Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
11-108093239-G-T c.-705G>T 5_prime_UTR_premature_start_codon_gain ATM 3 83340 3.59971E-5 41670 0 8.51368E-6
11-108093338-C-T c.-606C>T 5_prime_UTR_premature_start_codon_gain ATM 90 82478 0.0010912 41239 0 0.00197415
11-108093354-A-T c.-590A>T 5_prime_UTR_premature_start_codon_gain ATM 2 81940 2.44081E-5 40970 0 NA
11-108093355-G-C c.-589G>C 5_prime_UTR_premature_start_codon_gain ATM 72 81864 8.79507E-4 40932 0 0.003125
11-108093419-C-T c.-525C>T 5_prime_UTR_premature_start_codon_gain ATM 1 75570 1.32328E-5 37785 0 NA
11-108093451-C-T c.-493C>T 5_prime_UTR_premature_start_codon_gain ATM 2 69196 2.89034E-5 34598 0 6.36983E-5
11-108093467-C-T c.-477C>T 5_prime_UTR_premature_start_codon_gain ATM 1 65958 1.51612E-5 32979 0 NA
11-108093492-A-T c.-452A>T 5_prime_UTR_premature_start_codon_gain ATM 4 62860 6.36335E-5 31430 0 6.37267E-5
11-108093510-A-T c.-434A>T 5_prime_UTR_premature_start_codon_gain ATM 1 60360 1.65673E-5 30180 0 3.19244E-5
11-108093529-C-T c.-415C>T 5_prime_UTR_premature_start_codon_gain ATM 1 58460 1.71057E-5 29230 0 3.18939E-5
11-108093546-G-A c.-398G>A 5_prime_UTR_premature_start_codon_gain ATM 2 56338 3.55E-5 28169 0 3.18715E-5
11-108093590-C-T c.-354C>T 5_prime_UTR_premature_start_codon_gain ATM 7 52674 1.32893E-4 26337 0 6.36821E-5
11-108093616-A-T c.-328A>T 5_prime_UTR_premature_start_codon_gain ATM 68 48296 0.00140798 24148 0 0.00280201
11-108093645-C-T c.-299C>T 5_prime_UTR_premature_start_codon_gain ATM 1 46062 2.17099E-5 23031 0 NA
11-108093812-C-T c.-132C>T 5_prime_UTR_premature_start_codon_gain ATM 1 7384 1.35428E-4 3692 0 NA
11-108093921-C-T c.-31+8C>T splice_region ATM 1 3334 2.9994E-4 1667 0 6.37308E-5
11-108094421-T-A n.158+8T>A splice_region ATM 2 968 0.00206612 484 0 0.00172018
11-108098309-A-AT c.-30-5dupT splice_region ATM 2 82116 2.43558E-5 41058 0 6.71456E-5
11-108098317-TACAG-T c.-30_-27delACAG splice_region ATM 1 82416 1.21336E-5 41208 0 NA
11-108098323-C-T c.-29C>T splice_region ATM 2 82640 2.42014E-5 41320 0 1.65131E-5
11-108098337-C-T c.-15C>T 5_prime_UTR_premature_start_codon_gain ATM 5 82960 6.027E-5 41480 0 NA
11-108098388-C-T p.Arg13Cys missense ATM 3 83192 3.60612E-5 41596 0 2.4717E-5
11-108098392-A-G p.Gln14Arg missense ATM 1 83220 1.20163E-5 41610 0 8.23845E-6
11-108098401-A-G p.His17Arg missense ATM 1 83214 1.20172E-5 41607 0 3.97782E-6
11-108098412-A-G p.Thr21Ala missense ATM 1 83218 1.20166E-5 41609 0 NA
11-108098417-A-G p.Glu22Glu synonymous ATM 2 83216 2.40338E-5 41608 0 3.97804E-6
11-108098418-C-T p.Arg23* stop_gained ATM 3 83206 3.60551E-5 41603 0 2.47178E-5
11-108098419-G-A p.Arg23Gln missense ATM 3 83210 3.60534E-5 41605 0 NA
11-108098420-A-G p.Arg23Arg synonymous ATM 2 83222 2.40321E-5 41611 0 NA
11-108098421-AAGGTAGTAAATTACTTAAATTCAATTTTTCCTTGAAATAAGTGTGATTAGTAACCCATTATTATTTCCTTTTTATTTTC-A p.Lys25fs frameshift ATM 7 83218 8.41164E-5 41609 0 NA
11-108098508-A-T p.Glu26Asp missense ATM 1 83158 1.20253E-5 41579 0 3.18573E-5
11-108098516-A-C p.Lys29Thr missense ATM 2 83152 2.40523E-5 41576 0 1.65128E-5
11-108098524-C-T p.Arg32Cys missense ATM 1 83148 1.20267E-5 41574 0 1.23844E-4
11-108098525-G-A p.Arg32His missense ATM 1 83138 1.20282E-5 41569 0 1.6512E-5
11-108098527-C-T p.Leu33Leu synonymous ATM 2 83156 2.40512E-5 41578 0 3.98089E-6
11-108098533-C-A p.Arg35Arg synonymous ATM 15 83138 1.80423E-4 41569 0 0.00151057
11-108098533-C-T p.Arg35* stop_gained ATM 1 83138 1.20282E-5 41569 0 1.99021E-5
11-108098545-A-G p.Thr39Ala missense ATM 5 83142 6.01381E-5 41571 0 9.55231E-5
11-108098546-CAATT-C p.Ile40fs frameshift ATM 1 83144 1.20273E-5 41572 0 NA
11-108098555-A-G p.His42Arg missense ATM 2 83118 2.40622E-5 41559 0 1.89835E-4
11-108098561-A-G p.Asp44Gly missense ATM 7 83108 8.42278E-5 41554 0 6.28141E-4
11-108098563-C-T p.Arg45Trp missense ATM 6 83102 7.22004E-5 41551 0 4.12732E-5
11-108098565-GCATT-G p.His46fs frameshift ATM 1 83102 1.20334E-5 41551 0 NA
11-108098568-T-C p.His46His synonymous ATM 2 83104 2.40662E-5 41552 0 8.25546E-6
11-108098576-C-G p.Ser49Cys missense ATM 661 83080 0.00795619 41540 2 0.0076168
11-108098576-C-T p.Ser49Phe missense ATM 2 83098 2.4068E-5 41549 0 3.18695E-5
11-108098592-T-C p.Tyr54Tyr synonymous ATM 207 83034 0.00249295 41517 0 0.00210258
11-108098605-G-T p.Ala59Ser missense ATM 3 82946 3.61681E-5 41473 0 1.65459E-5
11-108099898-C-T c.186-7C>T splice_region ATM 183 82708 0.0022126 41354 3 0.00453124
11-108099917-A-G p.Lys66Lys synonymous ATM 15 82992 1.8074E-4 41496 0 9.66316E-5
11-108099937-A-C p.Glu73Ala missense ATM 1 83144 1.20273E-5 41572 0 NA
11-108099948-A-G p.Ile77Val missense ATM 1 83190 1.20207E-5 41595 0 3.18552E-5
11-108099952-CA-C p.Lys79fs frameshift ATM 1 83202 1.20189E-5 41601 0 3.99198E-6
11-108099957-C-T p.Pro80Ser missense ATM 1 83228 1.20152E-5 41614 0 1.75196E-5
11-108099961-A-G p.Asn81Ser missense ATM 1 83226 1.20155E-5 41613 0 NA
11-108099965-A-G p.Val82Val synonymous ATM 5 83248 6.00615E-5 41624 0 8.66987E-6
11-108099980-A-G p.Gln87Gln synonymous ATM 1 83252 1.20117E-5 41626 0 NA
11-108100001-G-A p.Met94Ile missense ATM 1 83248 1.20123E-5 41624 0 NA
11-108100002-C-A p.Gln95Lys missense ATM 4 83248 4.80492E-5 41624 0 1.53387E-4
11-108100009-T-C p.Ile97Thr missense ATM 6 83240 7.20807E-5 41620 0 9.58405E-5
11-108100010-C-T p.Ile97Ile synonymous ATM 2 83236 2.40281E-5 41618 0 1.70698E-5
11-108100014-A-G p.Ser99Gly missense ATM 21 83226 2.52325E-4 41613 0 2.86928E-4
