Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
6-29909094-G-A c.-284G>A splice_region HLA-A 2 2068 9.67118E-4 1034 0 3.1841E-5
6-29909101-G-A c.-282+5G>A splice_region HLA-A 1 2178 4.59137E-4 1089 0 NA
6-29909735-G-A c.-281-8G>A splice_region HLA-A 1 16810 5.94884E-5 8405 0 NA
6-29909744-C-T c.-280C>T splice_region HLA-A 1298 15430 0.0841218 7715 2 0.0835369
6-29909744-CA-TG c.-280_-279delCAinsTG splice_region HLA-A 208 16268 0.0127858 8134 0 NA
6-29909745-A-G c.-279A>G splice_region HLA-A 9834 15606 0.630142 7803 3298 0.648156
6-29909745-A-C c.-279A>C splice_region HLA-A 1 16416 6.09162E-5 8208 0 NA
6-29909756-G-T c.-268G>T 5_prime_UTR_premature_start_codon_gain HLA-A 1768 16942 0.104356 8471 179 0.119565
6-29909840-G-A c.-184G>A 5_prime_UTR_premature_start_codon_gain HLA-A 9382 21792 0.430525 10896 2223 0.498528
6-29910027-C-G c.-304C>G 5_prime_UTR_premature_start_codon_gain HLA-A 15406 28680 0.537169 14340 3674 0.636369
6-29910072-G-A c.-259G>A 5_prime_UTR_premature_start_codon_gain HLA-A 1 47522 2.10429E-5 23761 0 NA
6-29910095-C-T c.-236C>T 5_prime_UTR_premature_start_codon_gain HLA-A 182 51006 0.00356821 25503 0 0.00129172
6-29910112-T-C c.-219T>C 5_prime_UTR_premature_start_codon_gain HLA-A 3 61840 4.85123E-5 30920 0 9.56511E-5
6-29910130-G-T c.-201G>T 5_prime_UTR_premature_start_codon_gain HLA-A 1 66948 1.4937E-5 33474 0 NA
6-29910145-C-G c.-186C>G 5_prime_UTR_premature_start_codon_gain HLA-A 10 69952 1.42955E-4 34976 0 3.18471E-5
6-29910146-C-T c.-185C>T 5_prime_UTR_premature_start_codon_gain HLA-A 3 70132 4.27765E-5 35066 0 9.55475E-5
6-29910165-C-G c.-166C>G 5_prime_UTR_premature_start_codon_gain HLA-A 1 73862 1.35388E-5 36931 0 NA
6-29910167-C-G c.-164C>G 5_prime_UTR_premature_start_codon_gain HLA-A 5346 73660 0.0725767 36830 97 0.0717256
6-29910173-C-G c.-150-8C>G splice_region HLA-A 4 75344 5.30898E-5 37672 0 3.18492E-5
6-29910175-A-G c.-156A>G 5_prime_UTR_premature_start_codon_gain HLA-A 487 70894 0.00686941 35447 0 0.0209652
6-29910176-C-T c.-155C>T 5_prime_UTR_premature_start_codon_gain HLA-A 31005 57814 0.536289 28907 7004 0.614452
6-29910176-C-G c.-150-5C>G splice_region HLA-A 1 75726 1.32055E-5 37863 0 NA
6-29910179-A-C c.-150-2A>C splice_acceptor HLA-A 495 71640 0.00690955 35820 0 0.0227352
6-29910179-AGGG-CTGC c.-150-2_-149delAGGGinsCTGC splice_acceptor HLA-A 11 76090 1.44566E-4 38045 0 NA
6-29910179-AG-CT c.-150-2_-150-1delAGinsCT splice_acceptor HLA-A 2 76128 2.62715E-5 38064 0 NA
6-29910180-G-T c.-150-1G>T splice_acceptor HLA-A 496 71854 0.00690289 35927 0 0.0228612
6-29910180-GGG-TGC c.-150-1_-149delGGGinsTGC splice_acceptor HLA-A 1 76360 1.30959E-5 38180 0 NA
6-29910182-G-C c.-149G>C splice_region HLA-A 504 72112 0.00698913 36056 0 0.0233537
6-29910221-C-G c.-110C>G 5_prime_UTR_premature_start_codon_gain HLA-A 1 80196 1.24694E-5 40098 0 NA
6-29910225-C-G c.-106C>G 5_prime_UTR_premature_start_codon_gain HLA-A 898 72490 0.0123879 36245 0 0.0376763
6-29910229-T-C c.-102T>C 5_prime_UTR_premature_start_codon_gain HLA-A 5 80396 6.21921E-5 40198 0 NA
6-29910237-C-T c.-94C>T 5_prime_UTR_premature_start_codon_gain HLA-A 1060 72112 0.0146994 36056 0 0.0424522
6-29910264-C-T c.-67C>T 5_prime_UTR_premature_start_codon_gain HLA-A 2 81854 2.44337E-5 40927 0 NA
6-29910331-A-T p.Met1? initiator_codon HLA-A 1 83012 1.20465E-5 41506 0 NA
6-29910336-C-G p.Ala2Ala synonymous HLA-A 4607 76908 0.0599027 38454 0 0.118899
6-29910337-G-A p.Val3Ile missense HLA-A 65 83022 7.82925E-4 41511 0 2.51715E-4
6-29910339-C-A p.Val3Val synonymous HLA-A 1 83040 1.20424E-5 41520 0 5.33049E-4
6-29910340-A-G p.Met4Val missense HLA-A 4706 77080 0.0610535 38540 0 0.118899
6-29910341-T-C p.Met4Thr missense HLA-A 2 83050 2.40819E-5 41525 0 NA
6-29910343-G-C p.Ala5Pro missense HLA-A 106 83024 0.00127674 41512 0 0.00223314
6-29910344-C-T p.Ala5Val missense HLA-A 4 83052 4.81626E-5 41526 0 4.08115E-5
6-29910344-C-A p.Ala5Glu missense HLA-A 2 83052 2.40813E-5 41526 0 4.53461E-6
6-29910358-C-G p.Leu10Val missense HLA-A 39668 80184 0.494712 40092 9339 0.504393
6-29910358-C-A p.Leu10Ile missense HLA-A 1 83020 1.20453E-5 41510 0 4.62351E-6
6-29910361-C-A p.Leu11Met missense HLA-A 1 83030 1.20438E-5 41515 0 4.37193E-5
6-29910363-G-A p.Leu11Leu synonymous HLA-A 1 83002 1.20479E-5 41501 0 NA
6-29910366-A-G p.Leu12Leu synonymous HLA-A 1 82962 1.20537E-5 41481 0 0.0298507
6-29910371-C-T p.Ser14Leu missense HLA-A 10080 82086 0.122798 41043 271 0.136994
6-29910375-G-A p.Gly15Gly synonymous HLA-A 1 82986 1.20502E-5 41493 0 1.32937E-5
6-29910378-C-T p.Ala16Ala synonymous HLA-A 20472 81620 0.250821 40810 2539 0.274533
6-29910383-C-G p.Ala18Gly missense HLA-A 1 82966 1.20531E-5 41483 0 3.18878E-5
6-29910384-C-T p.Ala18Ala synonymous HLA-A 17 82950 2.04943E-4 41475 0 4.39159E-5
6-29910389-C-A p.Thr20Asn missense HLA-A 2 82912 2.4122E-5 41456 0 2.15649E-5
6-29910397-T-A p.Trp23Arg missense HLA-A 621 82800 0.0075 41400 8 0.0176218
6-29910399-G-A p.Trp23* stop_gained HLA-A 1 82846 1.20706E-5 41423 0 NA
