5 41192 0 0.0025
17-73569272-C-T p.Leu880Leu synonymous LLGL2 1 82282 1.21533E-5 41141 0 5.03525E-4
17-73569280-G-T p.Lys882Asn missense LLGL2 2 82144 2.43475E-5 41072 0 NA
17-73569290-C-T p.Arg886Cys missense LLGL2 2 82002 2.43896E-5 41001 0 3.20513E-5
17-73569291-G-A p.Arg886His missense LLGL2 7 81974 8.53929E-5 40987 0 4.45973E-4
17-73569301-C-T p.Cys889Cys synonymous LLGL2 1 81856 1.22166E-5 40928 0 3.18552E-5
17-73569305-C-T p.Arg891Cys missense LLGL2 4 81788 4.89069E-5 40894 0 9.55718E-5
17-73569308-C-T p.Arg892Trp missense LLGL2 45 81654 5.51106E-4 40827 0 0.00200726
17-73569309-G-A p.Arg892Gln missense LLGL2 5 81714 6.1189E-5 40857 0 9.55779E-5
17-73569314-GA-G p.Asp894fs frameshift LLGL2 1 81542 1.22636E-5 40771 0 3.18593E-5
17-73569316-C-T p.Asp894Asp synonymous LLGL2 1 81488 1.22717E-5 40744 0 5.11701E-5
17-73569317-G-A p.Val895Ile missense LLGL2 1 81476 1.22736E-5 40738 0 1.20806E-5
17-73569324-G-C p.Gly897Ala missense LLGL2 2 81336 2.45894E-5 40668 0 3.18654E-4
17-73569325-C-T p.Gly897Gly synonymous LLGL2 1 81336 1.22947E-5 40668 0 NA
17-73569328-C-T p.Ile898Ile synonymous LLGL2 10 81248 1.2308E-4 40624 0 9.32163E-5
17-73569329-G-A p.Ala899Thr missense LLGL2 4 81160 4.92854E-5 40580 0 1.73473E-5
17-73569337-C-T p.Cys901Cys synonymous LLGL2 13 81062 1.60371E-4 40531 0 5.04541E-4
17-73569338-G-A p.Val902Ile missense LLGL2 33 81092 4.06945E-4 40546 0 0.00146646
17-73569360-G-GC c.2725+1_2725+2insC splice_donor LLGL2 1 80922 1.23576E-5 40461 0 NA
17-73569554-C-T c.2726-8C>T splice_region LLGL2 1 81944 1.22035E-5 40972 0 4.01081E-6
17-73569559-C-T c.2726-3C>T splice_region LLGL2 1 82070 1.21847E-5 41035 0 4.00445E-6
17-73569568-A-T p.Tyr911Phe missense LLGL2 3 82160 3.65141E-5 41080 0 2.54717E-5
17-73569570-C-G p.Leu912Val missense LLGL2 2 82168 2.43404E-5 41084 0 NA
17-73569578-A-C p.Ser914Ser synonymous LLGL2 2 82202 2.43303E-5 41101 0 7.20179E-5
17-73569581-C-T p.Pro915Pro synonymous LLGL2 157 82308 0.00190747 41154 1 0.00350721
17-73569583-C-T p.Ser916Leu missense LLGL2 2 82260 2.43132E-5 41130 0 8.46955E-6
17-73569584-G-A p.Ser916Ser synonymous LLGL2 1 82244 1.21589E-5 41122 0 2.54022E-5
17-73569590-T-A p.Phe918Leu missense LLGL2 20 82312 2.42978E-4 41156 0 0.00104969
17-73569594-C-T p.Arg920Cys missense LLGL2 2 82284 2.43061E-5 41142 0 8.46468E-6
17-73569595-G-A p.Arg920His missense LLGL2 2 82276 2.43084E-5 41138 0 NA
17-73569601-C-T p.Ser922Phe missense LLGL2 1 82402 1.21356E-5 41201 0 3.18898E-5
17-73569611-C-G p.Thr925Thr synonymous LLGL2 9 82418 1.09199E-4 41209 0 9.56816E-5
17-73569623-G-A p.Val929Val synonymous LLGL2 4 82100 4.87211E-5 41050 0 1.60752E-5
17-73569624-G-A p.Glu930Lys missense LLGL2 1 82092 1.21815E-5 41046 0 NA
17-73569630-C-T p.Arg932Trp missense LLGL2 4 82080 4.87329E-5 41040 0 6.25E-4