11-108100028-C-T p.Tyr103Tyr synonymous ATM 2 83162 2.40494E-5 41581 0 7.97175E-6
11-108100039-G-A p.Cys107Tyr missense ATM 22 83082 2.64799E-4 41541 0 0.00100705
11-108100041-G-A p.Ala108Thr missense ATM 1 83070 1.2038E-5 41535 0 8.67634E-6
11-108100042-C-G p.Ala108Gly missense ATM 2 83066 2.40772E-5 41533 0 1.73593E-5
11-108106394-T-C c.332-3T>C splice_region ATM 5 82274 6.07725E-5 41137 0 1.59205E-4
11-108106399-G-A p.Ala112Thr missense+splice_region ATM 26 82464 3.15289E-4 41232 0 7.32811E-4
11-108106402-C-T p.Pro113Ser missense ATM 2 82570 2.42219E-5 41285 0 NA
11-108106426-T-A p.Leu121Ile missense ATM 1 82956 1.20546E-5 41478 0 6.36659E-5
11-108106430-A-C p.Asn122Thr missense ATM 1 82984 1.20505E-5 41492 0 NA
11-108106431-T-C p.Asn122Asn synonymous ATM 1 82990 1.20496E-5 41495 0 3.1839E-5
11-108106435-A-G p.Ile124Val missense ATM 56 83012 6.74601E-4 41506 0 0.00181482
11-108106436-T-C p.Ile124Thr missense ATM 2 83010 2.40935E-5 41505 0 NA
11-108106437-C-A p.Ile124Ile synonymous ATM 3 83018 3.61367E-5 41509 0 3.18555E-5
11-108106438-A-G p.Met125Val missense ATM 2 83020 2.40906E-5 41510 0 1.6512E-5
11-108106443-T-A p.Asp126Glu missense ATM 2301 82994 0.0277249 41497 163 0.0547557
11-108106460-C-T p.Ser132Phe missense ATM 4 83094 4.81383E-5 41547 0 3.1841E-5
11-108106465-G-A p.Gly134Ser missense ATM 1 83094 1.20346E-5 41547 0 1.64894E-5
11-108106466-G-A p.Gly134Asp missense ATM 2 83086 2.40714E-5 41543 0 7.95893E-6
11-108106475-A-T p.Tyr137Phe missense ATM 2 83108 2.40651E-5 41554 0 8.24226E-6
11-108106485-T-C p.Asp140Asp synonymous ATM 1 83114 1.20317E-5 41557 0 NA
11-108106498-C-G p.Leu145Val missense ATM 1 83106 1.20328E-5 41553 0 3.97874E-6
11-108106501-C-T p.Leu146Phe missense ATM 1 83120 1.20308E-5 41560 0 NA
11-108106519-G-C p.Val152Leu missense ATM 1 83118 1.20311E-5 41559 0 NA
11-108106527-A-G p.Lys154Lys synonymous ATM 2 83122 2.4061E-5 41561 0 3.97852E-6
11-108106548-G-A p.Gln161Gln synonymous ATM 1 83072 1.20378E-5 41536 0 3.97883E-6
11-108106557-G-T p.Trp164Cys missense ATM 1 83060 1.20395E-5 41530 0 NA
11-108106561-G-GAATT c.496_496+1insAATT splice_donor ATM 2 83054 2.40807E-5 41527 0 NA
11-108106565-T-C c.496+4T>C splice_region ATM 7 83020 8.4317E-5 41510 0 9.89136E-5
11-108106565-T-G c.496+4T>G splice_region ATM 1 83020 1.20453E-5 41510 0 3.97912E-6
11-108106569-T-C c.496+8T>C splice_region ATM 2 83002 2.40958E-5 41501 0 NA
11-108114684-G-T p.Leu167Phe missense ATM 1 81472 1.22742E-5 40736 0 1.58203E-4
11-108114693-G-A p.Val170Val synonymous ATM 1 82444 1.21294E-5 41222 0 3.52908E-5
11-108114701-G-T p.Arg173Met missense ATM 1 82674 1.20957E-5 41337 0 4.29682E-6
11-108114705-C-G p.Leu174Leu synonymous ATM 2 82712 2.41803E-5 41356 0 NA
11-108114709-C-G p.Leu176Val missense ATM 1 82788 1.2079E-5 41394 0 3.31543E-5
11-108114717-T-G p.Pro178Pro synonymous ATM 1 82904 1.20621E-5 41452 0 NA
11-108114722-A-G p.Gln180Arg missense ATM 1 82954 1.20549E-5 41477 0 NA
11-108114727-G-C p.Val182Leu missense ATM 397 82990 0.00478371 41495 4 0.0221551
11-108114749-G-A p.Arg189Lys missense ATM 1 82606 1.21057E-5 41303 0 0.0558912
11-108114752-T-A p.Ile190Lys missense ATM 19 82730 2.29663E-4 41365 0 0.0406782
11-108114757-C-G p.His192Asp missense ATM 2 83004 2.40952E-5 41502 0 8.02221E-6
11-108114758-A-T p.His192Leu missense ATM 1 83030 1.20438E-5 41515 0 NA
11-108114773-G-T p.Gly197Val missense ATM 1 83120 1.20308E-5 41560 0 NA
11-108114773-G-A p.Gly197Glu missense ATM 3 83120 3.60924E-5 41560 0 4.22461E-5
11-108114774-A-T p.Gly197Gly synonymous ATM 3 83112 3.60959E-5 41556 0 5.03525E-4
11-108114792-C-T p.Asp203Asp synonymous ATM 153 83074 0.00184173 41537 0 0.00146515
11-108114793-G-A p.Gly204Arg missense ATM 11 83058 1.32438E-4 41529 0 0.00100705
11-108114797-T-G p.Leu205* stop_gained ATM 2 83044 2.40836E-5 41522 0 NA
11-108114805-A-G p.Lys208Glu missense ATM 2 82988 2.40999E-5 41494 0 NA
11-108114821-T-C p.Phe213Ser missense ATM 1 82932 1.20581E-5 41466 0 3.98064E-6
11-108114823-T-C p.Ser214Pro missense ATM 1 82902 1.20624E-5 41451 0 8.27198E-6
11-108114829-G-T p.Ala216Ser missense ATM 4 82848 4.82812E-5 41424 0 6.40287E-5
11-108114831-T-C p.Ala216Ala synonymous ATM 5 82834 6.03617E-5 41417 0 8.27445E-6
11-108114840-T-C p.Cys219Cys synonymous ATM 935 82746 0.0112996 41373 30 0.0252248
11-108114842-C-T p.Ala220Val missense ATM 2 82748 2.41698E-5 41374 0 6.62943E-5
11-108114845-G-GACAA c.662_662+1insACAA splice_donor ATM 1 82724 1.20884E-5 41362 0 NA
11-108114845-G-GACAAGAAAAGAGCTCTTCA c.662_662+1insACAAGAAAAGAGCTCTTCA splice_donor ATM 1 82724 1.20884E-5 41362 0 NA
11-108114849-A-G c.662+4A>G splice_region ATM 2 82610 2.42101E-5 41305 0 NA
11-108115507-C-A c.663-8C>A splice_region ATM 1 82828 1.20732E-5 41414 0 NA
11-108115517-AAGAAAAGAGCTCT-A p.Gln222fs frameshift ATM 1 82894 1.20636E-5 41447 0 3.98305E-6
11-108115522-A-G p.Lys224Glu missense ATM 7 82916 8.44228E-5 41458 0 5.03525E-4
11-108115532-C-T p.Ser227Leu missense ATM 1 82924 1.20592E-5 41462 0 8.24837E-6
11-108115539-A-G p.Leu229Leu synonymous ATM 1 82918 1.20601E-5 41459 0 NA
11-108115544-A-G p.His231Arg missense ATM 2 82928 2.41173E-5 41464 0 1.59302E-5
11-108115548-C-A p.Ile232Ile synonymous ATM 1 82914 1.20607E-5 41457 0 NA
11-108115561-AC-A p.Thr237fs frameshift ATM 1 82872 1.20668E-5 41436 0 NA
11-108115563-T-C p.Thr237Thr synonymous ATM 1 82878 1.20659E-5 41439 0 3.98318E-6
11-108115564-A-G p.Ile238Val missense ATM 4 82878 4.82637E-5 41439 0 1.64883E-5