6-29910401-C-A p.Ala24Glu missense+splice_region HLA-A 1 82798 1.20776E-5 41399 0 NA
6-29910402-G-A p.Ala24Ala splice_region+synonymous HLA-A 10369 82060 0.126359 41030 659 0.155934
6-29910402-GGGTGAGTGCGGGGTCGGGAGGGAAACCGCCTCTGCGGGGAGAAGCAAGGGGCCCTCCTGGCGGGGGCGCAGGACCGGGGGAGCCGCGCCGGGACGAGGGTCGGGCAGGTCTCAGCCACTGCTCGCCCCCA-G p.Gly25fs frameshift HLA-A 2 82798 2.41552E-5 41399 0 NA
6-29910404-GTGAGTGCGGGGTCGGGAGGGAAACCGC-G c.73+2_73+28delTGAGTGCGGGGTCGGGAGGGAAACCGC splice_donor HLA-A 4 82770 4.83267E-5 41385 2 8.92873E-6
6-29910409-T-C c.73+6T>C splice_region HLA-A 1 82646 1.20998E-5 41323 0 9.06191E-6
6-29910435-TGCGGGGAGAAGCAAGGGGCCCTCCTGGCGGGGGCGCAGGACCGGGGGAGCCGCGCCGGGACGAGGGTCGGGCAGGTCTCAGCCACTGCTCGCCCCCAGGCTCC-T p.Gly25fs frameshift HLA-A 1 82252 1.21578E-5 41126 0 9.26887E-6
6-29910526-G-T c.74-8G>T splice_region HLA-A 1 80712 1.23897E-5 40356 0 NA
6-29910527-C-T c.74-7C>T splice_region HLA-A 29936 78796 0.379918 39398 5903 0.402441
6-29910527-C-A c.74-7C>A splice_region HLA-A 1 80764 1.23818E-5 40382 0 3.29207E-5
6-29910530-C-T c.74-4C>T splice_region HLA-A 3115 74568 0.041774 37284 0 0.106464
6-29910531-C-T c.74-3C>T splice_region HLA-A 1 80904 1.23603E-5 40452 0 NA
6-29910538-C-T p.Ser26Ser synonymous HLA-A 20013 80002 0.250156 40001 2541 0.266617
6-29910541-C-A p.His27Gln missense HLA-A 7 81076 8.63387E-5 40538 0 1.56842E-4
6-29910541-C-G p.His27Gln missense HLA-A 11 81076 1.35675E-4 40538 0 6.37349E-5
6-29910544-C-T p.Ser28Ser synonymous HLA-A 1 81202 1.2315E-5 40601 0 8.22057E-6
6-29910548-A-G p.Arg30Gly missense HLA-A 3 81272 3.69131E-5 40636 0 1.63753E-5
6-29910550-G-C p.Arg30Ser missense HLA-A 1 81318 1.22974E-5 40659 0 NA
6-29910552-A-G p.Tyr31Cys missense HLA-A 28 81442 3.43803E-4 40721 0 7.14245E-4
6-29910557-T-A p.Phe33Ile missense HLA-A 6279 80770 0.0777393 40385 60 0.0980084
6-29910557-TT-AC p.Phe33Thr missense HLA-A 455 81502 0.00558269 40751 2 NA
6-29910558-T-A p.Phe33Tyr missense HLA-A 15705 80082 0.196111 40041 1471 0.352056
6-29910558-T-C p.Phe33Ser missense HLA-A 21481 80032 0.268405 40016 3202 0.476075
6-29910562-A-C p.Thr34Thr synonymous HLA-A 12131 76378 0.158828 38189 1052 0.214606
6-29910562-A-T p.Thr34Thr synonymous HLA-A 1373 81022 0.016946 40511 16 0.0357131
6-29910565-C-G p.Ser35Ser synonymous HLA-A 1 81750 1.22324E-5 40875 0 NA
6-29910566-G-A p.Val36Met missense HLA-A 1414 81610 0.0173263 40805 0 0.032881
6-29910568-G-C p.Val36Val synonymous HLA-A 5 81820 6.11098E-5 40910 0 6.88387E-5
6-29910569-TCC-T p.Arg38fs frameshift HLA-A 1 81822 1.22217E-5 40911 0 4.04845E-6
6-29910572-C-T p.Arg38Trp missense HLA-A 47 81120 5.79389E-4 40560 0 0.124685
6-29910573-G-C p.Arg38Pro missense HLA-A 4 81948 4.88114E-5 40974 0 1.91192E-4
6-29910581-C-A p.Arg41Ser missense HLA-A 7265 78584 0.0924488 39292 132 0.137909
6-29910581-CGC-AGT p.Arg41Ser missense HLA-A 551 81962 0.00672263 40981 8 NA
6-29910581-C-T p.Arg41Cys missense HLA-A 1 82020 1.21921E-5 41010 0 2.68478E-5
6-29910583-C-T p.Arg41Arg synonymous HLA-A 7293 78616 0.0927674 39308 133 0.137909
6-29910585-G-T p.Gly42Val missense HLA-A 1 82150 1.21729E-5 41075 0 NA
6-29910586-G-A p.Gly42Gly synonymous HLA-A 7878 78716 0.100081 39358 139 0.140252
6-29910587-G-A p.Glu43Lys missense HLA-A 44 82172 5.35462E-4 41086 0 0.0026283
6-29910587-G-GAGCCCCGCTTCATCGCCGTGGGC p.Tyr51fs frameshift HLA-A 1 82174 1.21693E-5 41087 0 NA
6-29910592-C-G p.Pro44Pro synonymous HLA-A 1 82350 1.21433E-5 41175 0 NA
6-29910600-T-G p.Ile47Ser missense HLA-A 3 82472 3.6376E-5 41236 0 2.23029E-4
6-29910602-G-T p.Ala48Ser missense HLA-A 64 80916 7.90944E-4 40458 0 0.0589711
6-29910604-C-A p.Ala48Ala synonymous HLA-A 26168 77882 0.335995 38941 3015 0.385817
6-29910606-T-C p.Val49Ala missense HLA-A 2 82532 2.4233E-5 41266 0 1.67163E-5
6-29910607-G-C p.Val49Val synonymous HLA-A 71 80894 8.77692E-4 40447 0 0.0797325
6-29910612-A-T p.Tyr51Phe missense HLA-A 1 82594 1.21074E-5 41297 0 NA
6-29910615-T-C p.Val52Ala missense HLA-A 1 82634 1.21016E-5 41317 0 NA
6-29910622-C-T p.Asp54Asp synonymous HLA-A 54 81108 6.65779E-4 40554 0 0.174025
6-29910623-A-T p.Thr55Ser missense HLA-A 98 82618 0.00118618 41309 0 0.00213607
6-29910635-C-A n.177+4C>A splice_region HLA-A 1 82614 1.21045E-5 41307 0 0.0292909
6-29910636-G-A p.Arg59Gln missense HLA-A 96 82670 0.00116124 41335 0 0.00213485
6-29910640-C-T p.Phe60Phe synonymous HLA-A 5892 81910 0.0719326 40955 216 0.0791367
6-29910640-C-G p.Phe60Leu missense HLA-A 2 82660 2.41955E-5 41330 0 1.9984E-5
6-29910646-C-A p.Ser62Arg missense HLA-A 1 82630 1.21021E-5 41315 0 8.32723E-6
6-29910654-C-A p.Ala65Glu missense HLA-A 1 82602 1.21062E-5 41301 0 3.18654E-5
6-29910660-A-G p.Gln67Arg missense HLA-A 1809 82592 0.0219028 41296 29 0.0411946
6-29910663-G-A p.Arg68Lys missense HLA-A 10385 82232 0.126289 41116 773 0.122039
6-29910671-C-T p.Pro71Ser missense HLA-A 9 82782 1.08719E-4 41391 0 2.23115E-4
6-29910673-G-C p.Pro71Pro synonymous HLA-A 1 82652 1.20989E-5 41326 0 NA
6-29910679-G-A p.Ala73Ala synonymous HLA-A 2757 82450 0.0334384 41225 51 0.0273196
