Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
19-42470762-A-G p.Leu1218Leu synonymous ATP1A3 1 79396 1.25951E-5 39698 0 6.56366E-6
19-42470774-C-T p.Gly1214Ser missense ATP1A3 39 79668 4.89532E-4 39834 0 7.32671E-4
19-42470774-C-A p.Gly1214Cys missense ATP1A3 1 79670 1.25518E-5 39835 0 NA
19-42470790-C-CG p.Ala1209fs frameshift ATP1A3 2 80156 2.49513E-5 40078 0 1.31284E-5
19-42470790-C-T p.Pro1208Pro synonymous ATP1A3 5 80160 6.23752E-5 40080 0 3.03288E-4
19-42470790-C-CGGG p.Pro1208dup disruptive_inframe_insertion ATP1A3 1 80160 1.2475E-5 40080 0 NA
19-42470791-G-A p.Pro1208Leu missense ATP1A3 18 80190 2.24467E-4 40095 1 0.00125471
19-42470793-G-A p.Pro1207Pro synonymous ATP1A3 63 80212 7.85419E-4 40106 0 0.00178344
19-42470802-G-A p.Pro1204Pro synonymous ATP1A3 1 80250 1.24611E-5 40125 0 6.55987E-6
19-42470810-A-G p.Leu1202Leu synonymous ATP1A3 1 80230 1.24642E-5 40115 0 NA
19-42470829-G-A p.Ala1195Ala synonymous ATP1A3 6 79962 7.50356E-5 39981 2 4.4717E-4
19-42470832-T-G p.Pro1194Pro synonymous ATP1A3 1 79872 1.252E-5 39936 0 NA
19-42470837-C-G p.Ala1193Pro missense ATP1A3 1 79530 1.25739E-5 39765 0 NA
19-42470838-G-A p.Pro1192Pro synonymous ATP1A3 2 79660 2.51067E-5 39830 0 1.97462E-5
19-42470839-G-A p.Pro1192Leu missense ATP1A3 4 79696 5.01907E-5 39848 0 1.27527E-4
19-42470842-G-A p.Pro1191Leu missense ATP1A3 9 79566 1.13114E-4 39783 0 0.00209809
19-42470851-A-G p.Leu1188Pro missense ATP1A3 1 79128 1.26378E-5 39564 0 NA
19-42470853-A-G p.Pro1187Pro synonymous ATP1A3 98 78998 0.00124054 39499 1 0.00252207
19-42470859-G-A p.Leu1185Leu synonymous ATP1A3 1 78562 1.27288E-5 39281 0 NA
19-42470861-G-A p.Leu1185Phe missense ATP1A3 8 78394 1.02049E-4 39197 0 1.91718E-4
19-42470891-G-A p.Leu1175Phe missense ATP1A3 3 70958 4.22785E-5 35479 0 3.42133E-5
19-42470902-G-A p.Pro1171Leu missense ATP1A3 2 65422 3.05708E-5 32711 0 6.9254E-6
19-42470924-C-A p.Ala1164Ser missense ATP1A3 2 54164 3.69249E-5 27082 0 3.29142E-5
19-42470927-G-C p.Leu1163Val missense ATP1A3 1 52662 1.8989E-5 26331 0 7.18897E-6
19-42470935-G-A p.Pro1160Leu missense ATP1A3 1 52148 1.91762E-5 26074 0 8.98796E-5
19-42470935-G-C p.Pro1160Arg missense ATP1A3 2 52148 3.83524E-5 26074 0 NA
19-42470940-C-T p.Pro1158Pro synonymous ATP1A3 2 48372 4.13462E-5 24186 0 1.12613E-4
19-42470941-G-A p.Pro1158Leu missense ATP1A3 1 49270 2.02963E-5 24635 0 1.29887E-4
19-42470953-T-G p.His1154Pro missense ATP1A3 4 46264 8.64603E-5 23132 0 0.00181724
19-42470953-T-C p.His1154Arg missense ATP1A3 1 46276 2.16095E-5 23138 0 1.61098E-5
19-42470956-A-G p.Leu1153Pro missense ATP1A3 8 46246 1.72988E-4 23123 0 0.00681537
19-42470962-T-G p.His1151Pro missense ATP1A3 29 48606 5.96634E-4 24303 0 0.12394
19-42470962-T-TG p.His1151fs frameshift ATP1A3 1 49238 2.03095E-5 24619 0 NA
19-42470983-A-G p.Leu1144Pro missense ATP1A3 360 55026 0.00654236 27513 3 0.0106888
19-42470995-C-A p.Ser1140Ile missense ATP1A3 1 55466 1.80291E-5 27733 0 NA
19-42470998-C-T p.Arg1139Lys missense ATP1A3 1 56068 1.78355E-5 28034 0 NA
19-42471000-C-A p.Gly1138Gly synonymous ATP1A3 3 56520 5.30786E-5 28260 0 5.7006E-5
19-42471004-C-T p.Gly1137Glu missense ATP1A3 1 56902 1.75741E-5 28451 0 6.64681E-6
19-42471005-C-CAGAATACAA p.Ser1136_Gly1137insLeuTyrSer conservative_inframe_insertion ATP1A3 1 57008 1.75414E-5 28504 0 1.32878E-5
19-42471005-C-A p.Gly1137Trp missense ATP1A3 1 57008 1.75414E-5 28504 0 1.99317E-5
19-42471008-A-G p.Ser1136Pro missense ATP1A3 2 57372 3.48602E-5 28686 0 0.00127065
19-42471012-C-G p.Leu1134Phe missense ATP1A3 1 57722 1.73244E-5 28861 0 NA
19-42471017-T-C p.Ile1133Val missense ATP1A3 7 58298 1.20073E-4 29149 0 6.35324E-4
19-42471020-G-T p.Pro1132Thr missense ATP1A3 1 59238 1.68811E-5 29619 0 NA
19-42471037-G-A p.Pro1126Leu missense ATP1A3 2 61868 3.23269E-5 30934 0 3.27354E-5
19-42471050-G-C p.Pro1122Ala missense ATP1A3 38761 61308 0.632234 30654 12417 0.699621
19-42471053-G-A p.Pro1121Ser missense ATP1A3 3 65042 4.6124E-5 32521 0 NA
19-42471056-G-A p.Arg1120Cys missense ATP1A3 2 65760 3.04136E-5 32880 0 5.05561E-5
19-42471058-G-A p.Pro1119Leu missense ATP1A3 2 66424 3.01096E-5 33212 0 NA
19-42471061-A-T p.Leu1118His missense ATP1A3 1 66938 1.49392E-5 33469 0 NA
19-42471067-G-A p.Pro1116Leu missense ATP1A3 4 67988 5.88339E-5 33994 0 1.94467E-5
19-42471070-C-T p.Arg1115His missense ATP1A3 15 67850 2.21076E-4 33925 0 1.6203E-4
19-42471074-G-T p.His1114Asn missense ATP1A3 3 69228 4.33351E-5 34614 0 6.47668E-5
19-42471076-G-A p.Pro1113Leu missense ATP1A3 2 69534 2.87629E-5 34767 0 NA
19-42471076-G-T p.Pro1113Gln missense ATP1A3 1 69534 1.43815E-5 34767 0 1.27624E-4
19-42471086-A-C p.Ser1110Ala missense ATP1A3 1 71512 1.39837E-5 35756 0 5.81899E-5