11-108115568-T-C p.Phe239Ser missense ATM 2 82850 2.414E-5 41425 0 3.18573E-5
11-108115569-C-T p.Phe239Phe synonymous ATM 1 82854 1.20694E-5 41427 0 8.24321E-6
11-108115587-C-T p.Val245Val synonymous ATM 582 82824 0.00702695 41412 8 0.0140226
11-108115593-T-C p.Phe247Phe synonymous ATM 2 82830 2.41458E-5 41415 0 NA
11-108115600-C-T p.Arg250* stop_gained ATM 3 82834 3.6217E-5 41417 0 8.24307E-6
11-108115601-G-A p.Arg250Gln missense ATM 15 82838 1.81076E-4 41419 0 6.37511E-5
11-108115603-G-C p.Val251Leu missense ATM 3 82850 3.621E-5 41425 0 NA
11-108115623-A-C p.Glu257Asp missense ATM 1 82912 1.2061E-5 41456 0 NA
11-108115630-C-G p.Pro260Ala missense ATM 1 82928 1.20587E-5 41464 0 NA
11-108115634-C-G p.Thr261Ser missense ATM 1 82940 1.20569E-5 41470 0 NA
11-108115639-CT-C p.Tyr264fs frameshift ATM 1 82946 1.2056E-5 41473 0 8.24498E-6
11-108115654-C-T p.Gln268* stop_gained ATM 1 82972 1.20523E-5 41486 0 8.24851E-6
11-108115661-G-A p.Arg270Lys missense ATM 2 83010 2.40935E-5 41505 0 3.98451E-6
11-108115667-A-T p.Asn272Ile missense ATM 1 83032 1.20435E-5 41516 0 NA
11-108115669-G-T p.Asp273Tyr missense ATM 1 83032 1.20435E-5 41516 0 NA
11-108115673-CT-C p.Leu275fs frameshift ATM 3 83036 3.61289E-5 41518 0 7.97334E-6
11-108115710-A-G p.Gln286Gln synonymous ATM 1 82964 1.20534E-5 41482 0 3.18451E-5
11-108115727-C-T p.Pro292Leu missense ATM 1 82872 1.20668E-5 41436 0 3.18695E-5
11-108115735-G-C p.Ala295Pro missense ATM 2 82838 2.41435E-5 41419 0 NA
11-108115736-C-A p.Ala295Asp missense ATM 1 82846 1.20706E-5 41423 0 NA
11-108115754-G-GTGCT c.901+1_901+2insTGCT splice_donor ATM 1 82622 1.21033E-5 41311 0 NA
11-108115754-G-A c.901+1G>A splice_donor ATM 2 82624 2.4206E-5 41312 0 3.18512E-5
11-108117691-G-A p.Gly301Asp missense+splice_region ATM 1 82638 1.2101E-5 41319 0 6.36943E-5
11-108117710-A-T p.Lys307Asn missense ATM 1 82908 1.20616E-5 41454 0 NA
11-108117720-A-G p.Ile311Val missense ATM 3 82982 3.61524E-5 41491 0 7.97143E-6
11-108117725-A-C p.Leu312Phe missense ATM 1 83018 1.20456E-5 41509 0 7.97035E-6
11-108117735-T-C p.Tyr316His missense ATM 3 83070 3.61141E-5 41535 0 3.32099E-5
11-108117744-C-T p.Leu319Leu synonymous ATM 2 83120 2.40616E-5 41560 0 NA
11-108117767-A-G p.Ile326Met missense ATM 1 83126 1.20299E-5 41563 0 NA
11-108117770-AAGT-A p.Ser328del disruptive_inframe_deletion ATM 1 83122 1.20305E-5 41561 0 NA
11-108117775-G-A p.Arg329Lys missense ATM 2 83154 2.40518E-5 41577 0 5.97272E-5
11-108117779-A-G p.Gly330Gly synonymous ATM 1 83158 1.20253E-5 41579 0 NA
11-108117787-C-T p.Ser333Phe missense ATM 132 83148 0.00158753 41574 0 0.00156071
11-108117798-C-T p.Arg337Cys missense ATM 5 83142 6.01381E-5 41571 0 1.2747E-4
11-108117799-G-A p.Arg337His missense ATM 17 83148 2.04455E-4 41574 0 5.03525E-4
11-108117804-AT-A p.Ile339fs frameshift ATM 2 83134 2.40575E-5 41567 0 6.36821E-5
11-108117809-C-A p.Ala340Ala synonymous ATM 3 83132 3.60872E-5 41566 0 1.87153E-4
11-108117809-C-T p.Ala340Ala synonymous ATM 1 83132 1.20291E-5 41566 0 8.26282E-6
11-108117810-G-A p.Val341Ile missense ATM 2 83128 2.40593E-5 41564 0 2.78758E-5
11-108117812-CAAAG-C p.Glu343fs frameshift ATM 6 83134 7.21726E-5 41567 0 3.18542E-5
11-108117833-G-A p.Leu348Leu synonymous ATM 1 83056 1.20401E-5 41528 0 3.9814E-6
11-108117835-T-A p.Met349Lys missense ATM 1 83050 1.20409E-5 41525 0 NA
11-108117840-G-A p.Asp351Asn missense ATM 2 83028 2.40883E-5 41514 0 3.98178E-6
11-108117841-A-AT p.Ile352fs frameshift ATM 1 83026 1.20444E-5 41513 0 NA
11-108117855-G-T c.1065+1G>T splice_donor ATM 2 82962 2.41074E-5 41481 0 NA
11-108119654-T-G c.1066-6T>G splice_region ATM 115 82754 0.00138966 41377 1 0.00320102
11-108119658-A-G c.1066-2A>G splice_acceptor ATM 1 82880 1.20656E-5 41440 0 NA
11-108119662-T-C p.Val356Val splice_region+synonymous ATM 2 82964 2.41068E-5 41482 0 4.09779E-6
11-108119667-A-G p.Asn358Ser missense ATM 38 83012 4.57765E-4 41506 0 8.31043E-4
11-108119672-G-A p.Asp360Asn missense ATM 1 83070 1.2038E-5 41535 0 NA
11-108119696-C-G p.Gln368Glu missense ATM 1 83216 1.20169E-5 41608 0 NA
11-108119704-C-T p.Tyr370Tyr synonymous ATM 1 83200 1.20192E-5 41600 0 7.9621E-6
11-108119706-C-G p.Thr371Ser missense ATM 1 83214 1.20172E-5 41607 0 NA
11-108119732-T-A p.Tyr380Asn missense ATM 2 83240 2.40269E-5 41620 0 3.18532E-5
11-108119743-T-C p.Pro383Pro synonymous ATM 2 83238 2.40275E-5 41619 0 NA
11-108119746-C-G p.Cys384Trp missense ATM 1 83238 1.20137E-5 41619 0 8.25341E-6
11-108119770-C-G p.Gly392Gly synonymous ATM 558 83188 0.0067077 41594 10 0.0132436
11-108119802-C-A p.Ser403* stop_gained ATM 1 83100 1.20337E-5 41550 0 NA
11-108119803-A-G p.Ser403Ser synonymous ATM 1 83092 1.20349E-5 41546 0 6.37267E-5
11-108119806-G-A p.Gln404Gln synonymous ATM 1 83084 1.2036E-5 41542 0 NA
11-108119808-AT-A p.Asn405fs frameshift ATM 2 83078 2.40738E-5 41539 0 NA
11-108119819-C-T p.Leu409Phe missense ATM 1 82986 1.20502E-5 41493 0 3.98248E-6
11-108119821-T-C p.Leu409Leu synonymous ATM 1 82974 1.2052E-5 41487 0 NA
11-108119823-T-C p.Val410Ala missense ATM 205 82940 0.00247167 41470 0 0.0022222
11-108119828-T-C p.Trp412Arg missense+splice_region ATM 1 82906 1.20619E-5 41453 0 3.98324E-6
11-108119831-TAA-T c.1235+3_1235+4delAA splice_region ATM 1 82840 1.20715E-5 41420 0 8.26925E-6
11-108119833-A-C c.1235+4A>C splice_region ATM 1 82824 1.20738E-5 41412 0 NA
11-108121421-T-A c.1236-7T>A splice_region ATM 1 82256 1.21572E-5 41128 0 NA