6-29910681-C-T p.Pro74Leu missense HLA-A 3 82746 3.62555E-5 41373 0 2.32875E-4
6-29910681-C-A p.Pro74Gln missense HLA-A 1 82746 1.20852E-5 41373 0 NA
6-29910682-G-A p.Pro74Pro synonymous HLA-A 2 82644 2.42002E-5 41322 0 0.00154639
6-29910688-A-G p.Ile76Met missense HLA-A 3280 76728 0.0427484 38364 0 0.27193
6-29910693-A-G p.Gln78Arg missense HLA-A 73 81638 8.94191E-4 40819 0 0.186853
6-29910695-G-T p.Glu79* stop_gained HLA-A 1 82738 1.20863E-5 41369 0 NA
6-29910698-G-A p.Gly80Arg missense HLA-A 5600 82344 0.0680074 41172 103 0.104964
6-29910698-GG-AA p.Gly80Lys missense HLA-A 2 82718 2.41785E-5 41359 0 NA
6-29910699-G-A p.Gly80Glu missense HLA-A 4348 80024 0.0543337 40012 0 0.0687415
6-29910700-G-T p.Gly80Gly synonymous HLA-A 20101 81094 0.247873 40547 2380 0.267447
6-29910702-C-T p.Pro81Leu missense HLA-A 1 82672 1.2096E-5 41336 0 8.34516E-6
6-29910703-G-T p.Pro81Pro synonymous HLA-A 5614 82296 0.0682172 41148 109 0.107549
6-29910703-G-A p.Pro81Pro synonymous HLA-A 1 82662 1.20975E-5 41331 0 NA
6-29910715-C-CCGG p.Asp85_Gln86insArg disruptive_inframe_insertion HLA-A 10 82496 1.21218E-4 41248 0 4.18866E-4
6-29910716-C-G p.Gln86Glu missense HLA-A 22350 77160 0.289658 38580 5326 0.388616
6-29910716-CA-GG p.Gln86Gly missense HLA-A 6266 82340 0.0760991 41170 353 NA
6-29910716-CAGGAG-GGGAAC p.GlnGlu86GlyAsn missense HLA-A 4 82484 4.84943E-5 41242 0 NA
6-29910717-A-G p.Gln86Arg missense HLA-A 26308 80130 0.328316 40065 6613 0.44225
6-29910717-A-T p.Gln86Leu missense HLA-A 1980 82270 0.0240671 41135 47 0.0278265
6-29910717-AGGAG-GGAAC p.GlnGlu86ArgAsn missense HLA-A 1804 82314 0.0219161 41157 39 NA
6-29910717-AGG-TGC p.GlnGlu86LeuGln missense HLA-A 857 82332 0.0104091 41166 12 NA
6-29910717-AGG-GGA p.GlnGlu86ArgLys missense HLA-A 13 82346 1.5787E-4 41173 0 NA
6-29910717-AGG-GGC p.GlnGlu86ArgGln missense HLA-A 5 82330 6.07312E-5 41165 0 NA
6-29910718-G-GACA p.Gln86_Glu87insThr conservative_inframe_insertion HLA-A 6 82334 7.28739E-5 41167 0 4.36407E-4
6-29910719-GAG-AAC p.Glu87Asn missense HLA-A 1027 82350 0.0124712 41175 2 NA
6-29910719-G-A p.Glu87Lys missense HLA-A 8257 79518 0.103838 39759 639 0.171671
6-29910719-G-C p.Glu87Gln missense HLA-A 3448 79636 0.043297 39818 53 0.0584429
6-29910721-G-C p.Glu87Asp missense HLA-A 9348 81478 0.11473 40739 639 0.200624
6-29910722-A-ATCTCCAAGACCAACG p.Thr88delinsIleSerLysThrAsnAla disruptive_inframe_insertion HLA-A 2 82320 2.42954E-5 41160 0 4.199E-4
6-29910723-C-CAGAGATCTCCAAGACCA p.Arg89fs frameshift HLA-A 4 82232 4.86429E-5 41116 0 0.00212655
6-29910724-ACG-A p.Arg89fs frameshift HLA-A 2791 77794 0.0358768 38897 0 0.0426378
6-29910725-C-G p.Arg89Gly missense HLA-A 8585 78438 0.109449 39219 693 0.161935
6-29910726-G-A p.Arg89Gln missense HLA-A 13 82212 1.58128E-4 41106 0 0.00551874
6-29910727-GA-G p.Asn90fs frameshift HLA-A 19 82224 2.31076E-4 41112 0 0.00216769
6-29910727-G-GAGATCTCCAAGACC p.Asn90fs frameshift HLA-A 2 82280 2.43072E-5 41140 0 3.89507E-4
6-29910728-A-AG p.Asn90fs frameshift HLA-A 2607 77444 0.033663 38722 0 0.0428484
6-29910728-A-AGATCTCCAAGACC p.Asn90fs frameshift HLA-A 1 82242 1.21592E-5 41121 0 3.04234E-4
6-29910728-A-C p.Asn90His missense HLA-A 2 82254 2.43149E-5 41127 0 3.38455E-5
6-29910730-T-A p.Asn90Lys missense HLA-A 28584 76860 0.371897 38430 5788 0.434719
6-29910730-T-C p.Asn90Asn synonymous HLA-A 24 82264 2.91744E-4 41132 0 5.74283E-4
6-29910730-T-G p.Asn90Lys missense HLA-A 3 82278 3.64618E-5 41139 0 3.6531E-5
6-29910731-G-A p.Val91Met missense HLA-A 10374 81674 0.127017 40837 788 0.132845
6-29910731-G-C p.Val91Leu missense HLA-A 1850 76874 0.0240654 38437 0 0.0403828
6-29910732-T-TC p.Lys92fs frameshift HLA-A 2338 76846 0.0304245 38423 0 0.0434689
6-29910733-G-C p.Val91Val synonymous HLA-A 1840 75792 0.024277 37896 0 0.0431709
6-29910735-A-G p.Lys92Arg missense HLA-A 6 82152 7.30353E-5 41076 0 0.00209424
6-29910737-G-A p.Ala93Thr missense HLA-A 978 74110 0.0131966 37055 0 0.0421371
6-29910740-C-A p.Gln94Lys missense HLA-A 878 73936 0.0118751 36968 0 0.0414745
6-29910741-A-G p.Gln94Arg missense HLA-A 1 81992 1.21963E-5 40996 0 8.43341E-6
6-29910742-G-C p.Gln94His missense HLA-A 55120 78294 0.704013 39147 19395 0.701262
6-29910742-GT-CG p.GlnSer94HisAla missense HLA-A 1 81968 1.21999E-5 40984 0 NA
6-29910743-T-G p.Ser95Ala missense HLA-A 1163 74594 0.0155911 37297 0 0.0408318
6-29910750-C-T p.Thr97Ile missense HLA-A 5030 77602 0.0648179 38801 228 0.0988736
6-29910750-CTG-TTC p.ThrAsp97IleHis missense HLA-A 1 81828 1.22208E-5 40914 0 NA
6-29910750-C-A p.Thr97Asn missense HLA-A 1 81830 1.22205E-5 40915 0 NA
6-29910752-G-C p.Asp98His missense HLA-A 20269 80508 0.251764 40254 2699 0.269803
6-29910752-G-A p.Asp98Asn missense HLA-A 103 81760 0.00125978 40880 0 0.00223084
6-29910752-G-T p.Asp98Tyr missense HLA-A 1 81760 1.22309E-5 40880 0 8.5473E-6
6-29910755-C-CTA p.Arg99fs frameshift HLA-A 678 74144 0.00914437 37072 0 0.0352171
6-29910755-C-CGAGA p.Val100fs frameshift HLA-A 1 81674 1.22438E-5 40837 0 NA