17-73569631-G-A p.Arg932Gln missense LLGL2 1 81926 1.22061E-5 40963 0 3.41419E-5
17-73569631-G-C p.Arg932Pro missense LLGL2 1 81926 1.22061E-5 40963 0 4.02437E-6
17-73569638-G-C p.Leu1? start_lost LLGL2 1 81958 1.22014E-5 40979 0 4.02554E-6
17-73569658-A-T p.Lys941Met missense LLGL2 1 81648 1.22477E-5 40824 0 8.5834E-6
17-73569662-C-G p.Asn942Lys missense LLGL2 2 81472 2.45483E-5 40736 0 NA
17-73569666-C-T p.Arg944Cys missense LLGL2 750 81250 0.00923077 40625 3 0.00934143
17-73569668-C-T p.Arg944Arg synonymous LLGL2 2 81158 2.46433E-5 40579 0 NA
17-73569677-C-T p.Asn947Asn synonymous LLGL2 5 80462 6.21411E-5 40231 0 1.30678E-4
17-73569678-G-A p.Gly948Ser missense LLGL2 9 80510 1.11787E-4 40255 0 0.0020141
17-73569681-G-C p.Ala949Pro missense LLGL2 1 80154 1.2476E-5 40077 0 NA
17-73569682-C-T p.Ala949Val missense LLGL2 3 79928 3.75338E-5 39964 0 4.37468E-5
17-73569683-G-A p.Ala949Ala synonymous LLGL2 8 80270 9.96636E-5 40135 0 9.58283E-5
17-73569700-C-G p.Pro955Arg missense LLGL2 2 78978 2.53235E-5 39489 0 0.138018
17-73569701-G-A p.Pro955Pro synonymous LLGL2 984 80164 0.0122748 40082 8 0.0216334
17-73569705-C-A p.Arg957Arg synonymous LLGL2 1 80208 1.24676E-5 40104 0 NA
17-73569706-G-A p.Arg957Gln missense LLGL2 270 80252 0.0033644 40126 2 0.0299797
17-73569708-G-A p.Ala958Thr missense LLGL2 2 80228 2.4929E-5 40114 0 NA
17-73569712-G-A p.Arg959Lys missense+splice_region LLGL2 1 80262 1.24592E-5 40131 0 NA
17-73569716-A-G c.2876+4A>G splice_region LLGL2 1 79990 1.25016E-5 39995 0 NA
17-73569717-G-C c.2876+5G>C splice_region LLGL2 4 79944 5.0035E-5 39972 0 NA
17-73569717-G-A c.2876+5G>A splice_region LLGL2 1 79944 1.25088E-5 39972 0 3.61624E-5
17-73570033-G-A p.Arg959Arg splice_region+synonymous LLGL2 1 80766 1.23814E-5 40383 0 NA
17-73570045-T-A p.Thr963Thr synonymous LLGL2 2 80690 2.47862E-5 40345 0 3.19163E-5
17-73570048-G-C p.Gln964His missense LLGL2 3 80662 3.71922E-5 40331 0 1.91241E-4
17-73570057-C-T p.Gly967Gly synonymous LLGL2 16 80522 1.98703E-4 40261 0 7.58725E-4
17-73570058-G-A p.Glu968Lys missense LLGL2 7 80526 8.69284E-5 40263 0 5.0597E-5
17-73570060-G-A p.Glu968Glu splice_region+synonymous LLGL2 3 80496 3.72689E-5 40248 0 1.27584E-4
17-73570060-G-C p.Glu968Asp missense+splice_region LLGL2 1 80496 1.2423E-5 40248 0 NA
17-73570190-AGCCCTGG-A n.2426-1_2431delGCCCTGG splice_acceptor LLGL2 2 76144 2.6266E-5 38072 0 8.1473E-5
17-73570229-G-GGA p.Ser52fs frameshift LLGL2 2 78186 2.558E-5 39093 0 7.85953E-6
17-73570235-A-G p.Arg50Arg synonymous LLGL2 1 78388 1.27571E-5 39194 0 NA
17-73570237-A-C p.Glu51Ala missense LLGL2 20 78450 2.54939E-4 39225 0 5.32623E-4
17-73570239-A-C p.Ser52Arg missense LLGL2 2 78520 2.54712E-5 39260 0 6.25E-4
17-73570244-G-A p.Gln53Gln synonymous LLGL2 2 78712 2.54091E-5 39356 0 3.1904E-5
17-73570248-G-A p.Glu55Lys missense LLGL2 2 78886 2.5353E-5 39443 0 NA