19-42471104-C-T p.Gly1104Arg missense ATP1A3 1 74688 1.3389E-5 37344 0 NA
19-42471117-C-T p.Gly1005Asp missense+splice_region ATP1A3 1 76536 1.30657E-5 38268 0 3.19264E-5
19-42471128-A-G p.Cys1096Arg missense ATP1A3 4 77974 5.12992E-5 38987 0 3.19101E-5
19-42471149-G-A p.Leu1089Leu synonymous ATP1A3 1 79606 1.25619E-5 39803 0 NA
19-42471159-T-C p.Pro1085Pro synonymous ATP1A3 1 80040 1.24938E-5 40020 0 NA
19-42471160-GGA-G p.Pro1085fs frameshift ATP1A3 16 80090 1.99775E-4 40045 0 6.41083E-5
19-42471166-A-T p.Leu1083His missense ATP1A3 1 80174 1.24729E-5 40087 0 NA
19-42471167-G-C p.Leu1083Val missense ATP1A3 2 80214 2.49333E-5 40107 0 6.41346E-6
19-42471168-A-T p.Cys1082* stop_gained ATP1A3 1 80210 1.24673E-5 40105 0 NA
19-42471169-C-A p.Cys1082Phe missense ATP1A3 1 80240 1.24626E-5 40120 0 NA
19-42471173-C-A p.Ala1081Ser missense ATP1A3 1 80376 1.24415E-5 40188 0 NA
19-42471178-C-T p.Arg1079His missense ATP1A3 2 80408 2.48731E-5 40204 0 6.38121E-5
19-42471183-C-T p.Ala1077Ala synonymous ATP1A3 9 80566 1.1171E-4 40283 0 6.38651E-5
19-42471184-G-A p.Ala1077Val missense ATP1A3 20 80604 2.48127E-4 40302 0 9.57365E-5
19-42471186-C-T p.Trp1076* stop_gained ATP1A3 1 80658 1.2398E-5 40329 0 NA
19-42471195-A-T p.Ser1073Ser synonymous ATP1A3 1 80870 1.23655E-5 40435 0 NA
19-42471226-CCA-C p.Cys1062fs frameshift ATP1A3 2 81016 2.46865E-5 40508 0 1.47275E-4
19-42471226-C-T p.Gly1063Asp missense ATP1A3 2 81016 2.46865E-5 40508 0 6.41182E-6
19-42471227-C-T p.Gly1063Ser missense ATP1A3 1 81022 1.23423E-5 40511 0 6.411E-6
19-42471231-C-T p.Leu1061Leu synonymous ATP1A3 2 81000 2.46914E-5 40500 0 6.37836E-5
19-42471240-A-T p.Gly1058Gly synonymous ATP1A3 1 80850 1.23686E-5 40425 0 4.93194E-5
19-42471243-C-A p.Thr1057Thr synonymous ATP1A3 1 80836 1.23707E-5 40418 0 NA
19-42471243-C-T p.Thr1057Thr synonymous ATP1A3 1 80836 1.23707E-5 40418 0 2.56062E-5
19-42471244-G-A p.Thr1057Met missense ATP1A3 6 80854 7.42078E-5 40427 0 6.3901E-6
19-42471255-G-C p.Leu1053Leu synonymous ATP1A3 1 80870 1.23655E-5 40435 0 NA
19-42471257-G-A p.Leu1053Phe missense ATP1A3 1 80832 1.23713E-5 40416 0 NA
19-42471258-T-G p.Pro1052Pro synonymous ATP1A3 5 80760 6.19118E-5 40380 0 NA
19-42471265-C-T p.Gly1050Glu missense ATP1A3 27 80626 3.3488E-4 40313 0 3.43575E-4
19-42471266-C-T p.Gly1050Arg missense ATP1A3 4 80684 4.95761E-5 40342 0 4.89716E-5
19-42471267-G-A p.Ser1049Ser synonymous ATP1A3 17 80754 2.10516E-4 40377 0 4.46685E-4
19-42471292-T-A p.His1041Leu missense ATP1A3 1 80942 1.23545E-5 40471 0 NA
19-42471292-T-C p.His1041Arg missense ATP1A3 2 80942 2.47091E-5 40471 0 NA
19-42471295-G-C p.Ser1040Cys missense ATP1A3 1 81014 1.23435E-5 40507 0 NA
19-42471310-G-A p.Ala1035Val missense ATP1A3 4 81174 4.92769E-5 40587 0 5.70255E-5
19-42471315-C-T p.Trp1033* stop_gained ATP1A3 1 81248 1.2308E-5 40624 0 3.18898E-5
19-42471318-G-A p.Cys1032Cys synonymous ATP1A3 1 81264 1.23056E-5 40632 0 3.18878E-5
19-42471324-C-T p.Ser1030Ser synonymous ATP1A3 5 81218 6.15627E-5 40609 0 4.1738E-5
19-42471326-A-C p.Ser1030Ala missense ATP1A3 32 81340 3.9341E-4 40670 0 4.64995E-4
19-42471337-G-A p.Pro1026Leu missense ATP1A3 1 81422 1.22817E-5 40711 0 NA
19-42471344-C-T p.Ala1024Thr missense ATP1A3 1 81428 1.22808E-5 40714 0 NA
19-42471345-TG-T p.Ala1023fs frameshift ATP1A3 1 81448 1.22778E-5 40724 0 NA
19-42471355-C-T p.Gly1020Glu missense ATP1A3 1 81548 1.22627E-5 40774 0 2.03475E-5
19-42471360-T-C p.Ala1018Ala synonymous ATP1A3 1 81556 1.22615E-5 40778 0 6.37877E-5
19-42471367-C-G p.Arg1016Pro missense ATP1A3 1 81650 1.22474E-5 40825 0 3.71913E-5
19-42471372-C-A p.Gly1014Gly synonymous ATP1A3 1 81726 1.2236E-5 40863 0 2.68063E-5
19-42471377-G-A p.Arg1013* stop_gained ATP1A3 9 81660 1.10213E-4 40830 0 6.37836E-5
19-42471387-C-A p.Arg1009Arg synonymous ATP1A3 1 81730 1.22354E-5 40865 0 NA
19-42471388-C-T p.Arg1009Gln missense ATP1A3 6 81746 7.33981E-5 40873 0 1.20081E-4
19-42471389-G-A p.Arg1009Trp missense ATP1A3 3 81696 3.67215E-5 40848 0 3.18674E-5
19-42471403-C-A p.Gly1004Val missense+splice_region ATP1A3 2 81890 2.4423E-5 40945 0 8.46382E-6
19-42471408-G-A p.Asn1002Asn synonymous ATP1A3 2 81854 2.44337E-5 40927 0 2.52972E-5
19-42471423-G-C p.Leu997Leu synonymous ATP1A3 1 81804 1.22243E-5 40902 0 NA
19-42471423-G-A p.Leu997Leu synonymous ATP1A3 1 81804 1.22243E-5 40902 0 NA
19-42471429-G-C p.Arg995Arg synonymous ATP1A3 2 81604 2.45086E-5 40802 0 NA
19-42471433-AT-A p.Ile994fs frameshift ATP1A3 1 81510 1.22684E-5 40755 0 NA
19-42471438-G-A p.Asp992Asp synonymous ATP1A3 48 81240 5.90842E-4 40620 0 0.00181644
19-42471440-C-T p.Asp992Asn missense ATP1A3 1 81112 1.23286E-5 40556 0 4.00455E-6
19-42471441-G-A p.Tyr991Tyr synonymous ATP1A3 1 81116 1.2328E-5 40558 0 3.36038E-5