11-108121425-T-TTG c.1236-3_1236-2insTG splice_acceptor ATM 1 81722 1.22366E-5 40861 0 NA
11-108121426-A-G c.1236-2A>G splice_acceptor ATM 3 80698 3.71756E-5 40349 0 NA
11-108121428-G-A p.Trp412* stop_gained ATM 1 81044 1.2339E-5 40522 0 NA
11-108121443-C-T p.Thr417Thr synonymous ATM 2 82310 2.42984E-5 41155 0 NA
11-108121446-A-G p.Gln418Gln synonymous ATM 958 82358 0.0116321 41179 30 0.0225371
11-108121463-C-A p.Pro424His missense ATM 2 82772 2.41628E-5 41386 0 6.45578E-5
11-108121464-T-C p.Pro424Pro synonymous ATM 54 82810 6.52095E-4 41405 1 0.00654582
11-108121465-G-T p.Ala425Ser missense ATM 1 82800 1.20773E-5 41400 0 4.02026E-6
11-108121469-G-A p.Ser426Asn missense ATM 1 82912 1.2061E-5 41456 0 4.01068E-6
11-108121487-T-G p.Leu432Arg missense ATM 2 83072 2.40755E-5 41536 0 NA
11-108121495-T-C p.Leu435Leu synonymous ATM 2 83126 2.40599E-5 41563 0 5.03525E-4
11-108121521-A-C p.Leu443Leu synonymous ATM 1 83246 1.20126E-5 41623 0 1.64995E-5
11-108121532-G-A p.Arg447Gln missense ATM 1 83280 1.20077E-5 41640 0 1.64916E-5
11-108121538-G-A p.Gly449Glu missense ATM 1 83294 1.20057E-5 41647 0 NA
11-108121543-C-T p.Arg451Cys missense ATM 13 83304 1.56055E-4 41652 0 1.31893E-4
11-108121548-A-G p.Thr452Thr synonymous ATM 1 83308 1.20036E-5 41654 0 NA
11-108121555-G-A p.Val455Met missense ATM 1 83312 1.20031E-5 41656 0 1.19331E-5
11-108121560-A-G p.Leu456Leu synonymous ATM 1 83326 1.20011E-5 41663 0 3.182E-5
11-108121562-G-A p.Arg457Gln missense ATM 2 83324 2.40027E-5 41662 0 1.19334E-5
11-108121571-C-T p.Thr460Met missense ATM 2 83338 2.39987E-5 41669 0 6.25E-4
11-108121572-G-C p.Thr460Thr synonymous ATM 41 83342 4.91949E-4 41671 0 0.00100705
11-108121573-G-A p.Glu461Lys missense ATM 1 83340 1.1999E-5 41670 0 8.24063E-6
11-108121584-G-A p.Leu464Leu synonymous ATM 1 83334 1.19999E-5 41667 0 1.98869E-5
11-108121593-CAA-C p.Lys468fs frameshift ATM 3 83336 3.59988E-5 41668 0 9.5645E-5
11-108121632-A-C p.Leu480Phe missense ATM 2 83290 2.40125E-5 41645 0 3.18492E-5
11-108121634-T-G p.Leu481* stop_gained ATM 1 83294 1.20057E-5 41647 0 NA
11-108121636-A-C p.Lys482Gln missense ATM 5 83294 6.00283E-5 41647 0 6.25E-4
11-108121642-T-C p.Trp484Arg missense ATM 2 83286 2.40136E-5 41643 0 NA
11-108121656-G-T p.Trp488Cys missense ATM 1 83274 1.20085E-5 41637 0 3.18532E-5
11-108121668-T-G p.Phe492Leu missense ATM 1 83262 1.20103E-5 41631 0 NA
11-108121683-T-C p.Ser497Ser synonymous ATM 1 83256 1.20111E-5 41628 0 NA
11-108121692-A-G p.Ile500Met missense ATM 1 83254 1.20114E-5 41627 0 NA
11-108121697-C-G p.Ala502Gly missense ATM 1 83252 1.20117E-5 41626 0 8.24593E-6
11-108121706-T-C p.Phe505Ser missense ATM 1 83250 1.2012E-5 41625 0 NA
11-108121708-G-T p.Gly506Cys missense ATM 19 83248 2.28234E-4 41624 0 0.0060423
11-108121714-C-T p.Leu508Phe missense ATM 2 83236 2.40281E-5 41618 0 NA
11-108121733-G-A p.Gly514Asp missense ATM 599 83214 0.00719831 41607 16 0.0182472
11-108121734-T-C p.Gly514Gly synonymous ATM 1 83214 1.20172E-5 41607 0 1.19457E-5
11-108121739-T-C p.Leu516Ser missense ATM 1 83212 1.20175E-5 41606 0 NA
11-108121748-T-C p.Val519Ala missense ATM 2 83186 2.40425E-5 41593 0 3.18784E-5
11-108121752-CAG-C p.Glu522fs frameshift ATM 9 83170 1.08212E-4 41585 0 5.58102E-5
11-108121752-C-T p.Asp520Asp synonymous ATM 1 83170 1.20236E-5 41585 0 NA
11-108121787-G-A p.Cys532Tyr missense ATM 36 83036 4.33547E-4 41518 0 0.0020141
11-108121787-G-GCAGA p.Pro534fs frameshift ATM 2 83038 2.40854E-5 41519 0 NA
11-108121799-G-T p.Cys536Phe missense+splice_region ATM 1 82936 1.20575E-5 41468 0 NA
11-108122560-A-G c.1608-4A>G splice_region ATM 2 83154 2.40518E-5 41577 0 NA
11-108122566-C-A p.Pro537His missense+splice_region ATM 1 83180 1.20221E-5 41590 0 NA
11-108122585-T-G p.Thr543Thr synonymous ATM 2 83186 2.40425E-5 41593 0 3.97871E-6
11-108122587-T-C p.Leu544Ser missense ATM 5 83190 6.01034E-5 41595 0 9.55231E-5
11-108122591-A-G p.Ala545Ala synonymous ATM 1 83184 1.20215E-5 41592 0 NA
11-108122592-C-G p.Leu546Val missense ATM 588 83176 0.00706935 41588 15 0.0131537
11-108122597-C-A p.Thr547Thr synonymous ATM 1 83176 1.20227E-5 41588 0 1.19373E-5
11-108122604-A-G p.Ile550Val missense ATM 2 83168 2.40477E-5 41584 0 5.04032E-4
11-108122609-T-C p.Val551Val synonymous ATM 1 83164 1.20244E-5 41582 0 NA
11-108122617-C-T p.Thr554Met missense ATM 2 83154 2.40518E-5 41577 0 3.18695E-5
11-108122625-A-G p.Met557Val missense ATM 1 83168 1.20239E-5 41584 0 3.97902E-6
11-108122641-A-G p.Asn562Ser missense ATM 1 83184 1.20215E-5 41592 0 6.37064E-5
11-108122651-A-G p.Glu565Glu synonymous ATM 3 83174 3.6069E-5 41587 0 3.18431E-5
11-108122654-A-G p.Val566Val synonymous ATM 1 83162 1.20247E-5 41581 0 NA
11-108122659-G-T p.Arg568Ile missense ATM 35 83146 4.20946E-4 41573 0 5.03525E-4
11-108122678-A-G p.Glu574Glu synonymous ATM 1 83110 1.20322E-5 41555 0 3.98143E-6
11-108122682-A-G p.Ile576Val missense ATM 1 83094 1.20346E-5 41547 0 1.1945E-5
11-108122683-T-C p.Ile576Thr missense ATM 3 83090 3.61054E-5 41545 0 1.59236E-4
11-108122686-T-G p.Met577Arg missense ATM 1 83088 1.20354E-5 41544 0 NA
11-108122695-T-C p.Leu580Pro missense ATM 1 83038 1.20427E-5 41519 0 NA
11-108122696-C-T p.Leu580Leu synonymous ATM 1 83036 1.2043E-5 41518 0 6.25782E-4
11-108122700-T-C p.Phe582Leu missense ATM 174 83030 0.00209563 41515 0 0.0166163
11-108122729-T-C p.Asn591Asn synonymous ATM 19 82634 2.2993E-4 41317 0 0.00100705
11-108122742-C-CATAGTA p.Pro596delinsHisSerThr disruptive_inframe_insertion ATM 1 82166 1.21705E-5 41083 0 NA