17-73570258-C-T p.Pro58Leu missense LLGL2 1 79178 1.26298E-5 39589 0 8.06257E-6
17-73570262-C-T p.Gly59Gly synonymous LLGL2 12 79154 1.51603E-4 39577 0 6.38488E-5
17-73570263-G-A p.Gly60Arg missense LLGL2 2 79244 2.52385E-5 39622 0 3.23834E-5
17-73570265-G-T p.Gly60Gly synonymous LLGL2 1 79228 1.26218E-5 39614 0 NA
17-73570267-C-T p.Ala61Val missense LLGL2 4 79130 5.05497E-5 39565 0 0.00143724
17-73570268-G-A p.Ala61Ala synonymous LLGL2 5 79256 6.30867E-5 39628 0 6.38774E-5
17-73570274-A-G p.Ter63Trpext*? stop_lost LLGL2 1 79390 1.2596E-5 39695 0 NA
17-73570299-C-A p.Gln971Lys missense LLGL2 23 79560 2.8909E-4 39780 0 0.00106553
17-73570299-C-T p.Gln971* stop_gained LLGL2 1 79562 1.25688E-5 39781 0 NA
17-73570302-C-T p.Pro972Ser missense LLGL2 1 79514 1.25764E-5 39757 0 3.20533E-5
17-73570304-C-T p.Pro972Pro synonymous LLGL2 1 79454 1.25859E-5 39727 0 NA
17-73570305-G-A p.Gly973Ser missense LLGL2 1 79462 1.25846E-5 39731 0 3.20739E-5
17-73570316-G-A p.Met976Ile missense LLGL2 1 79296 1.2611E-5 39648 0 NA
17-73570320-C-T p.Arg978Cys missense LLGL2 3 78954 3.79968E-5 39477 0 1.39653E-5
17-73570321-G-A p.Arg978His missense LLGL2 4 78966 5.06547E-5 39483 0 1.1919E-4
17-73570323-G-A p.Ala979Thr missense LLGL2 3 78852 3.8046E-5 39426 0 NA
17-73570324-C-T p.Ala979Val missense LLGL2 49 78834 6.21559E-4 39417 0 0.0010022
17-73570333-G-C p.Ser982Thr missense LLGL2 4 78350 5.1053E-5 39175 0 6.47794E-5
17-73570342-G-A c.2953+1G>A splice_donor LLGL2 1 77736 1.28641E-5 38868 0 NA
17-73570348-T-C c.2953+7T>C splice_region LLGL2 1 77076 1.29742E-5 38538 0 3.99574E-4
17-73570533-G-A c.2954-1G>A splice_acceptor LLGL2 3 80460 3.72856E-5 40230 0 2.15285E-4
17-73570535-A-G p.Arg985Arg splice_region+synonymous LLGL2 1 80496 1.2423E-5 40248 0 NA
17-73570558-C-A p.Thr993Lys missense LLGL2 2 80934 2.47115E-5 40467 0 1.22903E-5
17-73570572-C-A p.Arg998Ser missense LLGL2 2 81030 2.46822E-5 40515 0 NA
17-73570573-G-A p.Arg998His missense LLGL2 2 81068 2.46706E-5 40534 0 1.19854E-5
17-73570573-G-T p.Arg998Leu missense LLGL2 3 81070 3.70051E-5 40535 0 1.79781E-5
17-73570574-C-T p.Arg998Arg splice_region+synonymous LLGL2 1 81072 1.23347E-5 40536 0 6.28931E-4
17-73570575-GGGTGAGGCACCGCCCAGGCCAGCTGGGGTGGGCCCGAGGCTCTGCCAGAGGGCTCAGGGGAGCGCTGAGAGTGGAGGTCCCTGAGGCCATGACTCCCCTGTCTTTGCCTGTGCA-G p.Arg985fs frameshift LLGL2 4 81102 4.93206E-5 40551 0 NA
17-73570575-G-A p.Gly999Arg missense+splice_region LLGL2 1 81106 1.23295E-5 40553 0 4.725E-5
17-73570579-G-A c.2996+3G>A splice_region LLGL2 1 81106 1.23295E-5 40553 0 3.18959E-5
17-73570583-C-T c.2996+7C>T splice_region LLGL2 3 81088 3.69968E-5 40544 0 4.52284E-5
17-73570694-C-T p.Ala986Val missense LLGL2 4 81564 4.90412E-5 40782 0 6.37674E-5
17-73570695-G-A p.Gly1001Ser missense LLGL2 1249 81558 0.0153143 40779 17 0.0132129