19-42471446-C-T p.Val990Ile missense ATP1A3 1 80744 1.23848E-5 40372 0 5.03525E-4
19-42471447-G-A p.Phe989Phe synonymous ATP1A3 2 80710 2.47801E-5 40355 0 1.68155E-5
19-42471468-G-A p.Phe982Phe synonymous ATP1A3 3 78816 3.80633E-5 39408 0 0.00100705
19-42471471-G-A p.Ala981Ala synonymous ATP1A3 2 78330 2.5533E-5 39165 0 8.14339E-6
19-42471475-C-A p.Cys980Phe missense ATP1A3 1 77678 1.28737E-5 38839 0 NA
19-42471828-G-A p.Arg969Arg synonymous ATP1A3 1 82270 1.21551E-5 41135 0 6.38325E-5
19-42471839-C-T p.Val966Met missense ATP1A3 1 82382 1.21386E-5 41191 0 6.38978E-5
19-42471848-C-T p.Gly963Ser missense ATP1A3 3 82470 3.63769E-5 41235 0 3.98492E-6
19-42471849-G-A p.Pro962Pro synonymous ATP1A3 6 82540 7.2692E-5 41270 0 5.04032E-4
19-42471850-G-T p.Pro962His missense ATP1A3 1 82558 1.21127E-5 41279 0 3.19122E-5
19-42471852-G-A p.Cys961Cys synonymous ATP1A3 1 82558 1.21127E-5 41279 0 3.98371E-6
19-42471863-G-A p.Leu958Leu synonymous ATP1A3 1 82626 1.21027E-5 41313 0 NA
19-42471865-A-G p.Phe957Ser missense ATP1A3 1 82622 1.21033E-5 41311 0 NA
19-42471879-C-T p.Thr952Thr synonymous ATP1A3 12 82568 1.45335E-4 41284 0 2.87173E-4
19-42471879-C-G p.Thr952Thr synonymous ATP1A3 1 82568 1.21112E-5 41284 0 3.98454E-6
19-42471891-C-T p.Leu948Leu synonymous ATP1A3 5 82544 6.05738E-5 41272 1 3.98591E-6
19-42471897-G-A p.Phe946Phe synonymous ATP1A3 2 82454 2.42559E-5 41227 0 8.93199E-4
19-42471915-C-G p.Lys940Asn missense+splice_region ATP1A3 1 82066 1.21853E-5 41033 0 NA
19-42472931-C-T c.2819+6G>A splice_region ATP1A3 1 83022 1.2045E-5 41511 0 NA
19-42472934-C-T c.2819+3G>A splice_region ATP1A3 1 83074 1.20375E-5 41537 0 1.98946E-5
19-42472975-G-T p.Cys927* stop_gained ATP1A3 1 83268 1.20094E-5 41634 0 NA
19-42472989-C-A p.Asp923Tyr missense ATP1A3 1 83306 1.20039E-5 41653 0 NA
19-42472990-G-A p.Ala922Ala synonymous ATP1A3 1 83304 1.20042E-5 41652 0 NA
19-42473008-G-A p.Ile916Ile synonymous ATP1A3 3 83318 3.60066E-5 41659 0 3.18512E-5
19-42473026-C-T p.Thr910Thr synonymous ATP1A3 5 83298 6.00254E-5 41649 0 3.97659E-6
19-42473054-C-A p.Arg901Met missense ATP1A3 1 83244 1.20129E-5 41622 0 NA
19-42473062-G-A p.Tyr898Tyr synonymous ATP1A3 1 83188 1.2021E-5 41594 0 7.95551E-6
19-42473065-T-C p.Thr897Thr splice_region+synonymous ATP1A3 1 83184 1.20215E-5 41592 0 3.18654E-5
19-42473067-T-TCCA c.2689-1_2689insTGG splice_acceptor ATP1A3 2 83154 2.40518E-5 41577 1 NA
19-42473068-C-CCACTGCTGCCCGTAACTGTCTTCCAGGTCATTGACGG c.2689-2_2689-1insCCGTCAATGACCTGGAAGACAGTTACGGGCAGCAGTG splice_acceptor ATP1A3 2 83152 2.40523E-5 41576 1 NA
19-42473068-C-CCACTGCTGCCCGTAACTGTCTTCCAGGTCAT c.2689-2_2689-1insATGACCTGGAAGACAGTTACGGGCAGCAGTG splice_acceptor ATP1A3 2 83152 2.40523E-5 41576 1 NA
19-42473071-C-T c.2689-4G>A splice_region ATP1A3 1 83100 1.20337E-5 41550 0 NA
19-42473590-C-T p.Gln895Gln synonymous ATP1A3 2 83182 2.40437E-5 41591 0 NA
19-42473596-C-T p.Gly893Gly synonymous ATP1A3 1 83206 1.20184E-5 41603 0 NA
19-42473599-G-A p.Tyr892Tyr synonymous ATP1A3 2 83232 2.40292E-5 41616 0 3.57938E-5
19-42473620-G-A p.Val885Val synonymous ATP1A3 1 83300 1.20048E-5 41650 0 NA
19-42473622-C-T p.Val885Ile missense ATP1A3 31 83300 3.72149E-4 41650 0 3.82312E-4
19-42473623-G-A p.Thr884Thr synonymous ATP1A3 1 83304 1.20042E-5 41652 0 6.37146E-5
19-42473627-C-T p.Arg883His missense ATP1A3 1 83302 1.20045E-5 41651 0 2.38584E-5
19-42473641-C-T p.Leu878Leu synonymous ATP1A3 1 83332 1.20002E-5 41666 0 1.67009E-4
19-42473644-C-T p.Arg877Arg synonymous ATP1A3 2 83324 2.40027E-5 41662 0 NA
19-42473647-G-A p.Ile876Ile synonymous ATP1A3 1 83324 1.20013E-5 41662 0 1.59056E-5
19-42473656-C-G p.Leu873Leu synonymous ATP1A3 1 83334 1.19999E-5 41667 0 3.97649E-6
19-42473659-G-T p.Asn872Lys missense ATP1A3 2 83330 2.4001E-5 41665 0 1.27502E-4
19-42473664-C-T p.Gly871Ser missense ATP1A3 1 83326 1.20011E-5 41663 0 7.414E-5
19-42473665-G-A p.Pro870Pro synonymous ATP1A3 522 83328 0.0062644 41664 6 0.00653782
19-42473669-A-G p.Leu869Ser missense ATP1A3 1 83330 1.20005E-5 41665 0 NA
19-42473677-A-G p.Asn866Asn synonymous ATP1A3 2 83334 2.39998E-5 41667 0 NA
19-42473679-T-A p.Asn866Tyr missense ATP1A3 1 83334 1.19999E-5 41667 0 NA
19-42473683-T-A p.Ala864Ala synonymous ATP1A3 2 83332 2.40004E-5 41666 0 3.18878E-5
19-42473710-G-A p.Gly855Gly synonymous ATP1A3 1 83178 1.20224E-5 41589 0 8.24321E-6
19-42473716-G-A p.Leu853Leu synonymous ATP1A3 8 83060 9.63159E-5 41530 0 6.25E-4
19-42473720-G-C p.Ala852Gly missense ATP1A3 2 83010 2.40935E-5 41505 0 NA
19-42473725-G-A p.Ile850Ile synonymous ATP1A3 1 82936 1.20575E-5 41468 0 NA
19-42473729-A-T p.Met849Lys missense ATP1A3 1 82834 1.20723E-5 41417 0 NA
19-42473733-C-CAATCTGCCCGTAGGCCATGCTGATGAGTCTCTCATTGACCAA c.2543-2_2543-1insTTGGTCAATGAGAGACTCATCAGCATGGCCTACGGGCAGATT splice_acceptor ATP1A3 2 82750 2.41692E-5 41375 1 NA