11-108123542-A-G c.1803-2A>G splice_acceptor ATM 1 81820 1.2222E-5 40910 0 NA
11-108123551-C-T p.Pro604Ser missense ATM 520 82030 0.00633914 41015 2 0.0196771
11-108123575-C-G p.Leu612Val missense ATM 1 82308 1.21495E-5 41154 0 NA
11-108123575-C-T p.Leu612Phe missense ATM 1 82308 1.21495E-5 41154 0 1.70739E-5
11-108123578-G-T p.Val613Leu missense ATM 5 82324 6.07356E-5 41162 0 4.25554E-5
11-108123582-G-C p.Ser614Thr missense ATM 2 82336 2.42907E-5 41168 0 8.48911E-6
11-108123590-A-G p.Met617Val missense ATM 1 82352 1.2143E-5 41176 0 NA
11-108123596-A-C p.Asn619His missense ATM 2 82380 2.42777E-5 41190 0 1.69236E-5
11-108123611-A-C p.Met624Leu missense ATM 1 82342 1.21445E-5 41171 0 NA
11-108123615-A-G p.Asn625Ser missense ATM 1 82316 1.21483E-5 41158 0 NA
11-108123621-T-G p.Phe627Cys missense ATM 1 82264 1.2156E-5 41132 0 3.18552E-5
11-108123628-C-T p.Ser629Ser synonymous ATM 2 82140 2.43487E-5 41070 0 6.38366E-5
11-108123629-G-A p.Val630Met missense ATM 1 82110 1.21788E-5 41055 0 9.98323E-5
11-108123633-C-T p.Pro631Leu missense ATM 1 82086 1.21823E-5 41043 0 8.75151E-6
11-108123639-G-GTGAACACCACCAAAAAGATAAAGAA c.1898_1898+1insTGAACACCACCAAAAAGATAAAGAA splice_donor ATM 2 81998 2.43908E-5 40999 1 NA
11-108124544-A-G p.Glu634Glu synonymous ATM 1 82892 1.20639E-5 41446 0 NA
11-108124547-C-T p.His635His synonymous ATM 1 82890 1.20642E-5 41445 0 3.18796E-5
11-108124553-A-G n.93-5A>G splice_region ATM 4 82920 4.82393E-5 41460 0 3.18573E-5
11-108124556-A-C n.93-2A>C splice_acceptor ATM 1 82950 1.20555E-5 41475 0 NA
11-108124560-AAAG-A p.Glu642del conservative_inframe_deletion ATM 1 83006 1.20473E-5 41503 0 3.98467E-6
11-108124573-C-T p.Ser644Leu missense ATM 1 83048 1.20412E-5 41524 0 NA
11-108124585-T-C p.Val648Ala missense ATM 3 83104 3.60993E-5 41552 0 3.18573E-5
11-108124589-A-G p.Glu649Glu synonymous ATM 1 83124 1.20302E-5 41562 0 NA
11-108124595-A-G p.Leu651Leu synonymous ATM 7 83128 8.42075E-5 41564 0 7.95862E-5
11-108124596-T-C p.Phe652Leu missense ATM 2 83132 2.40581E-5 41566 0 NA
11-108124602-C-A p.Gln654Lys missense ATM 2 83146 2.40541E-5 41573 0 4.12283E-5
11-108124609-C-T p.Thr656Ile missense ATM 1 83162 1.20247E-5 41581 0 8.24429E-6
11-108124628-T-C p.Phe662Phe synonymous ATM 51 83202 6.12966E-4 41601 0 4.77373E-4
11-108124654-T-A p.Ile671Lys missense ATM 3 83218 3.60499E-5 41609 0 7.95532E-6
11-108124661-G-A p.Lys673Lys synonymous ATM 1 83228 1.20152E-5 41614 0 NA
11-108124663-A-G p.His674Arg missense ATM 12 83232 1.44175E-4 41616 0 0.00100705
11-108124670-C-A p.Ser676Ser synonymous ATM 1 83230 1.20149E-5 41615 0 NA
11-108124678-G-C p.Gly679Ala missense ATM 1 83228 1.20152E-5 41614 0 6.37105E-5
11-108124682-C-T p.Phe680Phe synonymous ATM 6 83226 7.20929E-5 41613 1 0.00251762
11-108124685-T-A p.Ser681Ser synonymous ATM 1 83214 1.20172E-5 41607 0 NA
11-108124690-A-G p.His683Arg missense ATM 2 83202 2.40379E-5 41601 0 3.97801E-6
11-108124693-A-G p.Gln684Arg missense ATM 1 83206 1.20184E-5 41603 0 1.59118E-5
11-108124704-G-A p.Glu688Lys missense ATM 1 83180 1.20221E-5 41590 0 5.03525E-4
11-108124706-A-G p.Glu688Glu synonymous ATM 2 83176 2.40454E-5 41588 0 8.24946E-6
11-108124712-G-A p.Leu690Leu synonymous ATM 1 83154 1.20259E-5 41577 0 NA
11-108124716-C-T p.Arg692Cys missense ATM 1 83136 1.20285E-5 41568 0 5.03525E-4
11-108124716-C-G p.Arg692Gly missense ATM 1 83136 1.20285E-5 41568 0 NA
11-108124724-T-C p.Leu694Leu synonymous ATM 2 83082 2.40726E-5 41541 0 2.47983E-5
11-108124727-G-A p.Leu695Leu synonymous ATM 1 83068 1.20383E-5 41534 0 3.18695E-5
11-108124730-A-T p.Gly696Gly synonymous ATM 1 83050 1.20409E-5 41525 0 NA
11-108124738-A-G p.Glu699Gly missense ATM 28 82974 3.37455E-4 41487 0 6.05057E-4
11-108124761-T-C p.Ser707Pro missense ATM 815 82526 0.00987568 41263 2 0.0125881
11-108124766-G-GATTACAAATTCAGAAACTCTTGTCCGGTGTTCAC c.2124_2124+1insATTACAAATTCAGAAACTCTTGTCCGGTGTTCAC splice_donor ATM 1 82468 1.21259E-5 41234 0 NA
11-108124772-A-AT c.2124+6_2124+7insT splice_region ATM 1 82112 1.21785E-5 41056 0 8.51789E-6
11-108126938-T-C c.2125-4T>C splice_region ATM 1 82432 1.21312E-5 41216 0 NA
11-108126944-T-G p.Ile709Met missense+splice_region ATM 3 82542 3.63451E-5 41271 0 NA
11-108126944-T-C p.Ile709Ile splice_region+synonymous ATM 23 82542 2.78646E-4 41271 0 0.00133641
11-108126965-C-G p.Val716Val synonymous ATM 1 82818 1.20747E-5 41409 0 NA
11-108126966-C-T p.Arg717Trp missense ATM 2 82790 2.41575E-5 41395 0 4.95983E-5
11-108126967-G-C p.Arg717Pro missense ATM 2 82772 2.41628E-5 41386 0 3.19366E-5
11-108126967-G-A p.Arg717Gln missense ATM 1 82772 1.20814E-5 41386 0 1.9947E-5
11-108126975-C-T p.Arg720Cys missense ATM 3 82908 3.61847E-5 41454 0 3.30082E-5
11-108126976-G-A p.Arg720His missense ATM 7 82902 8.4437E-5 41451 0 6.37714E-5
11-108126986-G-T p.Val723Val synonymous ATM 2 82972 2.41045E-5 41486 0 5.04032E-4
11-108126992-C-T p.Val725Val synonymous ATM 1 82984 1.20505E-5 41492 0 1.64908E-5
11-108126998-C-T p.Gly727Gly synonymous ATM 1 82998 1.20485E-5 41499 0 NA
11-108127004-C-T p.Tyr729Tyr synonymous ATM 21 83012 2.52975E-4 41506 0 3.29777E-5
11-108127006-G-A p.Cys730Tyr missense ATM 2 83012 2.40929E-5 41506 0 6.37389E-5
11-108127010-C-T p.Tyr731Tyr synonymous ATM 583 82982 0.00702562 41491 16 0.0131654
11-108127018-T-TC p.Ile735fs frameshift ATM 1 83004 1.20476E-5 41502 0 3.98073E-6
11-108127024-C-T p.Ala736Val missense ATM 1 82998 1.20485E-5 41499 0 7.96223E-6
11-108127037-A-G p.Ala740Ala synonymous ATM 5 82958 6.02715E-5 41479 0 1.23738E-4