6-29910757-A-C p.Arg99Arg synonymous HLA-A 1 81626 1.2251E-5 40813 0 NA
6-29910759-T-C p.Val100Ala missense HLA-A 9798 79816 0.122757 39908 1283 0.266228
6-29910759-T-A p.Val100Glu missense HLA-A 12683 73596 0.172333 36798 1253 0.297956
6-29910759-TGG-CGA p.ValAsp100AlaAsn missense HLA-A 6555 80210 0.081723 40105 597 NA
6-29910759-TGG-AGA p.ValAsp100GluAsn missense HLA-A 942 80266 0.011736 40133 31 NA
6-29910759-TGGA-AGAG p.ValAsp100GluSer missense HLA-A 272 80356 0.00338494 40178 1 NA
6-29910759-TGGAC-T p.Asp101fs frameshift HLA-A 1 80374 1.24418E-5 40187 0 NA
6-29910760-GGA-G p.Asp101fs frameshift HLA-A 858 73718 0.0116389 36859 0 0.0321317
6-29910761-G-A p.Asp101Asn missense HLA-A 21846 77066 0.283471 38533 5367 0.431559
6-29910761-GA-AG p.Asp101Ser missense HLA-A 1 80242 1.24623E-5 40121 0 NA
6-29910762-A-G p.Asp101Gly missense HLA-A 2551 78536 0.0324819 39268 67 0.0570342
6-29910767-G-C p.Gly103Arg missense HLA-A 10884 69858 0.155802 34929 811 0.224937
6-29910768-G-C p.Gly103Ala missense HLA-A 22 80062 2.74787E-4 40031 0 0.00268817
6-29910770-ACCC-A p.Thr104_Leu105delinsMet disruptive_inframe_deletion HLA-A 11481 71842 0.159809 35921 846 0.186209
6-29910770-A-ATCG p.Thr104delinsIleAla disruptive_inframe_insertion HLA-A 3 79944 3.75263E-5 39972 0 3.85908E-4
6-29910770-A-ATCGCGCT p.Thr104fs frameshift HLA-A 1 79950 1.25078E-5 39975 0 5.31696E-4
6-29910771-C-T p.Thr104Ile missense HLA-A 5 79954 6.2536E-5 39977 0 0.00138406
6-29910772-C-G p.Thr104Thr synonymous HLA-A 7 79946 8.75591E-5 39973 0 0.0016
6-29910772-CCT-C p.Leu105fs frameshift HLA-A 2 79940 2.50188E-5 39970 0 0.0010594
6-29910774-TG-T p.Arg106fs frameshift HLA-A 11436 71924 0.159001 35962 831 0.19445
6-29910775-G-C p.Leu105Leu synonymous HLA-A 1 79896 1.25163E-5 39948 0 5.36716E-4
6-29910777-G-GCT p.Gly107fs frameshift HLA-A 2 79864 2.50426E-5 39932 0 2.73986E-4
6-29910779-G-GCTCC p.Gly107fs frameshift HLA-A 11633 71752 0.162128 35876 867 0.194037
6-29910782-T-A p.Tyr108Asn missense HLA-A 1 81040 1.23396E-5 40520 0 NA
6-29910791-C-G p.Gln111Glu missense HLA-A 1 81132 1.23256E-5 40566 0 3.19448E-5
6-29910799-G-A p.Glu113Glu synonymous HLA-A 1 80974 1.23496E-5 40487 0 3.19366E-5
6-29910799-GGC-TGA p.GluAla113AspAsp missense+splice_region HLA-A 1 80976 1.23493E-5 40488 0 NA
6-29910799-GGC-AGA p.GluAla113GluAsp missense+splice_region HLA-A 1 80976 1.23493E-5 40488 0 NA
6-29910801-C-A p.Ala114Asp missense+splice_region HLA-A 20636 74640 0.276474 37320 2850 0.313602
6-29910802-C-T p.Ala114Ala splice_region+synonymous HLA-A 1 80896 1.23616E-5 40448 0 1.2453E-5
6-29910803-G-T p.Gly115Cys missense+splice_region HLA-A 1 80892 1.23622E-5 40446 0 1.75184E-5
6-29911035-T-TCCCATGACAGATGCAAAATGC c.344-9_344-8insCCATGACAGATGCAAAATGCC splice_region HLA-A 1 75234 1.32919E-5 37617 0 3.19939E-5
6-29911035-T-TCCCATGACAGATGCAAAATGCCTGAATTTTCTGACTCTTCC c.344-9_344-8insCCATGACAGATGCAAAATGCCTGAATTTTCTGACTCTTCCC splice_region HLA-A 5 75136 6.6546E-5 37568 0 3.19939E-5
6-29911035-T-TCCCATGA c.344-9_344-8insCCATGAC splice_region HLA-A 2 75250 2.65781E-5 37625 0 6.39877E-5
6-29911035-TCG-GCC c.344-10_344-8delTCGinsGCC splice_region HLA-A 2 75256 2.6576E-5 37628 1 NA
6-29911036-C-CCCATGACAGATGCAAAATGCCTGAATTTTCTGACTCTTCCCGTCA c.344-9_344-8insCCATGACAGATGCAAAATGCCTGAATTTTCTGACTCTTCCCGTCA splice_region HLA-A 8 75662 1.05733E-4 37831 0 2.64669E-5
6-29911036-C-CCCATGACAGATGCAAAATGCCTGAATTTTCTGACTCTTCCCGTCAGACCCCCCCCCAA c.344-9_344-8insCCATGACAGATGCAAAATGCCTGAATTTTCTGACTCTTCCCGTCAGACCCCCCCCCAA splice_region HLA-A 3 75738 3.96102E-5 37869 0 1.42721E-5
6-29911036-C-CCCATGACAGAT c.344-9_344-8insCCATGACAGAT splice_region HLA-A 1 75930 1.317E-5 37965 0 9.65189E-5
6-29911036-C-CCCATGACAGATGCAAAATGCCT c.344-9_344-8insCCATGACAGATGCAAAATGCCT splice_region HLA-A 1 75908 1.31738E-5 37954 0 3.2173E-5
6-29911036-CGGGG-C c.344-8_344-5delGGGG splice_region HLA-A 2 75918 2.63442E-5 37959 0 3.2173E-5
6-29911036-C-CCCATGACA c.344-9_344-8insCCATGACA splice_region HLA-A 2 75914 2.63456E-5 37957 0 NA
6-29911036-C-CCCATGACAGATGCAAAATGCCTGAATTTTCTGACTCTTCCCGTCAGACCCCCCCGCAA c.344-9_344-8insCCATGACAGATGCAAAATGCCTGAATTTTCTGACTCTTCCCGTCAGACCCCCCCGCAA splice_region HLA-A 1 75934 1.31693E-5 37967 0 NA
6-29911037-G-C c.344-8G>C splice_region HLA-A 25337 73144 0.346399 36572 4584 0.392855
6-29911038-G-A c.344-7G>A splice_region HLA-A 36 75698 4.75574E-4 37849 0 0.01
6-29911038-G-T c.344-7G>T splice_region HLA-A 1 75710 1.32083E-5 37855 0 NA
6-29911044-G-T c.344-1G>T splice_acceptor HLA-A 3 76642 3.9143E-5 38321 0 NA
6-29911047-T-A p.Ser116Thr missense+splice_region HLA-A 1 76980 1.29904E-5 38490 0 0.00125
6-29911052-C-T p.His117His synonymous HLA-A 1 77464 1.29092E-5 38732 0 3.2774E-5
6-29911054-CCA-TCG p.ThrIle118IleVal missense HLA-A 1 77632 1.28813E-5 38816 0 NA
6-29911054-CCA-ACG p.ThrIle118AsnVal missense HLA-A 1 77632 1.28813E-5 38816 0 NA
6-29911056-A-G p.Ile119Val missense HLA-A 16238 76168 0.213187 38084 2041 0.252572
6-29911056-A-C p.Ile119Leu missense HLA-A 11332 76672 0.147798 38336 1052 0.221816