19-42473733-C-CAATCTGCCCGTAGGCCATGCTGATGAGTCTCTCAT c.2543-2_2543-1insATGAGAGACTCATCAGCATGGCCTACGGGCAGATT splice_acceptor ATP1A3 2 82750 2.41692E-5 41375 1 NA
19-42474347-G-A p.Tyr844Tyr synonymous ATP1A3 1 82948 1.20557E-5 41474 0 0.00100806
19-42474356-G-A p.Ser841Ser synonymous ATP1A3 2 83042 2.40842E-5 41521 0 NA
19-42474371-A-G p.Asn836Asn synonymous ATP1A3 3 83122 3.60915E-5 41561 0 NA
19-42474379-A-G p.Leu834Leu synonymous ATP1A3 1 83152 1.20262E-5 41576 0 6.37471E-5
19-42474386-C-T p.Thr831Thr synonymous ATP1A3 9 83146 1.08243E-4 41573 0 1.64796E-4
19-42474388-T-A p.Thr831Ser missense ATP1A3 1 83180 1.20221E-5 41590 0 3.97687E-6
19-42474390-C-T p.Arg830Gln missense ATP1A3 1 83178 1.20224E-5 41589 0 9.54434E-5
19-42474391-G-A p.Arg830Trp missense ATP1A3 1 83190 1.20207E-5 41595 0 NA
19-42474392-C-T p.Pro829Pro synonymous ATP1A3 685 83162 0.00823694 41581 7 0.009375
19-42474407-T-C p.Arg824Arg synonymous ATP1A3 2 83218 2.40333E-5 41609 0 NA
19-42474421-C-T p.Asp820Asn missense ATP1A3 1 83208 1.20181E-5 41604 0 6.37105E-5
19-42474428-G-A p.Ala817Ala synonymous ATP1A3 2 83188 2.40419E-5 41594 0 1.27445E-4
19-42474434-C-T p.Glu815Glu synonymous ATP1A3 1 83184 1.20215E-5 41592 0 8.24457E-6
19-42474436-C-T p.Glu815Lys missense ATP1A3 1 83192 1.20204E-5 41596 0 NA
19-42474437-G-A p.Tyr814Tyr synonymous ATP1A3 3 83182 3.60655E-5 41591 0 3.18654E-5
19-42474440-C-T p.Ala813Ala synonymous ATP1A3 5 83180 6.01106E-5 41590 0 5.03525E-4
19-42474443-C-T p.Leu812Leu synonymous ATP1A3 1 83194 1.20201E-5 41597 0 NA
19-42474458-GACCTAGGCGGAGGAGGCCGGGTGAGCCGGAGAGGGGAGGACTCCACCCTCCTGGGCCCCAAGGGTGGCTGCCAGGGCTC-G p.Val807fs frameshift ATP1A3 7 83182 8.41528E-5 41591 1 NA
19-42474466-C-T c.2419-6G>A splice_region ATP1A3 4 83130 4.81174E-5 41565 0 1.81533E-4
19-42474467-G-A c.2419-7C>T splice_region ATP1A3 13 83142 1.56359E-4 41571 0 7.00314E-4
19-42474537-C-T c.2418+3G>A splice_region ATP1A3 1 83204 1.20187E-5 41602 0 6.25E-4
19-42474558-G-A p.Ile800Ile synonymous ATP1A3 2 83250 2.4024E-5 41625 0 8.24362E-6
19-42474576-G-A p.Thr794Thr synonymous ATP1A3 1 83274 1.20085E-5 41637 0 NA
19-42474591-C-T p.Pro789Pro synonymous ATP1A3 7 83300 8.40336E-5 41650 0 9.58589E-5
19-42474602-C-T p.Ala786Thr missense ATP1A3 1 83290 1.20062E-5 41645 0 NA
19-42474605-T-G p.Met785Leu missense ATP1A3 2 83308 2.40073E-5 41654 0 NA
19-42474615-C-A p.Leu781Leu synonymous ATP1A3 1 83318 1.20022E-5 41659 0 3.97636E-6
19-42474624-C-T p.Thr778Thr synonymous ATP1A3 79 83312 9.48243E-4 41656 0 0.00182178
19-42474633-C-T p.Pro775Pro synonymous ATP1A3 3 83324 3.6004E-5 41662 0 8.23737E-5
19-42474636-G-A p.Ile774Ile synonymous ATP1A3 1 83326 1.20011E-5 41663 0 NA
19-42474639-A-G p.Asn773Asn synonymous ATP1A3 678 83296 0.00813965 41648 10 0.00972949
19-42474675-G-A p.Asn761Asn synonymous ATP1A3 1 83274 1.20085E-5 41637 0 NA
19-42474678-G-T p.Asp760Glu missense ATP1A3 1 83244 1.20129E-5 41622 0 NA
19-42474681-G-A p.Phe759Phe synonymous ATP1A3 2 83232 2.40292E-5 41616 0 4.1197E-5
19-42474693-G-A p.Gly755Gly splice_region+synonymous ATP1A3 3 83114 3.6095E-5 41557 0 NA
19-42479780-C-T c.2263+1G>A splice_donor ATP1A3 1 83118 1.20311E-5 41559 0 NA
19-42479781-C-A p.Gly755Cys missense+splice_region ATP1A3 1 83124 1.20302E-5 41562 0 NA
19-42479792-C-T p.Gly751Glu missense ATP1A3 1 83198 1.20195E-5 41599 0 NA
19-42479818-G-A p.Asp742Asp synonymous ATP1A3 13 83300 1.56062E-4 41650 0 1.15338E-4
19-42479823-G-A p.Leu741Leu synonymous ATP1A3 1 83324 1.20013E-5 41662 0 NA
19-42479854-G-A p.Asp730Asp synonymous ATP1A3 3 83318 3.60066E-5 41659 0 1.59571E-4
19-42479866-G-A p.Ile726Ile synonymous ATP1A3 3 83300 3.60144E-5 41650 0 4.77213E-5
19-42479890-G-A p.Ala718Ala synonymous ATP1A3 9 83232 1.08131E-4 41616 1 6.25E-4
19-42479892-C-CG p.Ala718fs frameshift ATP1A3 2 83226 2.4031E-5 41613 0 NA
19-42479895-TC-T p.Lys717fs frameshift ATP1A3 2 83214 2.40344E-5 41607 0 NA
19-42479905-G-C p.Pro713Pro synonymous ATP1A3 1 83122 1.20305E-5 41561 0 6.3861E-5
19-42479905-G-A p.Pro713Pro synonymous ATP1A3 1 83122 1.20305E-5 41561 0 1.5912E-5
19-42479920-A-G p.Gly708Gly synonymous ATP1A3 1 82780 1.20802E-5 41390 0 NA
19-42479929-G-A p.Thr705Thr synonymous ATP1A3 2 82482 2.42477E-5 41241 0 7.56496E-5
19-42479932-C-T p.Val704Val synonymous ATP1A3 1 82358 1.21421E-5 41179 0 NA
19-42479952-G-GTCTCTGACAGCCCTCCACAATGATGAGCTTCTGCT c.2095-4_2095-3insAGCAGAAGCTCATCATTGTGGAGGGCTGTCAGAGA splice_region ATP1A3 1 81016 1.23432E-5 40508 0 NA
19-42479952-G-GTCTCT c.2095-4_2095-3insAGAGA splice_region ATP1A3 1 81018 1.23429E-5 40509 0 NA
19-42479952-G-A c.2095-3C>T splice_region ATP1A3 2 81018 2.46859E-5 40509 0 8.27499E-6