11-108127039-A-G p.Tyr741Cys missense ATM 3 82972 3.61568E-5 41486 0 3.18613E-5
11-108127062-G-T p.Ala749Ser missense ATM 1 82840 1.20715E-5 41420 0 NA
11-108127067-G-A p.Lys750Lys splice_region+synonymous ATM 3 82858 3.62065E-5 41429 0 4.38708E-5
11-108127074-G-A c.2250+7G>A splice_region ATM 1 82802 1.2077E-5 41401 0 3.99147E-6
11-108128211-C-G p.Leu752Val missense ATM 2 83214 2.40344E-5 41607 0 8.27746E-6
11-108128211-C-T p.Leu752Leu synonymous ATM 1 83214 1.20172E-5 41607 0 NA
11-108128217-C-A p.Gln754Lys missense ATM 2 83232 2.40292E-5 41616 0 3.18451E-5
11-108128219-A-G p.Gln754Gln synonymous ATM 1 83242 1.20132E-5 41621 0 2.47803E-5
11-108128220-T-C p.Cys755Arg missense ATM 2 83242 2.40263E-5 41621 0 3.98441E-6
11-108128226-G-A p.Gly757Arg missense ATM 1 83254 1.20114E-5 41627 0 3.18431E-5
11-108128227-G-T p.Gly757Val missense ATM 1 83262 1.20103E-5 41631 0 NA
11-108128232-A-G p.Ser759Gly missense ATM 10 83268 1.20094E-4 41634 0 3.18504E-5
11-108128238-A-T p.Thr761Ser missense ATM 3 83272 3.60265E-5 41636 0 5.04032E-4
11-108128239-C-T p.Thr761Ile missense ATM 1 83278 1.2008E-5 41639 0 NA
11-108128246-T-A p.Phe763Leu missense ATM 106 83290 0.00127266 41645 0 0.00453629
11-108128274-A-G p.Ile773Val missense ATM 1 83286 1.20068E-5 41643 0 NA
11-108128290-A-G p.Asn778Ser missense ATM 1 83274 1.20085E-5 41637 0 1.19346E-5
11-108128295-A-T p.Met780Leu missense ATM 1 83266 1.20097E-5 41633 0 8.24008E-6
11-108128303-A-G p.Leu782Leu synonymous ATM 4 83248 4.80492E-5 41624 0 1.07132E-4
11-108128310-C-T p.Arg785Cys missense ATM 2 83238 2.40275E-5 41619 0 1.19383E-5
11-108128311-G-A p.Arg785His missense ATM 3 83230 3.60447E-5 41615 0 2.38787E-5
11-108128319-A-C p.Ser788Arg missense ATM 104 83190 0.00125015 41595 0 0.00232454
11-108128320-G-A p.Ser788Asn missense ATM 3 83190 3.6062E-5 41595 0 NA
11-108128330-C-T p.Thr791Thr synonymous ATM 2 83130 2.40587E-5 41565 0 NA
11-108128331-A-G p.Lys792Glu missense+splice_region ATM 1 83134 1.20288E-5 41567 0 7.96514E-6
11-108129707-T-A c.2377-6T>A splice_region ATM 4 82866 4.82707E-5 41433 0 3.9826E-6
11-108129713-A-C p.Lys793Gln missense+splice_region ATM 1 82936 1.20575E-5 41468 0 NA
11-108129715-G-A p.Lys793Lys splice_region+synonymous ATM 1 82950 1.20555E-5 41475 0 3.9814E-6
11-108129720-C-T p.Pro795Leu missense ATM 1 82968 1.20528E-5 41484 0 NA
11-108129722-A-C p.Asn796His missense ATM 1 82996 1.20488E-5 41498 0 8.32681E-6
11-108129730-T-C p.Ile798Ile synonymous ATM 1 83040 1.20424E-5 41520 0 3.97997E-6
11-108129732-C-T p.Ala799Val missense ATM 1 83060 1.20395E-5 41530 0 6.37024E-5
11-108129740-T-C p.Phe802Leu missense ATM 1 83066 1.20386E-5 41533 0 NA
11-108129742-T-C p.Phe802Phe synonymous ATM 1 83074 1.20375E-5 41537 0 3.97994E-6
11-108129761-T-A p.Ser809Thr missense ATM 1 83076 1.20372E-5 41538 0 NA
11-108129778-C-A p.Asp814Glu missense ATM 264 83018 0.00318003 41509 7 0.00705645
11-108129778-C-T p.Asp814Asp synonymous ATM 2 83026 2.40888E-5 41513 0 3.18492E-5
11-108129782-GC-CT p.Ala816Leu missense ATM 3 83028 3.61324E-5 41514 0 NA
11-108129785-G-C p.Asp817His missense ATM 1 83024 1.20447E-5 41512 0 2.90818E-4
11-108129786-A-G p.Asp817Gly missense ATM 1 83014 1.20462E-5 41507 0 NA
11-108129792-G-C p.Cys819Ser missense ATM 1 82976 1.20517E-5 41488 0 NA
11-108129802-A-G p.Leu822Leu splice_region+synonymous ATM 2 82952 2.41103E-5 41476 0 3.1837E-5
11-108129803-G-GCA c.2466+1_2466+2insCA splice_donor ATM 1 82910 1.20613E-5 41455 0 NA
11-108129806-A-C c.2466+4A>C splice_region ATM 1 82878 1.20659E-5 41439 0 8.89585E-6
11-108129809-A-G c.2466+7A>G splice_region ATM 10 82794 1.20782E-4 41397 0 3.52135E-4
11-108129810-T-A c.2466+8T>A splice_region ATM 1 82794 1.20782E-5 41397 0 9.05256E-6
11-108129810-T-C c.2466+8T>C splice_region ATM 1 82794 1.20782E-5 41397 0 1.81051E-5
11-108137891-C-T c.2467-7C>T splice_region ATM 6 83072 7.22265E-5 41536 0 2.38947E-5
11-108137897-G-A c.2467-1G>A splice_acceptor ATM 2 83118 2.40622E-5 41559 0 3.98146E-6
11-108137898-G-A p.Ala823Thr missense+splice_region ATM 1 83138 1.20282E-5 41569 0 NA
11-108137905-T-G p.Phe825Cys missense ATM 1 83176 1.20227E-5 41588 0 NA
11-108137907-A-C p.Ile826Leu missense ATM 7 83188 8.41468E-5 41594 0 5.00509E-5
11-108137925-C-T p.Arg832Cys missense ATM 25 83236 3.00351E-4 41618 0 0.00151057
11-108137925-CG-AT p.Arg832Ile missense ATM 1 83236 1.2014E-5 41618 0 NA
11-108137926-G-A p.Arg832His missense ATM 6 83246 7.20755E-5 41623 0 5.03525E-4
11-108137926-G-T p.Arg832Leu missense ATM 1 83246 1.20126E-5 41623 0 8.75169E-5
11-108137931-G-T p.Glu834* stop_gained ATM 1 83262 1.20103E-5 41631 0 NA
11-108137931-GA-CT p.Glu834Leu missense ATM 1 83262 1.20103E-5 41631 0 NA
11-108137932-A-T p.Glu834Val missense ATM 3 83268 3.60282E-5 41634 0 3.9775E-6
11-108137948-A-G p.Glu839Glu synonymous ATM 2 83270 2.40183E-5 41635 0 5.04032E-4
11-108137953-A-C p.Asp841Ala missense ATM 4 83262 4.80411E-5 41631 0 2.55945E-4
11-108137953-A-G p.Asp841Gly missense ATM 1 83264 1.201E-5 41632 0 NA
11-108137962-G-A p.Gly844Glu missense ATM 1 83276 1.20083E-5 41638 0 5.04032E-4
11-108137963-A-T p.Gly844Gly synonymous ATM 2 83276 2.40165E-5 41638 0 NA
11-108137981-G-A p.Glu850Glu synonymous ATM 1 83274 1.20085E-5 41637 0 7.95526E-6
11-108137982-G-A p.Asp851Asn missense ATM 2 83284 2.40142E-5 41642 0 NA
11-108137983-A-G p.Asp851Gly missense ATM 4 83288 4.80261E-5 41644 0 8.24565E-6