6-29911060-A-T n.178-2A>T splice_acceptor HLA-A 2 77970 2.56509E-5 38985 0 NA
6-29911063-T-G p.Ile121Arg missense HLA-A 17936 76224 0.235306 38112 3196 0.340307
6-29911063-TA-GG p.Ile121Arg missense HLA-A 5813 77426 0.0750781 38713 893 NA
6-29911063-TA-AG p.Ile121Lys missense HLA-A 1 77962 1.28268E-5 38981 0 NA
6-29911063-T-A p.Ile121Lys missense HLA-A 5 77962 6.41338E-5 38981 0 8.18465E-5
6-29911064-A-G p.Ile121Met missense HLA-A 40800 75142 0.542972 37571 14246 0.625629
6-29911068-T-C p.Tyr123His missense HLA-A 27 78682 3.43153E-4 39341 0 0.00276855
6-29911069-A-T p.Tyr123Phe missense HLA-A 9878 77976 0.12668 38988 775 0.16359
6-29911069-A-G p.Tyr123Cys missense HLA-A 105 78786 0.00133272 39393 3 0.00543339
6-29911069-A-C p.Tyr123Ser missense HLA-A 46 78792 5.83816E-4 39396 0 2.13799E-4
6-29911073-C-T p.Gly124Gly synonymous HLA-A 1 78968 1.26634E-5 39484 0 4.03633E-4
6-29911077-G-C p.Asp126His missense HLA-A 373 79030 0.00471973 39515 7 0.0179348
6-29911086-T-C p.Ser129Pro missense HLA-A 24319 77808 0.312551 38904 4169 0.364375
6-29911086-T-G p.Ser129Ala missense HLA-A 1 79210 1.26247E-5 39605 0 NA
6-29911092-G-T p.Gly131Trp missense HLA-A 18894 77484 0.243844 38742 2545 0.271209
6-29911096-G-A p.Arg132His missense HLA-A 1 79616 1.25603E-5 39808 0 5.61619E-5
6-29911098-T-C p.Phe133Leu missense HLA-A 3237 79534 0.0406996 39767 91 0.0664147
6-29911103-C-G p.Leu134Leu synonymous HLA-A 1638 79566 0.0205867 39783 38 0.029375
6-29911105-G-A p.Arg135His missense HLA-A 3 79762 3.76119E-5 39881 0 3.18918E-5
6-29911108-G-A p.Gly136Glu missense HLA-A 1 79816 1.25288E-5 39908 0 4.18456E-6
6-29911110-T-TATG p.Tyr137_Arg138insAsp disruptive_inframe_insertion HLA-A 1 79576 1.25666E-5 39788 0 2.72541E-4
6-29911111-ACC-A p.Tyr137fs frameshift HLA-A 3597 79516 0.0452362 39758 149 0.0511313
6-29911114-G-A p.Arg138Gln missense HLA-A 38397 77526 0.495279 38763 12335 0.586933
6-29911114-G-T p.Arg138Leu missense HLA-A 3485 79060 0.0440804 39530 168 0.130435
6-29911114-GG-AC p.Arg138His missense HLA-A 4984 78904 0.0631654 39452 202 NA
6-29911115-G-C p.Arg138Arg synonymous HLA-A 22591 74704 0.302407 37352 5975 0.409784
6-29911115-G-GAA p.Gln139fs frameshift HLA-A 2177 79252 0.0274693 39626 167 0.051561
6-29911119-G-T p.Asp140Tyr missense HLA-A 30636 77194 0.39687 38597 6345 0.409679
6-29911119-G-C p.Asp140His missense HLA-A 3419 78972 0.0432938 39486 168 0.0924855
6-29911119-G-A p.Asp140Asn missense HLA-A 6 79436 7.55325E-5 39718 0 3.69956E-4
6-29911119-GA-TT p.Asp140Phe missense HLA-A 1 79436 1.25888E-5 39718 0 NA
6-29911120-A-T p.Asp140Val missense HLA-A 11 79494 1.38375E-4 39747 0 3.82726E-4
6-29911120-A-C p.Asp140Ala missense HLA-A 1 79498 1.25789E-5 39749 0 8.28837E-6
6-29911120-A-G p.Asp140Gly missense HLA-A 1 79498 1.25789E-5 39749 0 NA
6-29911121-C-T p.Asp140Asp synonymous HLA-A 4 79466 5.0336E-5 39733 0 5.38793E-4
6-29911124-C-T p.Ala141Ala synonymous HLA-A 5469 79300 0.0689659 39650 218 0.0678149
6-29911130-C-A p.Asp143Glu missense HLA-A 1 79706 1.25461E-5 39853 0 8.9962E-6
6-29911146-G-C p.Ala149Pro missense HLA-A 1 79788 1.25332E-5 39894 0 NA
6-29911146-G-T p.Ala149Ser missense HLA-A 3 79786 3.76006E-5 39893 0 3.18735E-5
6-29911149-C-T p.Leu150Leu synonymous HLA-A 10405 79308 0.131197 39654 790 0.151499
6-29911154-C-A p.Asn151Lys missense HLA-A 33213 76560 0.433817 38280 7748 0.454001
6-29911157-G-A p.Glu152Glu synonymous HLA-A 5 79810 6.26488E-5 39905 0 6.09162E-5
6-29911160-C-T p.Asp153Asp synonymous HLA-A 1 79748 1.25395E-5 39874 0 NA
6-29911164-C-A p.Arg155Ser missense HLA-A 1 79584 1.25653E-5 39792 0 0.011242
6-29911169-T-C p.Ser156Ser synonymous HLA-A 1 79572 1.25672E-5 39786 0 0.00588865
6-29911178-G-A p.Ala159Ala synonymous HLA-A 12 79306 1.51313E-4 39653 0 5.35332E-4
6-29911189-C-T p.Ala163Val missense HLA-A 1 79034 1.26528E-5 39517 0 4.0849E-6
6-29911190-G-A p.Ala163Ala synonymous HLA-A 37929 76270 0.497299 38135 9891 0.531995
6-29911198-T-C p.Ile166Thr missense HLA-A 21152 72814 0.290494 36407 3504 0.330408
6-29911199-C-T p.Ile166Ile synonymous HLA-A 3 78572 3.81815E-5 39286 0 1.66635E-4
6-29911203-A-C p.Lys168Gln missense HLA-A 21626 77102 0.280486 38551 3582 0.345123
6-29911203-A-G p.Lys168Glu missense HLA-A 7 78598 8.90608E-5 39299 0 6.83013E-5
6-29911205-G-C p.Lys168Asn missense HLA-A 1 78558 1.27294E-5 39279 0 4.08851E-6
6-29911207-G-A p.Arg169His missense HLA-A 20024 71494 0.280079 35747 2991 0.321126
6-29911216-A-T p.Glu172Val missense HLA-A 1 78596 1.27233E-5 39298 0 NA
6-29911218-G-A p.Ala173Thr missense HLA-A 5330 77932 0.068393 38966 182 0.0665951
6-29911219-C-T p.Ala173Val missense HLA-A 7 78346 8.93473E-5 39173 0 0.00161117
6-29911220-G-T p.Ala173Ala synonymous HLA-A 1 78458 1.27457E-5 39229 0 NA
6-29911222-C-T p.Ala174Val missense HLA-A 8701 76516 0.113715 38258 318 0.11875
6-29911225-A-G p.His175Arg missense HLA-A 13696 73518 0.186295 36759 1747 0.262084
6-29911225-ATG-GTT p.HisGlu175* stop_gained HLA-A 4 78476 5.0971E-5 39238 0 NA