19-42479953-G-GAGGGTGCAGGGTA c.2095-5_2095-4insTACCCTGCACCCT splice_region ATP1A3 7 80938 8.6486E-5 40469 0 7.18213E-5
19-42479956-G-A c.2095-7C>T splice_region ATP1A3 2 80588 2.48176E-5 40294 0 NA
19-42480617-C-T p.Arg682His missense ATP1A3 1 83264 1.201E-5 41632 0 NA
19-42480622-G-A p.Phe680Phe synonymous ATP1A3 8 83280 9.60615E-5 41640 0 6.25E-4
19-42480634-G-A p.Thr676Thr synonymous ATP1A3 2 83314 2.40056E-5 41657 0 3.1839E-5
19-42480637-G-A p.His675His synonymous ATP1A3 3 83324 3.6004E-5 41662 0 3.97643E-6
19-42480640-A-G p.Asn674Asn synonymous ATP1A3 2 83328 2.40015E-5 41664 0 NA
19-42480643-C-T p.Gln673Gln synonymous ATP1A3 1 83330 1.20005E-5 41665 0 NA
19-42480646-C-T p.Leu672Leu synonymous ATP1A3 1 83326 1.20011E-5 41663 0 NA
19-42480654-C-T p.Glu670Lys missense ATP1A3 1 83332 1.20002E-5 41666 0 8.23791E-6
19-42480655-G-A p.Asp669Asp synonymous ATP1A3 2 83330 2.4001E-5 41665 0 3.29511E-5
19-42480658-G-A p.Ile668Ile synonymous ATP1A3 4 83316 4.801E-5 41658 0 4.94266E-5
19-42480667-G-A p.Ser665Ser synonymous ATP1A3 2 83292 2.40119E-5 41646 0 5.03525E-4
19-42480688-G-A p.Thr658Thr synonymous ATP1A3 5 83220 6.00817E-5 41610 0 1.3183E-4
19-42480694-G-A p.His656His synonymous ATP1A3 7 83208 8.41265E-5 41604 0 8.23995E-5
19-42480703-G-A p.Cys653Cys synonymous ATP1A3 6 83174 7.21379E-5 41587 0 6.37186E-5
19-42480706-G-C p.Ala652Ala synonymous ATP1A3 1 83156 1.20256E-5 41578 0 8.24158E-6
19-42480719-C-CGGGGG c.1944-2_1944-1insCCCCC splice_acceptor ATP1A3 3 83054 3.61211E-5 41527 1 NA
19-42480722-G-A c.1944-4C>T splice_region ATP1A3 1 83002 1.20479E-5 41501 0 NA
19-42482107-C-T p.Val642Ile missense ATP1A3 6 83296 7.20323E-5 41648 0 6.59163E-5
19-42482108-G-A p.Pro641Pro synonymous ATP1A3 4 83300 4.80192E-5 41650 0 8.23954E-5
19-42482121-C-T p.Arg637Gln missense ATP1A3 1 83314 1.20028E-5 41657 0 3.97719E-6
19-42482125-C-T p.Ala636Thr missense ATP1A3 4 83320 4.80077E-5 41660 0 0.00100705
19-42482126-G-A p.Ala635Ala synonymous ATP1A3 1 83326 1.20011E-5 41663 0 6.25E-4
19-42482131-T-C p.Ile634Val missense ATP1A3 1 83348 1.19979E-5 41674 0 3.97665E-6
19-42482147-G-A p.Asn628Asn synonymous ATP1A3 2 83364 2.39912E-5 41682 0 6.36902E-5
19-42482192-C-T p.Thr613Thr synonymous ATP1A3 2 83342 2.39975E-5 41671 0 3.1835E-5
19-42482207-G-A p.Gly608Gly synonymous ATP1A3 2 83342 2.39975E-5 41671 0 1.59051E-5
19-42482210-G-A p.Thr607Thr synonymous ATP1A3 12 83340 1.43988E-4 41670 0 0.00125
19-42482219-G-T p.Ile604Ile synonymous ATP1A3 1 83342 1.19988E-5 41671 0 3.9763E-6
19-42482222-GACCTGCAGGCATTGTTTTTTAGGGATGGCCTCTCCCGCCCCACGCCTGGCTTTGCCTCCCCCAGCCACCCCAAGCCAC-G p.Val603fs frameshift ATP1A3 11 83332 1.32002E-4 41666 4 NA
19-42482224-C-T p.Val603Ile missense+splice_region ATP1A3 1 83334 1.19999E-5 41667 0 3.97636E-6
19-42482315-G-A p.Ser598Ser synonymous ATP1A3 1 83114 1.20317E-5 41557 0 3.18735E-5
19-42482333-C-T p.Ala592Ala synonymous ATP1A3 10 83098 1.2034E-4 41549 0 2.14741E-4
19-42482334-G-A p.Ala592Val missense ATP1A3 1 83090 1.20351E-5 41545 0 NA
19-42482336-G-A p.Asp591Asp synonymous ATP1A3 2 83082 2.40726E-5 41541 0 9.55475E-5
19-42482342-G-T p.Val589Val synonymous ATP1A3 1 83106 1.20328E-5 41553 0 NA
19-42482363-G-A p.Ile582Ile synonymous ATP1A3 4 83084 4.8144E-5 41542 0 2.50803E-5
19-42482381-C-T p.Val576Val synonymous ATP1A3 2 83056 2.40801E-5 41528 0 NA
19-42482390-G-T p.Leu573Leu synonymous ATP1A3 2 83070 2.40761E-5 41535 0 3.98359E-6
19-42482395-T-C p.Asn572Asp missense ATP1A3 17 83072 2.04642E-4 41536 0 8.37007E-5
19-42482400-G-A p.Thr570Met missense ATP1A3 1 83074 1.20375E-5 41537 0 NA
19-42482409-T-G p.Asn567Thr missense ATP1A3 1 83046 1.20415E-5 41523 0 NA
19-42482414-G-A p.Asp565Asp synonymous ATP1A3 26 83038 3.1311E-4 41519 0 3.24643E-4
19-42482425-C-T p.Asp562Asn missense ATP1A3 1 82968 1.20528E-5 41484 0 NA
19-42482452-C-T p.Glu553Lys missense ATP1A3 3 82834 3.6217E-5 41417 0 NA
19-42482456-G-C p.Pro551Pro synonymous ATP1A3 1 82786 1.20793E-5 41393 0 1.31978E-5
19-42482456-G-A p.Pro551Pro synonymous ATP1A3 5 82786 6.03967E-5 41393 0 4.26913E-6
19-42482486-C-T c.1631-8G>A splice_region ATP1A3 1 82326 1.21468E-5 41163 0 NA
19-42482771-G-C p.Gly539Gly synonymous ATP1A3 1 82572 1.21106E-5 41286 0 NA
19-42482771-GCC-TCT p.Gly539Arg missense ATP1A3 1 82572 1.21106E-5 41286 0 NA
19-42482783-G-A p.Leu535Leu synonymous ATP1A3 3 82666 3.62906E-5 41333 0 1.65404E-5
19-42482825-G-T p.Asp521Glu missense ATP1A3 2 82996 2.40975E-5 41498 0 1.64894E-5
19-42482825-G-A p.Asp521Asp synonymous ATP1A3 1 82996 1.20488E-5 41498 0 NA
19-42482825-G-C p.Asp521Glu missense ATP1A3 1 82996 1.20488E-5 41498 0 NA
19-42482839-C-G p.Glu517Gln missense ATP1A3 1 82972 1.20523E-5 41486 0 NA
19-42482861-G-A p.Ser509Ser synonymous ATP1A3 66 82962 7.95545E-4 41481 1 0.004375