11-108137992-C-A p.Ser854Tyr missense ATM 12 83296 1.44065E-4 41648 0 8.24389E-6
11-108137994-A-C p.Met855Leu missense ATM 1 83304 1.20042E-5 41652 0 NA
11-108138002-A-T p.Leu857Leu synonymous ATM 1 83288 1.20065E-5 41644 0 NA
11-108138002-A-G p.Leu857Leu synonymous ATM 1 83288 1.20065E-5 41644 0 3.18532E-5
11-108138003-T-C p.Phe858Leu missense ATM 826 83280 0.00991835 41640 7 0.0191339
11-108138008-C-T p.Asn859Asn synonymous ATM 1 83284 1.20071E-5 41642 0 6.3743E-5
11-108138009-G-A p.Asp860Asn missense ATM 1 83286 1.20068E-5 41643 0 6.25E-4
11-108138010-A-T p.Asp860Val missense ATM 1 83294 1.20057E-5 41647 0 8.24198E-6
11-108138034-A-G p.Asp868Gly missense ATM 1 83284 1.20071E-5 41642 0 5.56802E-5
11-108138037-C-T p.Ala869Val missense ATM 2 83272 2.40177E-5 41636 0 1.19317E-5
11-108138037-C-G p.Ala869Gly missense ATM 5 83272 6.00442E-5 41636 0 1.27453E-4
11-108138039-A-G p.Asn870Asp missense ATM 58 83280 6.96446E-4 41640 1 0.0013703
11-108138041-C-T p.Asn870Asn synonymous ATM 7 83272 8.40619E-5 41636 0 3.18796E-5
11-108138045-C-T p.Pro872Ser missense ATM 501 83250 0.00601802 41625 11 0.0117021
11-108138046-C-T p.Pro872Leu missense ATM 1 83268 1.20094E-5 41634 0 NA
11-108138050-A-G p.Gly873Gly synonymous ATM 1 83272 1.20088E-5 41636 0 1.98872E-5
11-108138061-G-C p.Ser877Thr missense ATM 1 83238 1.20137E-5 41619 0 4.9586E-5
11-108138066-A-G p.Ile879Val missense ATM 1 83206 1.20184E-5 41603 0 1.19342E-5
11-108138071-T-TGCC c.2638+2_2638+3insGCC splice_region ATM 1 83160 1.2025E-5 41580 0 NA
11-108138072-A-G c.2638+3A>G splice_region ATM 1 83138 1.20282E-5 41569 0 7.95729E-6
11-108139129-A-AT c.2639-8_2639-7insT splice_region ATM 1 83112 1.2032E-5 41556 0 NA
11-108139134-T-C c.2639-3T>C splice_region ATM 1 83146 1.2027E-5 41573 0 7.96781E-6
11-108139183-A-G p.Leu895Leu synonymous ATM 506 83244 0.00607852 41622 11 0.0117257
11-108139187-T-A p.Phe897Ile missense ATM 5 83264 6.005E-5 41632 0 3.18266E-5
11-108139195-C-T p.Asp899Asp synonymous ATM 3 83262 3.60308E-5 41631 0 6.36983E-5
11-108139196-A-G p.Met900Val missense ATM 2 83262 2.40206E-5 41631 0 3.18471E-5
11-108139218-G-T p.Cys907Phe missense ATM 1 83278 1.2008E-5 41639 0 3.29489E-5
11-108139233-A-G p.Gln912Arg missense ATM 2 83290 2.40125E-5 41645 0 NA
11-108139246-G-T p.Val916Val synonymous ATM 1 83288 1.20065E-5 41644 0 3.97728E-6
11-108139248-C-G p.Ser917Cys missense ATM 1 83290 1.20062E-5 41645 0 NA
11-108139268-C-T p.Arg924Trp missense ATM 5 83292 6.00298E-5 41646 0 0.001875
11-108139298-A-G p.Ser934Gly missense ATM 2 83276 2.40165E-5 41638 0 1.64745E-5
11-108139302-C-T p.Thr935Met missense ATM 6 83272 7.2053E-5 41636 0 9.06096E-5
11-108139303-G-C p.Thr935Thr synonymous ATM 45 83270 5.40411E-4 41635 0 5.03525E-4
11-108139317-A-T p.Lys940Ile missense ATM 2 83266 2.40194E-5 41633 0 8.23764E-6
11-108139321-C-T p.Ser941Ser synonymous ATM 1 83260 1.20106E-5 41630 0 NA
11-108139321-C-A p.Ser941Ser synonymous ATM 2 83258 2.40217E-5 41629 0 5.76644E-5
11-108139340-A-G c.2838+4A>G splice_region ATM 1 83192 1.20204E-5 41596 0 3.98051E-6
11-108141784-A-G c.2839-7A>G splice_region ATM 1 83172 1.20233E-5 41586 0 3.97921E-6
11-108141800-C-T p.Leu950Phe missense ATM 8 83258 9.60869E-5 41629 0 4.77392E-5
11-108141830-C-A p.Pro960Thr missense ATM 1 83306 1.20039E-5 41653 0 NA
11-108141839-A-G p.Met963Val missense ATM 9 83316 1.08022E-4 41658 0 6.36862E-5
11-108141846-A-T p.Asp965Val missense ATM 1 83312 1.20031E-5 41656 0 3.97753E-6
11-108141847-T-C p.Asp965Asp synonymous ATM 1 83310 1.20034E-5 41655 0 3.97753E-6
11-108141860-C-T p.Leu970Leu synonymous ATM 6 83324 7.20081E-5 41662 0 NA
11-108141867-C-T p.Pro972Leu missense ATM 2 83318 2.40044E-5 41659 0 1.65098E-5
11-108141871-A-G p.Leu973Leu splice_region+synonymous ATM 7 83310 8.40235E-5 41655 0 9.56267E-5
11-108141873-CGTAAGAAATTAAAACCTTATGTTATGTTCACTTTAAAGTTATAAAATAACTGATGTGTTCTGTTAAGCTTATAAAGTTGAACTTTTTTTTTTTTTTTACCACAG-C c.2921+1_2922-1del splice_acceptor ATM 8 83314 9.60223E-5 41657 1 NA
11-108141874-G-A c.2921+1G>A splice_donor ATM 4 83308 4.80146E-5 41654 0 2.47786E-5
11-108141874-G-C c.2921+1G>C splice_donor ATM 1 83308 1.20036E-5 41654 0 3.97924E-6
11-108141970-T-A c.2922-8T>A splice_region ATM 1 83226 1.20155E-5 41613 0 NA
11-108141970-T-TA c.2922-8_2922-7insA splice_region ATM 1 83226 1.20155E-5 41613 0 1.20016E-5
11-108141983-T-C p.Val976Ala missense ATM 4 83204 4.80746E-5 41602 0 9.5865E-5
11-108141986-G-A p.Cys977Tyr missense ATM 1 83210 1.20178E-5 41605 0 3.39582E-5
11-108141988-T-C p.Ser978Pro missense ATM 69 83212 8.29207E-4 41606 0 0.00375
11-108141993-G-A p.Leu979Leu synonymous ATM 1 83214 1.20172E-5 41607 0 NA
11-108141995-A-T p.Tyr980Phe missense ATM 1 83210 1.20178E-5 41605 0 NA
11-108141998-G-A p.Arg981His missense ATM 1 83216 1.20169E-5 41608 0 2.79216E-5
11-108142000-C-T p.Arg982Cys missense ATM 1 83212 1.20175E-5 41606 0 1.99171E-5
11-108142001-G-A p.Arg982His missense ATM 3 83212 3.60525E-5 41606 0 5.03525E-4
11-108142001-G-T p.Arg982Leu missense ATM 1 83212 1.20175E-5 41606 0 3.98403E-6
11-108142003-G-A p.Asp983Asn missense ATM 1 83228 1.20152E-5 41614 0 NA
11-108142014-T-G p.Val986Val synonymous ATM 2 83256 2.40223E-5 41628 0 3.97867E-5
11-108142055-A-T p.Asn1000Ile missense ATM 1 83260 1.20106E-5 41630 0 NA
11-108142070-A-G p.Asn1005Ser missense ATM 38 83224 4.56599E-4 41612 0 3.77962E-4
11-108142073-T-C p.Met1006Thr missense ATM 1 83214 1.20172E-5 41607 0 NA
11-108142078-T-C p.Ser1008Pro missense ATM 1 83178 1.20224E-5 41589 0 NA