6-29911225-ATG-GTC p.HisGlu175ArgGln missense HLA-A 9 78474 1.14688E-4 39237 0 NA
6-29911225-ATGA-GTTG p.HisGlu175ArgTrp missense HLA-A 2 78476 2.54855E-5 39238 0 NA
6-29911225-ATGA-GTCG p.HisGlu175ArgArg missense HLA-A 2 78476 2.54855E-5 39238 0 NA
6-29911227-G-T p.Glu176* stop_gained HLA-A 1509 77722 0.0194154 38861 28 0.0449367
6-29911227-G-C p.Glu176Gln missense HLA-A 1211 77722 0.0155812 38861 40 0.0242858
6-29911227-GA-TG p.Glu176Trp missense HLA-A 1 78512 1.27369E-5 39256 0 NA
6-29911227-GA-CG p.Glu176Arg missense HLA-A 1 78512 1.27369E-5 39256 0 NA
6-29911228-A-T p.Glu176Val missense HLA-A 39232 71948 0.545283 35974 10427 0.783101
6-29911228-A-C p.Glu176Ala missense HLA-A 12834 75882 0.169131 37941 962 0.591803
6-29911228-A-G p.Glu176Gly missense HLA-A 3316 78206 0.0424008 39103 139 0.267647
6-29911230-G-A p.Ala177Thr missense HLA-A 1 78578 1.27262E-5 39289 0 NA
6-29911232-G-A p.Ala177Ala synonymous HLA-A 1 78548 1.27311E-5 39274 0 3.52429E-4
6-29911239-T-C p.Leu180Leu synonymous HLA-A 18142 66162 0.274206 33081 3309 0.456875
6-29911239-TT-CA p.Leu180Gln missense HLA-A 1179 78180 0.0150806 39090 34 NA
6-29911239-TT-CG p.Leu180Arg missense HLA-A 230 78244 0.00293952 39122 2 NA
6-29911240-T-G p.Leu180Trp missense HLA-A 18905 76660 0.246608 38330 1744 0.367328
6-29911240-T-A p.Leu180* stop_gained HLA-A 12644 74878 0.168861 37439 1220 0.446738
6-29911243-G-C p.Arg181Thr missense HLA-A 1 78684 1.27091E-5 39342 0 0.0025
6-29911243-G-A p.Arg181Lys missense HLA-A 2 78688 2.54168E-5 39344 0 NA
6-29911246-C-T p.Ala182Val missense HLA-A 8423 76614 0.109941 38307 87 0.113125
6-29911248-T-C p.Tyr183His missense HLA-A 7 78766 8.88708E-5 39383 0 3.18715E-5
6-29911251-C-A p.Leu184Met missense HLA-A 1 78856 1.26813E-5 39428 0 3.18573E-5
6-29911253-G-A p.Leu184Leu synonymous HLA-A 2 78782 2.53865E-5 39391 0 0.00625
6-29911254-G-C p.Asp185His missense HLA-A 1 78888 1.26762E-5 39444 0 4.09115E-6
6-29911256-T-G p.Asp185Glu missense HLA-A 67586 76032 0.888915 38016 30204 0.892473
6-29911259-CA-C p.Thr187fs frameshift HLA-A 2 78580 2.54518E-5 39290 0 1.38927E-4
6-29911260-A-C p.Thr187Pro missense HLA-A 14839 75292 0.197086 37646 664 0.26625
6-29911260-AC-CG p.Thr187Arg missense HLA-A 804 78542 0.0102366 39271 33 NA
6-29911260-A-G p.Thr187Ala missense HLA-A 204 78548 0.00259714 39274 0 0.00353243
6-29911260-AC-GA p.Thr187Glu missense HLA-A 7 78614 8.90427E-5 39307 0 NA
6-29911261-C-G p.Thr187Arg missense HLA-A 15333 75672 0.202624 37836 934 0.27375
6-29911261-C-A p.Thr187Lys missense HLA-A 212 78598 0.00269727 39299 0 0.00357236
6-29911265-C-T p.Cys188Cys synonymous HLA-A 1 79012 1.26563E-5 39506 0 NA
6-29911266-G-A p.Val189Met missense HLA-A 57 79166 7.20006E-4 39583 0 1.91083E-4
6-29911266-G-C p.Val189Leu missense HLA-A 1 79174 1.26304E-5 39587 0 8.17147E-6
6-29911267-T-A p.Val189Glu missense HLA-A 6 79032 7.59186E-5 39516 0 0.01375
6-29911271-G-C p.Glu190Asp missense HLA-A 15071 76408 0.197244 38204 710 0.241875
6-29911271-GT-CG p.GluTrp190AspGly missense HLA-A 1507 79126 0.0190456 39563 110 NA
6-29911272-T-G p.Trp191Gly missense HLA-A 15089 76448 0.197376 38224 702 0.245403
6-29911272-T-A p.Trp191Arg missense HLA-A 13 78954 1.64653E-4 39477 0 0.0189613
6-29911275-C-T p.Leu192Phe missense HLA-A 1 79236 1.26205E-5 39618 0 NA
6-29911284-T-C p.Tyr195His missense HLA-A 1099 79218 0.0138731 39609 2 0.101822
6-29911287-C-T p.Leu196Leu synonymous HLA-A 1 79412 1.25926E-5 39706 0 4.08463E-6
6-29911292-G-A p.Glu197Glu synonymous HLA-A 1 79484 1.25811E-5 39742 0 NA
6-29911296-G-A p.Gly199Arg missense HLA-A 4255 63936 0.0665509 31968 0 0.206875
6-29911296-G-C p.Gly199Arg missense HLA-A 1 79552 1.25704E-5 39776 0 1.25083E-4
6-29911302-G-A p.Glu201Lys missense HLA-A 5 79690 6.27431E-5 39845 0 0.003125
6-29911306-C-T p.Thr202Met missense HLA-A 4477 64496 0.0694152 32248 0 0.199769
6-29911307-G-A p.Thr202Thr synonymous HLA-A 320 77588 0.00412435 38794 0 0.063125
6-29911310-G-C p.Leu203Leu synonymous HLA-A 1 79540 1.25723E-5 39770 0 NA
6-29911317-A-G p.Thr206Ala missense HLA-A 8 79442 1.00702E-4 39721 0 0.129968
6-29911318-CG-C p.Leu203fs frameshift HLA-A 131 78380 0.00167134 39190 0 0.0327605
6-29911319-G-T p.Thr206Thr splice_region+synonymous HLA-A 10483 49382 0.212284 24691 3 0.404455
6-29911320-G-T p.Asp207Tyr missense+splice_region HLA-A 133 78388 0.00169669 39194 0 0.0525
6-29911320-G-A p.Asp207Asn missense+splice_region HLA-A 1 79648 1.25552E-5 39824 0 3.36338E-5
6-29911326-A-G c.619+6A>G splice_region HLA-A 2278 78736 0.0289321 39368 0 0.0251246
6-29911327-G-A c.619+7G>A splice_region HLA-A 3 79634 3.76724E-5 39817 0 1.72945E-5
6-29911893-C-T c.620-6C>T splice_region HLA-A 17158 49206 0.348697 24603 2622 0.460712
6-29911893-CGT-TGA c.620-6_620-4delCGTinsTGA splice_region HLA-A 5 81242 6.15445E-5 40621 0 NA
6-29911894-G-T c.620-5G>T splice_region HLA-A 11 81260 1.35368E-4 40630 1 3.18837E-4
6-29911895-T-A c.620-4T>A splice_region HLA-A 8085 42514 0.190173 21257 62 0.382161