19-42482868-C-T p.Arg507His missense ATP1A3 5 82940 6.02845E-5 41470 1 8.35216E-5
19-42482879-G-A p.Arg503Arg synonymous ATP1A3 1 83020 1.20453E-5 41510 0 NA
19-42482885-G-A p.Pro501Pro synonymous ATP1A3 16 83006 1.92757E-4 41503 0 1.91375E-4
19-42482888-G-A p.Ala500Ala synonymous ATP1A3 16 83018 1.92729E-4 41509 0 1.27535E-4
19-42482888-G-T p.Ala500Ala synonymous ATP1A3 1 83018 1.20456E-5 41509 0 1.1931E-5
19-42482897-C-T p.Met497Ile missense ATP1A3 2 82990 2.40993E-5 41495 0 NA
19-42482916-T-C p.Asn491Ser missense ATP1A3 15 82904 1.80932E-4 41452 1 0.00151057
19-42482920-C-T p.Asp490Asn missense ATP1A3 1 82882 1.20653E-5 41441 0 1.1932E-5
19-42482921-G-A p.Asn489Asn synonymous ATP1A3 3 82892 3.61917E-5 41446 0 6.37959E-5
19-42482926-G-A p.Pro488Ser missense ATP1A3 1 82864 1.2068E-5 41432 0 NA
19-42482933-G-C p.Thr485Thr synonymous ATP1A3 1 82798 1.20776E-5 41399 0 3.29968E-5
19-42485703-C-T p.Arg463His missense ATP1A3 2 83330 2.4001E-5 41665 0 2.47109E-5
19-42485704-G-A p.Arg463Cys missense ATP1A3 44 83334 5.27996E-4 41667 0 0.00100705
19-42485714-C-T p.Leu459Leu synonymous ATP1A3 2 83336 2.39992E-5 41668 0 NA
19-42485722-C-G p.Val457Leu missense ATP1A3 1 83314 1.20028E-5 41657 0 NA
19-42485723-G-A p.Ser456Ser synonymous ATP1A3 8 83320 9.60154E-5 41660 0 9.55414E-5
19-42485735-C-T p.Leu452Leu synonymous ATP1A3 1 83300 1.20048E-5 41650 0 NA
19-42485741-G-A p.Ile450Ile synonymous ATP1A3 1 83274 1.20085E-5 41637 0 1.0711E-4
19-42485747-C-T p.Lys448Lys synonymous ATP1A3 2 83280 2.40154E-5 41640 0 3.29571E-5
19-42485753-C-T p.Leu446Leu synonymous ATP1A3 1 83272 1.20088E-5 41636 0 3.97662E-6
19-42485768-C-T p.Ala441Ala synonymous ATP1A3 496 83220 0.00596011 41610 6 0.00772274
19-42485769-G-A p.Ala441Val missense ATP1A3 1 83216 1.20169E-5 41608 0 NA
19-42485779-C-T p.Ala438Thr missense ATP1A3 3 83212 3.60525E-5 41606 0 8.24443E-6
19-42485788-TCTGCAAGGAGAAAGGGTTGTCAGAACAGGGACAGCTGAGGGGAGGACACAGGCAGGGCCGAGGTGAGGCCAGTAGCTGAACCCAC-T c.1302+1_1303-1delGTGGGTTCAGCTACTGGCCTCACCTCGGCCCTGCCTGTGTCCTCCCCTCAGCTGTCCCTGTTCTGACAACCCTTTCTCCTTGCAG splice_acceptor ATP1A3 10 83202 1.20189E-4 41601 4 NA
19-42485793-A-C c.1303-5T>G splice_region ATP1A3 1 83174 1.2023E-5 41587 0 8.24606E-6
19-42485880-C-A p.Val432Val synonymous ATP1A3 2 83264 2.402E-5 41632 0 3.1841E-5
19-42485895-C-T p.Gln427Gln synonymous ATP1A3 8 83294 9.60453E-5 41647 0 2.86348E-4
19-42485916-G-A p.Arg420Arg synonymous ATP1A3 20 83308 2.40073E-4 41654 0 7.95976E-4
19-42485969-T-C p.Lys403Glu missense ATP1A3 1 83254 1.20114E-5 41627 0 NA
19-42485982-CCCTGGGGGAGGCATGTGTGAGGGCCAGGGACTCCTGGAGCCAGGCCCCCATGGTCCTCACCCGGGGCCTGCGCTCA-C p.Thr399fs frameshift ATP1A3 6 83220 7.20981E-5 41610 3 NA
19-42485985-T-C c.1193-2A>G splice_acceptor ATP1A3 1 83222 1.20161E-5 41611 0 NA
19-42485987-G-C c.1193-4C>G splice_region ATP1A3 35 83212 4.20612E-4 41606 0 0.00125
19-42485988-G-A c.1193-5C>T splice_region ATP1A3 1 83210 1.20178E-5 41605 0 NA
19-42485990-G-A c.1193-7C>T splice_region ATP1A3 1 83210 1.20178E-5 41605 0 3.97678E-6
19-42486053-C-G c.1192+7G>C splice_region ATP1A3 2 83300 2.40096E-5 41650 0 2.47105E-5
19-42486053-C-T c.1192+7G>A splice_region ATP1A3 7 83300 8.40336E-5 41650 0 1.64737E-5
19-42486054-G-A c.1192+6C>T splice_region ATP1A3 9 83296 1.08048E-4 41648 0 3.82239E-4
19-42486057-C-T c.1192+3G>A splice_region ATP1A3 10 83324 1.20013E-4 41662 0 6.25E-4
19-42486074-G-A p.Thr393Ile missense ATP1A3 1 83348 1.19979E-5 41674 0 NA
19-42486088-G-A p.His388His synonymous ATP1A3 3 83360 3.59885E-5 41680 0 1.64731E-5
19-42486088-G-C p.His388Gln missense ATP1A3 2 83360 2.39923E-5 41680 0 NA
19-42486118-G-A p.Val378Val synonymous ATP1A3 7 83388 8.39449E-5 41694 0 1.51097E-4
19-42486121-T-C p.Thr377Thr synonymous ATP1A3 9 83392 1.07924E-4 41696 0 1.27494E-4
19-42486160-G-A p.Cys364Cys synonymous ATP1A3 1 83404 1.19898E-5 41702 0 NA
19-42486166-G-A p.Thr362Thr synonymous ATP1A3 6 83394 7.19476E-5 41697 0 3.45933E-4
19-42486172-C-T p.Thr360Thr synonymous ATP1A3 7 83388 8.39449E-5 41694 0 5.03525E-4
19-42486181-C-A p.Leu357Leu synonymous ATP1A3 1 83382 1.1993E-5 41691 0 NA
19-42486201-G-A p.Leu351Leu synonymous ATP1A3 1 83382 1.1993E-5 41691 0 8.23655E-6
19-42486211-C-T p.Leu347Leu synonymous ATP1A3 1 83364 1.19956E-5 41682 0 NA
19-42486231-T-C p.Met341Val missense ATP1A3 1 83346 1.19982E-5 41673 0 3.97643E-6
19-42486235-C-T p.Lys339Lys synonymous ATP1A3 3 83326 3.60032E-5 41663 0 5.76549E-5
19-42486241-G-A p.Thr337Thr synonymous ATP1A3 1 83298 1.20051E-5 41649 0 8.23669E-6
19-42486247-C-T p.Thr335Thr synonymous ATP1A3 6 83276 7.20496E-5 41638 0 6.37308E-5
19-42486261-G-C c.994-3C>G splice_region ATP1A3 17 83210 2.04302E-4 41605 0 3.50452E-4