17-73570704-C-T p.Arg1004Cys missense LLGL2 118 81352 0.00145049 40676 0 0.00398673
17-73570705-G-A p.Val990Ile missense LLGL2 8 81356 9.83333E-5 40678 0 3.18959E-5
17-73570711-A-G p.Ile992Val missense LLGL2 3 81302 3.68995E-5 40651 0 NA
17-73570713-C-T p.Arg1007* stop_gained LLGL2 7 81092 8.63217E-5 40546 0 1.91351E-4
17-73570713-C-A p.Ile992Ile synonymous LLGL2 1 81092 1.23317E-5 40546 0 NA
17-73570714-G-A p.Glu993Lys missense LLGL2 7 81026 8.6392E-5 40513 0 2.09911E-4
17-73570714-G-C p.Glu993Gln missense LLGL2 1 81026 1.23417E-5 40513 0 1.21805E-5
17-73570718-C-G p.Pro994Arg missense LLGL2 23785 79476 0.299273 39738 3856 0.362973
17-73570718-C-T p.Pro994Leu missense LLGL2 2 80778 2.47592E-5 40389 0 9.5957E-5
17-73570718-C-A p.Pro994Gln missense LLGL2 2 80778 2.47592E-5 40389 0 1.76929E-5
17-73570719-G-A p.Ala1009Thr missense LLGL2 4 80718 4.95552E-5 40359 0 1.62405E-5
17-73570721-C-T p.Pro995Leu missense LLGL2 13 80684 1.61122E-4 40342 0 2.31189E-4
17-73570722-G-A p.Val1010Met missense LLGL2 6 80714 7.43365E-5 40357 0 3.24623E-5
17-73570724-G-T p.Trp996Leu missense LLGL2 1 80708 1.23903E-5 40354 0 1.76653E-5
17-73570726-G-C p.Gly997Arg missense LLGL2 26 80698 3.22189E-4 40349 0 0.00201816
17-73570727-G-A p.Gly997Asp missense LLGL2 1 80634 1.24017E-5 40317 0 4.0539E-6
17-73570728-T-C p.Cys1012Arg missense LLGL2 1 80524 1.24187E-5 40262 0 NA
17-73570732-G-A p.Ala999Thr missense LLGL2 17 80356 2.11559E-4 40178 0 9.71337E-5
17-73570742-T-C p.Met1002Thr missense LLGL2 1 80062 1.24903E-5 40031 0 NA
17-73570746-G-A p.Gly1018Arg missense LLGL2 2 79686 2.50985E-5 39843 0 1.22757E-5
17-73570750-G-A c.3012+1G>A splice_donor LLGL2 1 79512 1.25767E-5 39756 0 2.45608E-5
17-73570751-T-TG c.3012+2_3012+3insG splice_region LLGL2 10 79306 1.26094E-4 39653 0 3.1953E-5
17-73570752-G-C c.3012+3G>C splice_region LLGL2 14 79404 1.76314E-4 39702 0 1.06831E-4
17-73570753-G-A c.3012+4G>A splice_region LLGL2 1 79356 1.26014E-5 39678 0 8.00413E-5
17-73570756-G-T c.3012+7G>T splice_region LLGL2 23172 77654 0.298401 38827 3800 0.361577
17-73570950-A-G c.3013-2A>G splice_acceptor LLGL2 2 82902 2.41249E-5 41451 0 4.00506E-6
17-73570961-T-C p.Trp1008Arg missense LLGL2 1 82866 1.20677E-5 41433 0 NA
17-73570968-G-C p.Ser1010Thr missense LLGL2 2 82862 2.41365E-5 41431 0 NA
17-73570970-G-A p.Val1011Ile missense LLGL2 15 82856 1.81037E-4 41428 0 1.91363E-4
17-73570980-C-T p.Ala1014Val missense LLGL2 1 82802 1.2077E-5 41401 0 8.40007E-5
17-73570980-C-G p.Ala1014Gly missense LLGL2 2 82802 2.4154E-5 41401 0 NA
17-73570981-G-A p.Ala1014Ala synonymous LLGL2 4 82806 4.83057E-5 41403 0 3.18878E-5
17-73570982-C-T p.Arg1015* stop_gained LLGL2 1 82820 1.20744E-5 41410 0 1.23951E-4
17-73570983-G-A p.Arg1015Gln missense LLGL2 1 82832 1.20726E-5 41416 0 3.18898E-5
17-73570984-A-T p.Arg1015Arg synonymous LLGL2 1 82846 1.20706E-5 41423 0 NA