6-29911899-A-AC p.Lys210fs frameshift HLA-A 4 81338 4.91775E-5 40669 0 2.4401E-5
6-29911899-A-ACC p.Lys210fs frameshift HLA-A 78 79760 9.77934E-4 39880 0 0.00259431
6-29911899-AC-A p.Lys210fs frameshift HLA-A 2 81344 2.45869E-5 40672 0 8.46196E-6
6-29911901-C-G p.Pro208Ala missense+splice_region HLA-A 4861 40412 0.120286 20206 13 0.34845
6-29911908-A-G p.Lys210Arg missense HLA-A 326 79990 0.00407551 39995 0 0.01625
6-29911909-G-A p.Lys210Lys synonymous HLA-A 3100 52120 0.0594781 26060 5 0.265048
6-29911912-A-G p.Thr211Thr synonymous HLA-A 6238 38388 0.162499 19194 21 0.380524
6-29911913-C-T p.His212Tyr missense HLA-A 1 81426 1.22811E-5 40713 0 8.46482E-6
6-29911918-G-A p.Met213Ile missense HLA-A 1 81446 1.22781E-5 40723 0 NA
6-29911921-C-T p.Thr214Thr synonymous HLA-A 6687 38812 0.172292 19406 18 0.379658
6-29911924-C-T p.His215His synonymous HLA-A 3 81426 3.68433E-5 40713 0 2.79509E-4
6-29911925-C-T p.His216Tyr missense HLA-A 1048 75176 0.0139406 37588 2 0.0796359
6-29911928-C-G p.Pro217Ala missense HLA-A 6960 39070 0.178142 19535 20 0.380368
6-29911928-CCCA-GCTG p.ProIle217AlaVal missense HLA-A 5 81368 6.14492E-5 40684 0 NA
6-29911930-C-T p.Pro217Pro synonymous HLA-A 6885 39074 0.176204 19537 17 0.380758
6-29911931-A-G p.Ile218Val missense HLA-A 6957 39340 0.176843 19670 20 0.380622
6-29911940-C-A p.His221Asn missense HLA-A 15 81300 1.84502E-4 40650 0 1.27567E-4
6-29911945-G-A p.Glu222Glu synonymous HLA-A 3596 51720 0.0695282 25860 10 0.266164
6-29911949-A-G p.Thr224Ala missense HLA-A 1 81244 1.23086E-5 40622 0 4.05482E-6
6-29911951-C-T p.Thr224Thr synonymous HLA-A 8379 76722 0.109212 38361 718 0.15875
6-29911957-G-A p.Arg226Arg synonymous HLA-A 8352 76792 0.108761 38396 698 0.15875
6-29911959-GC-G p.Trp228fs frameshift HLA-A 1 81050 1.23381E-5 40525 0 NA
6-29911963-G-A p.Trp228* stop_gained HLA-A 16 80834 1.97937E-4 40417 0 1.59826E-4
6-29911970-G-A p.Gly231Ser missense HLA-A 3291 32220 0.102142 16110 178 0.418407
6-29911983-C-T p.Ala235Val missense HLA-A 1 80412 1.2436E-5 40206 0 2.83112E-5
6-29911994-C-G p.Leu239Val missense HLA-A 1 80208 1.24676E-5 40104 0 NA
6-29912006-C-T p.Arg243Trp missense HLA-A 2 79966 2.50106E-5 39983 0 3.40861E-5
6-29912007-G-A p.Arg243Gln missense HLA-A 4 79984 5.001E-5 39992 0 9.37734E-5
6-29912007-G-C p.Arg243Pro missense HLA-A 1 80010 1.24984E-5 40005 0 4.04374E-6
6-29912021-C-T p.Gln248* stop_gained HLA-A 1 79960 1.25063E-5 39980 0 3.19673E-5
6-29912023-G-A p.Gln248Gln synonymous HLA-A 1 79970 1.25047E-5 39985 0 4.1216E-6
6-29912027-CAGG-C p.Gln250_Asp251delinsHis disruptive_inframe_deletion HLA-A 19 79896 2.37809E-4 39948 0 7.08454E-4
6-29912028-AG-A p.Asp251fs frameshift HLA-A 14690 53592 0.274108 26796 1 0.422067
6-29912030-G-C p.Asp251His missense HLA-A 200 24292 0.00823316 12146 0 0.422373
6-29912032-C-CAT p.Thr252fs frameshift HLA-A 17 79888 2.12798E-4 39944 0 6.72135E-4
6-29912034-C-T p.Thr252Met missense HLA-A 6 79956 7.50413E-5 39978 0 1.78599E-4
6-29912034-C-CAT p.Glu253fs frameshift HLA-A 1 79980 1.25031E-5 39990 0 8.5047E-6
6-29912036-G-A p.Glu253Lys missense HLA-A 1 80028 1.24956E-5 40014 0 NA
6-29912041-C-T p.Leu254Leu synonymous HLA-A 7178 63866 0.112392 31933 626 0.221942
6-29912042-G-A p.Val255Met missense HLA-A 19 58532 3.24609E-4 29266 0 0.22825
6-29912050-C-T p.Thr257Thr synonymous HLA-A 1 80168 1.24738E-5 40084 0 1.21173E-5
6-29912058-C-A p.Ala260Glu missense HLA-A 5 80314 6.22556E-5 40157 0 0.00251256
6-29912059-AGGGGATG-A p.Gly261fs frameshift HLA-A 1 80398 1.24381E-5 40199 0 8.55373E-5
6-29912061-G-A p.Gly261Glu missense HLA-A 1 80478 1.24258E-5 40239 0 NA
6-29912068-A-G p.Gly263Gly synonymous HLA-A 1230 73460 0.0167438 36730 0 0.0600751
6-29912070-C-T p.Thr264Ile missense HLA-A 17 80692 2.10678E-4 40346 0 5.44662E-4
6-29912085-C-T p.Ala269Val missense HLA-A 1378 75582 0.0182319 37791 1 0.0620915
6-29912086-G-A p.Ala269Ala synonymous HLA-A 9136 78328 0.116638 39164 712 0.16
6-29912087-G-T p.Ala270Ser missense HLA-A 4613 54824 0.084142 27412 107 0.247277
6-29912094-T-C p.Val272Ala missense HLA-A 1 81238 1.23095E-5 40619 0 4.01352E-6
6-29912098-G-A p.Val273Val synonymous HLA-A 9542 79132 0.120583 39566 700 0.159375
6-29912108-G-C p.Glu277Gln missense HLA-A 11230 38024 0.29534 19012 1147 0.471286
6-29912108-G-A p.Glu277Lys missense HLA-A 34 81340 4.17999E-4 40670 0 0.00232447
6-29912114-C-A p.Gln279Lys missense HLA-A 81 81518 9.93646E-4 40759 0 0.00217865
6-29912147-C-T p.Leu290Leu synonymous HLA-A 17749 72036 0.246391 36018 1362 0.303421
6-29912149-G-C p.Leu290Leu synonymous HLA-A 3479 80146 0.0434083 40073 1 0.06625
6-29912149-G-GC p.Lys292fs frameshift HLA-A 1 81940 1.22041E-5 40970 0 4.13192E-6
6-29912152-C-A p.Pro291Pro synonymous HLA-A 2 79430 2.51794E-5 39715 0 0.0337323
6-29912153-A-G p.Lys292Glu missense HLA-A 77 79154 9.72787E-4 39577 0 0.0413493
6-29912172-GGGGTAAGGAGGGAGATGGGGGTGTCATGTCTCTTAGGGAAAGCA-G p.Trp298fs frameshift HLA-A 1 81924 1.22064E-5 40962 0 NA