19-42486262-G-C c.994-4C>G splice_region ATP1A3 4 83210 4.80711E-5 41605 0 9.0614E-5
19-42489064-C-T c.993+6G>A splice_region ATP1A3 2 80052 2.49838E-5 40026 0 NA
19-42489109-G-T p.Ile318Ile synonymous ATP1A3 2 82140 2.43487E-5 41070 0 5.9854E-5
19-42489118-G-A p.Ile315Ile synonymous ATP1A3 4 82578 4.84391E-5 41289 0 8.74646E-6
19-42489121-G-A p.Leu314Leu synonymous ATP1A3 2 82656 2.41967E-5 41328 0 8.70716E-6
19-42489127-G-T p.Ile312Ile synonymous ATP1A3 3 82784 3.62389E-5 41392 0 3.98333E-6
19-42489148-G-A p.Tyr305Tyr synonymous ATP1A3 26 82968 3.13374E-4 41484 0 1.75243E-4
19-42489154-G-A p.Leu303Leu synonymous ATP1A3 10 83000 1.20482E-4 41500 0 7.569E-5
19-42489154-G-C p.Leu303Leu synonymous ATP1A3 1 83004 1.20476E-5 41502 0 6.36862E-5
19-42489187-C-G p.Leu292Leu synonymous ATP1A3 2 82986 2.41005E-5 41493 0 NA
19-42489204-C-A p.Gly287Cys missense ATP1A3 1 83026 1.20444E-5 41513 0 NA
19-42489205-G-A p.Thr286Thr synonymous ATP1A3 4 83024 4.81788E-5 41512 0 8.5131E-5
19-42489241-G-A p.Ile274Ile synonymous ATP1A3 1 82932 1.20581E-5 41466 0 4.80027E-5
19-42489247-C-T p.Thr272Thr synonymous ATP1A3 189 82862 0.0022809 41431 1 0.00755287
19-42489248-G-T p.Thr272Lys missense ATP1A3 1 82862 1.20683E-5 41431 0 NA
19-42489255-C-T p.Gly270Ser missense ATP1A3 1 82816 1.2075E-5 41408 0 NA
19-42489259-C-T p.Glu268Glu synonymous ATP1A3 7 82806 8.45349E-5 41403 0 8.46826E-6
19-42489265-C-T p.Gly266Gly synonymous ATP1A3 1 82746 1.20852E-5 41373 0 NA
19-42489277-G-A p.Thr262Thr synonymous ATP1A3 4 82642 4.84015E-5 41321 0 7.19885E-5
19-42489282-C-T p.Ala261Thr missense ATP1A3 1 82500 1.21212E-5 41250 0 NA
19-42489283-G-A p.Ile260Ile synonymous ATP1A3 1 82562 1.21121E-5 41281 0 4.00247E-6
19-42489295-G-A p.Val256Val synonymous ATP1A3 1 82470 1.21256E-5 41235 0 4.00609E-6
19-42489307-G-A p.Gly252Gly synonymous ATP1A3 4 82026 4.8765E-5 41013 0 1.91302E-4
19-42489310-C-T p.Thr251Thr synonymous ATP1A3 4 82078 4.87341E-5 41039 0 4.83138E-5
19-42489322-C-G p.Val247Val synonymous ATP1A3 5 81944 6.10173E-5 40972 0 1.81219E-4
19-42489324-C-T p.Val247Met missense ATP1A3 1 81848 1.22178E-5 40924 0 1.59429E-4
19-42489334-C-T p.Thr243Thr synonymous ATP1A3 1 82034 1.21901E-5 41017 0 1.6909E-5
19-42489337-GCCTGCAGGCCAGAGGGGTTAGGCTGAGGTGGGGTGGCTCAGGGAGGTTCTGGAGGCCTGACCCCCTGGGACACATCCCTGTGTCTGCCCCAGCTGTGTGTCTTCTCTGCACCCGCCTCA-G p.Gly242fs frameshift ATP1A3 1 82022 1.21919E-5 41011 0 NA
19-42489345-G-A c.725-7C>T splice_region ATP1A3 1 81972 1.21993E-5 40986 0 8.4391E-6
19-42489474-G-A p.Ser236Ser synonymous ATP1A3 2 83032 2.40871E-5 41516 0 3.29554E-5
19-42489483-G-C p.Thr233Thr synonymous ATP1A3 2 83028 2.40883E-5 41514 0 NA
19-42489507-G-A p.Asn225Asn synonymous ATP1A3 2 82910 2.41225E-5 41455 0 9.55231E-5
19-42489516-A-C p.Thr222Thr synonymous ATP1A3 72806 81370 0.894752 40685 32696 0.931394
19-42489516-A-T p.Thr222Thr synonymous ATP1A3 4 82732 4.83489E-5 41366 0 1.48263E-4
19-42489524-C-T p.Asp220Asn missense ATP1A3 2 82652 2.41978E-5 41326 0 3.97722E-6
19-42489532-C-T p.Arg217His missense ATP1A3 1 82360 1.21418E-5 41180 0 NA
19-42489546-G-A p.Ser212Ser synonymous ATP1A3 1 82070 1.21847E-5 41035 0 2.4719E-5
19-42489552-G-A p.Gly210Gly synonymous ATP1A3 1 81740 1.22339E-5 40870 0 5.03525E-4
19-42489577-TG-T c.607-3delC splice_region ATP1A3 1 80758 1.23827E-5 40379 0 9.94819E-5
19-42489581-G-T c.607-6C>A splice_region ATP1A3 1 80572 1.24113E-5 40286 0 NA
19-42489582-G-T c.607-7C>A splice_region ATP1A3 5 80486 6.21226E-5 40243 1 8.24511E-6
19-42490025-G-A p.His199His synonymous ATP1A3 8 82338 9.71605E-5 41169 0 9.57304E-5
19-42490070-C-A p.Lys184Asn missense ATP1A3 1 83172 1.20233E-5 41586 0 NA
19-42490070-C-G p.Lys184Asn missense ATP1A3 1 83172 1.20233E-5 41586 0 NA
19-42490073-G-A p.Ile183Ile synonymous ATP1A3 1 83176 1.20227E-5 41588 0 3.97678E-6
19-42490090-C-T p.Gly178Arg missense ATP1A3 1 83228 1.20152E-5 41614 0 NA
19-42490091-G-A p.Val177Val synonymous ATP1A3 5 83234 6.00716E-5 41617 0 3.19305E-5
19-42490150-GCTGAGGTGGGATGGAGTAATGTCACCTCCCAGACTCCCTCTGCCTGGGGGTCACTGGGCCCGGCCCCCAGCCCATACACTAACACCCCCGTCTGGCCCCTTGCTGGGCACCCTTCAC-G c.471+1_472-1del splice_acceptor ATP1A3 7 83294 8.40397E-5 41647 1 NA
19-42490153-G-C c.472-3C>G splice_region ATP1A3 1 83290 1.20062E-5 41645 0 NA
19-42490155-G-C c.472-5C>G splice_region ATP1A3 11 83284 1.32078E-4 41642 0 7.41314E-5
19-42490271-G-C p.Pro156Pro synonymous ATP1A3 1 83318 1.20022E-5 41659 0 7.95292E-6
19-42490314-G-A p.Ala142Val missense ATP1A3 1 83322 1.20016E-5 41661 0 NA
19-42490355-G-C p.Ala128Ala synonymous ATP1A3 1 83224 1.20158E-5 41612 0 8.24892E-6
19-42490358-C-T p.Ala127Ala synonymous ATP1A3 5 83206 6.00918E-5 41603 0 2.38703E-5
19-42490376-G-A p.Tyr121Tyr synonymous ATP1A3 6 82984 7.23031E-5 41492 0 0.001875
19-42492088-G-A p.Asn119Asn splice_region+synonymous ATP1A3 176 82864 0.00212396 41432 0 0.0026414
19-42492115-G-C p.Gly110Gly synonymous ATP1A3 1 83082 1.20363E-5 41541 0 NA
19-42492118-C-T p.Ala109Ala synonymous ATP1A3 2 83124 2.40604E-5 41562 0 9.56633E-5
19-42492130-G-A p.Tyr105Tyr synonymous ATP1A3 9 83192 1.08183E-4 41596 0 1.15399E-4
19-42492142-G-A p.Cys101Cys synonymous ATP1A3 1 83220 1.20163E-5 41610 0 2.78388E-5
19-42492150-T-C p.Ile99Val missense ATP1A3 1 83224 1.20158E-5 41612 0 NA
19-42492157-G-A p.Ile96Ile synonymous ATP1A3 18 83222 2.16289E-4 41611 0 6.25E-4
19-42492166-C-A p.Leu93Leu synonymous ATP1A3 1 83248 1.20123E-5 41624 0 NA
19-42492171-T-C p.Ile92Val missense ATP1A3 2 83262 2.40206E-5 41631 0 3.97662E-6
19-42492178-G-A p.Gly89Gly synonymous ATP1A3 1 83254 1.20114E-5 41627 0 NA
19-42492202-C-T p.Lys81Lys synonymous ATP1A3 4 83278 4.80319E-5 41639 0 1.40042E-4
19-42492207-C-T p.Val80Ile missense ATP1A3 1 83284 1.20071E-5 41642 0 8.23778E-6
19-42492221-G-A p.Thr75Ile missense ATP1A3 1 83270 1.20091E-5 41635 0 NA
19-42492226-C-T n.528G>A splice_region ATP1A3 1 83248 1.20123E-5 41624 0 1.64758E-5
19-42492232-C-A p.Thr71Thr synonymous ATP1A3 1 83200 1.20192E-5 41600 0 NA
19-42492238-T-A p.Ala69Ala synonymous ATP1A3 38 83232 4.56555E-4 41616 0 0.00352467
19-42492253-C-T p.Arg64Arg synonymous ATP1A3 30 83206 3.60551E-4 41603 0 7.02158E-4
19-42492254-C-T p.Arg64Gln missense ATP1A3 9 83208 1.08163E-4 41604 0 6.38325E-5
19-42492255-G-A p.Arg64Trp missense ATP1A3 1 83194 1.20201E-5 41597 0 3.98168E-6
19-42492296-G-C c.154-5C>G splice_region ATP1A3 242 83126 0.00291124 41563 1 0.009375
19-42492476-A-G p.Cys49Cys synonymous ATP1A3 7 83140 8.41953E-5 41570 0 2.66522E-4
19-42492495-C-T p.Arg43Gln missense ATP1A3 4 83206 4.80735E-5 41603 0 2.78392E-5
19-42492519-T-C p.Lys35Arg missense ATP1A3 1 83248 1.20123E-5 41624 0 NA
19-42492524-C-T p.Glu33Glu synonymous ATP1A3 2 83242 2.40263E-5 41621 0 3.97671E-6
19-42492528-G-C p.Thr32Arg missense+splice_region ATP1A3 1 83240 1.20135E-5 41620 0 NA
19-42492529-TCTGAGGAACAGGAGTTTGGGGGAGACGGTGAGTGCCTAGGCCAGCCAAGAACTGGCGAGGTTCTCTGGGAGGGTGTGCGGGCAGAGGGCGAGGCTTAC-T c.93+1_94-1delGTAAGCCTCGCCCTCTGCCCGCACACCCTCCCAGAGAACCTCGCCAGTTCTTGGCTGGCCTAGGCACTCACCGTCTCCCCCAAACTCCTGTTCCTCAG splice_acceptor ATP1A3 12 83230 1.44179E-4 41615 5 NA
19-42492529-T-C p.Thr32Ala missense+splice_region ATP1A3 1 83232 1.20146E-5 41616 0 NA
19-42492623-C-T c.93+5G>A splice_region ATP1A3 1 83316 1.20025E-5 41658 0 3.18634E-5
19-42492652-A-G p.Asp23Asp synonymous ATP1A3 1 83364 1.19956E-5 41682 0 3.97624E-6
19-42492658-G-A p.Asp21Asp synonymous ATP1A3 1 83352 1.19973E-5 41676 0 6.37349E-5
19-42492662-C-T p.Arg20Gln missense ATP1A3 1 83342 1.19988E-5 41671 0 2.38574E-5
19-42492666-G-A p.Arg19Cys missense ATP1A3 6 83344 7.19908E-5 41672 0 6.75966E-5
19-42492667-C-T p.Glu18Glu synonymous ATP1A3 1 83346 1.19982E-5 41673 0 3.29457E-5
19-42492675-C-T p.Gly16Ser missense ATP1A3 3 83356 3.59902E-5 41678 0 8.23642E-6
19-42492679-GTTC-G p.Lys13del disruptive_inframe_deletion ATP1A3 1 83356 1.19967E-5 41678 0 NA
19-42492696-C-T p.Asp9Asn missense ATP1A3 1 83362 1.19959E-5 41681 0 NA
19-42492710-T-C p.Lys4Arg missense ATP1A3 1 83366 1.19953E-5 41683 0 NA
19-42492716-T-G c.7-2A>C splice_acceptor ATP1A3 1 83320 1.20019E-5 41660 0 1.19292E-5
19-42492731-C-T p.Arg10His missense ATP1A3 2 83242 2.40263E-5 41621 0 2.23029E-4
19-42492732-G-A p.Arg10Cys missense ATP1A3 2 83228 2.40304E-5 41614 0 3.18735E-5
19-42492757-C-T c.7-4G>A splice_region ATP1A3 3 82958 3.61629E-5 41479 0 1.19362E-5
19-42492758-G-A c.7-5C>T splice_region ATP1A3 1 82954 1.20549E-5 41477 0 7.43028E-5
19-42492761-C-T c.7-8G>A splice_region ATP1A3 1 82854 1.20694E-5 41427 0 NA
19-42497354-A-G n.315+6T>C splice_region ATP1A3 1 11810 8.4674E-5 5905 0 3.31961E-5
19-42497545-C-T p.Thr13Thr splice_region+synonymous ATP1A3 1 34740 2.87853E-5 17370 0 1.15635E-4
19-42497558-T-A p.Asn9Ile missense ATP1A3 1 34766 2.87637E-5 17383 0 NA
19-42497617-C-A c.-34G>T 5_prime_UTR_premature_start_codon_gain ATP1A3 2 34674 5.76801E-5 17337 0 2.24158E-4
19-42498163-C-G c.-85G>C splice_region ATP1A3 2 76564 2.61219E-5 38282 0 NA
19-42498174-G-A c.-96C>T 5_prime_UTR_premature_start_codon_gain ATP1A3 1 76770 1.30259E-5 38385 0 1.28818E-5
19-42498219-C-T c.6+4G>A splice_region ATP1A3 1 76850 1.30124E-5 38425 0 NA
19-42498220-T-C c.6+3A>G splice_region ATP1A3 20 76764 2.60539E-4 38382 0 0.00251256
19-42498223-C-A p.Gly2Gly splice_region+synonymous ATP1A3 1 76732 1.30324E-5 38366 0 NA
19-42498225-C-T p.Gly2Arg missense+splice_region ATP1A3 1 76714 1.30354E-5 38357 0 NA
19-42498331-G-A c.-103C>T 5_prime_UTR_premature_start_codon_gain ATP1A3 1 52758 1.89545E-5 26379 0 NA