6-29912173-GGGTAAGGAGGGAGATGGGGGTGTCATGTCTCTTAGGGAAAGCAGGAGCCTCTCTGGAGACCTTTAGCAGGGTCAGGGCCCCTCACCTTCCCCTCTTTTCCCA-G p.Val299fs frameshift HLA-A 1 81920 1.2207E-5 40960 0 NA
6-29912179-G-A c.895+5G>A splice_region HLA-A 43 81902 5.25018E-4 40951 0 1.43948E-4
6-29912181-A-C c.895+7A>C splice_region HLA-A 1 81870 1.22145E-5 40935 0 NA
6-29912222-CTCTCTGGAGACCTTTAGCAGGGTCAGGGCCCCTCACCTTCCCCTCTTTTCCCAGAGCT-C p.Glu299fs frameshift HLA-A 1 81720 1.22369E-5 40860 0 NA
6-29912280-T-C p.Leu300Pro missense HLA-A 51235 77908 0.657635 38954 16857 0.660941
6-29912280-TG-CA p.Leu300Pro missense HLA-A 39 81636 4.7773E-4 40818 1 NA
6-29912280-T-A p.Leu300Gln missense HLA-A 2 81640 2.44978E-5 40820 0 8.45466E-6
6-29912281-G-A p.Leu300Leu synonymous HLA-A 10002 80360 0.124465 40180 732 0.159375
6-29912290-G-T p.Gln303His missense HLA-A 54 81624 6.6157E-4 40812 0 1.94553E-4
6-29912292-C-T p.Pro304Leu missense HLA-A 1 81634 1.22498E-5 40817 0 4.03008E-6
6-29912296-C-T p.Thr305Thr synonymous HLA-A 1 81652 1.22471E-5 40826 0 NA
6-29912297-A-G p.Ile306Val missense HLA-A 10059 80604 0.124795 40302 727 0.159375
6-29912301-C-A p.Pro307His missense HLA-A 2340 81388 0.0287512 40694 63 0.0456026
6-29912304-T-C p.Ile308Thr missense HLA-A 7 81642 8.57402E-5 40821 0 9.55597E-5
6-29912305-C-T p.Ile308Ile synonymous HLA-A 109 81642 0.0013351 40821 0 0.00219801
6-29912308-G-C p.Val309Val synonymous HLA-A 4 81654 4.89872E-5 40827 0 5.42888E-4
6-29912312-A-C p.Ile311Leu missense HLA-A 1 81646 1.2248E-5 40823 0 NA
6-29912315-A-C p.Ile312Leu missense HLA-A 7599 80522 0.0943717 40261 7 0.130694
6-29912326-G-A p.Leu315Leu synonymous HLA-A 7424 76924 0.0965108 38462 177 0.1375
6-29912328-T-C p.Val316Ala missense HLA-A 1 81658 1.22462E-5 40829 0 NA
6-29912330-C-T p.Leu317Phe missense HLA-A 1 81676 1.22435E-5 40838 0 3.18756E-5
6-29912333-C-T p.Leu318Phe missense HLA-A 41273 78650 0.524768 39325 10603 0.530535
6-29912335-T-G p.Leu318Leu synonymous HLA-A 1 81678 1.22432E-5 40839 0 NA
6-29912342-G-A p.Val321Met missense HLA-A 2412 80066 0.0301251 40033 46 0.0575
6-29912345-A-T p.Ile322Phe missense HLA-A 7199 76734 0.0938176 38367 150 0.1375
6-29912345-A-G p.Ile322Val missense HLA-A 2 81662 2.44912E-5 40831 0 6.02887E-5
6-29912348-A-G p.Thr323Ala missense HLA-A 17536 78304 0.223948 39152 1491 0.2525
6-29912359-G-C p.Val326Val synonymous HLA-A 1 81596 1.22555E-5 40798 0 NA
6-29912363-G-C p.Ala328Pro missense HLA-A 1 81570 1.22594E-5 40785 0 NA
6-29912363-G-A p.Ala328Thr missense HLA-A 1 81570 1.22594E-5 40785 0 1.69601E-5
6-29912368-C-T p.Ala329Ala synonymous HLA-A 48228 75500 0.638781 37750 15161 0.649694
6-29912373-T-G p.Met331Arg missense HLA-A 6626 76226 0.0869257 38113 119 0.1375
6-29912377-G-C p.Trp332Cys missense HLA-A 2 81514 2.45357E-5 40757 0 NA
6-29912381-A-T p.Arg334Trp missense HLA-A 1 81470 1.22745E-5 40735 0 NA
6-29912382-G-A p.Arg334Lys missense HLA-A 102 81456 0.00125221 40728 0 0.0027115
6-29912386-G-C p.Lys335Asn missense HLA-A 9953 80508 0.123627 40254 593 0.159574
6-29912395-T-TGG p.Gly341fs frameshift HLA-A 7856 79530 0.0987803 39765 227 0.126195
6-29912398-A-G c.1012+5A>G splice_region HLA-A 29423 73224 0.401822 36612 4905 0.502465
6-29912398-A-T c.1012+5A>T splice_region HLA-A 5430 77050 0.0704737 38525 103 0.161606
6-29912398-A-C c.1012+5A>C splice_region HLA-A 1 81230 1.23107E-5 40615 0 NA
6-29912403-G-C p.Gly341Ala missense HLA-A 2 81180 2.46366E-5 40590 0 9.57148E-6
6-29912405-G-A p.Val342Met missense HLA-A 9618 78232 0.122942 39116 473 0.149649
6-29912410-G-A p.Lys343Lys splice_region+synonymous HLA-A 4676 80700 0.057943 40350 172 0.118881
6-29912411-G-T p.Asp344Tyr missense+splice_region HLA-A 4 81044 4.93559E-5 40522 0 8.91583E-5
6-29912413-TG-T c.1030+6delG splice_region HLA-A 41804 79748 0.524201 39874 10819 0.52971
6-29912419-C-G c.1030+8C>G splice_region HLA-A 1 80886 1.23631E-5 40443 0 8.73439E-6
6-29912830-T-C c.1031-6T>C splice_region HLA-A 65232 77658 0.839991 38829 27561 0.853324
6-29912836-A-T p.Asp344Val missense+splice_region HLA-A 85 80858 0.00105123 40429 0 0.00219871
6-29912837-T-C p.Asp344Asp splice_region+synonymous HLA-A 8 80898 9.889E-5 40449 0 1.27413E-4
6-29912841-A-G p.Lys346Glu missense HLA-A 2 80988 2.4695E-5 40494 0 1.27372E-4
6-29912850-A-T p.Ser349Cys missense HLA-A 1 81074 1.23344E-5 40537 0 NA
6-29912852-T-C p.Ser349Ser synonymous HLA-A 43001 65180 0.659727 32590 15573 0.661014
6-29912853-T-C p.Tyr350His missense HLA-A 1 81024 1.2342E-5 40512 0 3.9992E-6
6-29912856-A-T p.Thr351Ser missense HLA-A 49010 75214 0.651607 37607 16583 0.661053
6-29913007-C-T c.1064-4C>T splice_region HLA-A 270 83028 0.00325192 41514 3 0.01625
6-29913020-G-T p.Ser358Ile missense HLA-A 26 82996 3.13268E-4 41498 1 1.91107E-4
6-29913037-G-A p.Val364Met missense HLA-A 11763 78606 0.149645 39303 898 0.192553
6-29913042-C-T p.Ser365Ser synonymous HLA-A 73158 82266 0.889286 41133 32708 0.89734
6-29913221-T-C c.896-7T>C splice_region HLA-A 3 82102 3.65399E-5 41051 0 1.17465E-4
6-29913229-G-T p.Val299Val splice_region+synonymous HLA-A 1 81740 1.22339E-5 40870 0 1.201E-5