11-108142086-C-T p.Asn1010Asn synonymous ATM 1 83150 1.20265E-5 41575 0 3.97975E-6
11-108142088-C-A p.Thr1011Lys missense ATM 2 83134 2.40575E-5 41567 0 3.19E-5
11-108142103-G-T p.Gly1016Val missense ATM 1 83048 1.20412E-5 41524 0 NA
11-108142111-C-G p.Leu1019Val missense ATM 1 82964 1.20534E-5 41482 0 NA
11-108142115-C-T p.Thr1020Ile missense ATM 1 82908 1.20616E-5 41454 0 1.1956E-5
11-108142130-T-TAGA p.Phe1025delinsLeuAsp disruptive_inframe_insertion ATM 1 82662 1.20975E-5 41331 0 NA
11-108142137-G-A c.3077+4G>A splice_region ATM 5 82510 6.05987E-5 41255 0 1.91253E-4
11-108142141-C-G c.3077+8C>G splice_region ATM 2 82432 2.42624E-5 41216 0 3.18552E-5
11-108143289-C-T p.Phe1036Phe synonymous ATM 7 83068 8.42683E-5 41534 0 0.00100806
11-108143291-CT-C p.Val1038fs frameshift ATM 1 83082 1.20363E-5 41541 0 NA
11-108143293-G-GT p.Arg1039fs frameshift ATM 1 83106 1.20328E-5 41553 0 NA
11-108143299-A-G p.Met1040Val missense ATM 428 83140 0.00514794 41570 8 0.0113673
11-108143319-T-G p.Leu1046Leu synonymous ATM 1 83178 1.20224E-5 41589 0 7.95893E-6
11-108143324-C-G p.Thr1048Ser missense ATM 2 83170 2.40471E-5 41585 0 NA
11-108143331-T-C p.Leu1050Leu synonymous ATM 12 83202 1.44227E-4 41601 0 0.001875
11-108143332-GAGGTGAGTTTTTGCATTTTTTTAGTAAGATCTCCATTGAAAATTTTAAAGCAGTCTTTGTTTGTTAATGAGTAATTTTTCTCTATTTCATATTTAACCACAGTTCTTTTCCCGT-G p.Glu1051fs frameshift ATM 3 83206 3.60551E-5 41603 0 NA
11-108143333-A-C p.Glu1051Ala missense+splice_region ATM 1 83208 1.20181E-5 41604 0 NA
11-108143341-T-TA c.3153+7_3153+8insA splice_region ATM 1 83198 1.20195E-5 41599 0 NA
11-108143444-C-T c.3154-5C>T splice_region ATM 2 83220 2.40327E-5 41610 0 3.18616E-5
11-108143445-G-A c.3154-4G>A splice_region ATM 58 83220 6.96948E-4 41610 0 0.001875
11-108143445-G-T c.3154-4G>T splice_region ATM 2 83220 2.40327E-5 41610 0 3.18715E-5
11-108143452-G-C p.Asp1053His missense ATM 1 83240 1.20135E-5 41620 0 NA
11-108143456-C-G p.Pro1054Arg missense ATM 1730 83216 0.0207893 41608 17 0.0312185
11-108143470-G-A p.Ala1059Thr missense ATM 1 83230 1.20149E-5 41615 0 6.37186E-5
11-108143473-A-G p.Ile1060Val missense ATM 1 83232 1.20146E-5 41616 0 NA
11-108143483-T-C p.Val1063Ala missense ATM 2 83224 2.40315E-5 41612 0 NA
11-108143487-G-A p.Met1064Ile missense ATM 1 83228 1.20152E-5 41614 0 NA
11-108143505-A-G p.Val1070Val synonymous ATM 1 83192 1.20204E-5 41596 0 3.97836E-6
11-108143511-A-G p.Glu1072Glu synonymous ATM 1 83194 1.20201E-5 41597 0 3.1837E-5
11-108143514-A-AAG p.Phe1074fs frameshift ATM 1 83178 1.20224E-5 41589 0 NA
11-108143514-A-G p.Val1073Val synonymous ATM 3 83178 3.60672E-5 41589 0 3.18431E-5
11-108143526-T-G p.Phe1077Leu missense ATM 1 83116 1.20314E-5 41558 0 NA
11-108143535-C-A p.Asp1080Glu missense ATM 1 83062 1.20392E-5 41531 0 2.47353E-5
11-108143537-A-G p.Asn1081Ser missense ATM 9 83046 1.08374E-4 41523 0 2.14373E-4
11-108143540-A-G p.His1082Arg missense ATM 1 83032 1.20435E-5 41516 0 NA
11-108143544-C-G p.His1083Gln missense ATM 2 83010 2.40935E-5 41505 0 3.98045E-6
11-108143551-C-T p.Arg1086Cys missense ATM 1 82956 1.20546E-5 41478 0 6.37227E-5
11-108143552-G-A p.Arg1086His missense ATM 4 82932 4.82323E-5 41466 0 4.12426E-5
11-108143553-C-T p.Arg1086Arg synonymous ATM 2 82930 2.41167E-5 41465 0 8.24865E-6
11-108143560-G-T p.Ala1089Ser missense ATM 4 82906 4.82474E-5 41453 0 3.18451E-5
11-108143579-G-GATT c.3284_3284+1insATT splice_donor ATM 1 82818 1.20747E-5 41409 0 NA
11-108143586-G-C c.3284+7G>C splice_region ATM 1 82752 1.20843E-5 41376 0 1.65112E-5
11-108150226-A-G p.Gln1098Arg missense ATM 1 82018 1.21924E-5 41009 0 NA
11-108150232-C-T p.Thr1100Met missense ATM 1 82160 1.21714E-5 41080 0 1.21929E-5
11-108150233-G-A p.Thr1100Thr synonymous ATM 7 82202 8.51561E-5 41101 0 3.24018E-5
11-108150236-G-A p.Lys1101Lys synonymous ATM 1 82272 1.21548E-5 41136 0 NA
11-108150237-G-A p.Gly1102Arg missense ATM 1 82270 1.21551E-5 41135 0 1.06735E-5
11-108150257-G-C p.Leu1108Leu synonymous ATM 1 82490 1.21227E-5 41245 0 3.99332E-6
11-108150261-G-A p.Ala1110Thr missense ATM 1 82490 1.21227E-5 41245 0 6.36699E-5
11-108150264-C-G p.Leu1111Val missense ATM 2 82494 2.42442E-5 41247 0 7.97881E-6
11-108150267-C-G p.Pro1112Ala missense ATM 1 82484 1.21236E-5 41242 0 NA
11-108150269-T-A p.Pro1112Pro synonymous ATM 1 82484 1.21236E-5 41242 0 3.1837E-5
11-108150275-G-A p.Lys1114Lys synonymous ATM 69 82434 8.37033E-4 41217 0 5.74007E-4
11-108150279-C-A p.Gln1116Lys missense ATM 1 82436 1.21306E-5 41218 0 NA
11-108150284-A-G p.Gln1117Gln synonymous ATM 1 82434 1.21309E-5 41217 0 8.35729E-6
11-108150285-A-G p.Thr1118Ala missense ATM 7 82428 8.49226E-5 41214 0 6.25E-4
11-108150286-C-T p.Thr1118Ile missense ATM 1 82424 1.21324E-5 41212 0 5.03525E-4
11-108150287-A-G p.Thr1118Thr synonymous ATM 5 82438 6.06516E-5 41219 0 6.3678E-5
11-108150302-A-G p.Ala1123Ala synonymous ATM 2 82320 2.42954E-5 41160 0 8.29752E-6
11-108150302-AT-A p.Tyr1124fs frameshift ATM 1 82320 1.21477E-5 41160 0 NA
11-108150304-A-T p.Tyr1124Phe missense ATM 4 82290 4.86086E-5 41145 0 6.25E-4
11-108150305-C-G p.Tyr1124* stop_gained ATM 2 82262 2.43126E-5 41131 0 3.98533E-6
11-108150306-T-C p.Leu1125Leu synonymous ATM 1 82250 1.21581E-5 41125 0 3.18801E-5
11-108150311-A-G p.Lys1126Lys synonymous ATM 6 82172 7.30176E-5 41086 0 6.36902E-5
11-108150313-CTCAG-C p.Gln1128fs frameshift ATM 1 82146 1.21734E-5 41073 0 NA
11-108150316-A-G p.Gln1128Arg missense ATM 258 82060 0.00314404 41030 2 0.00592244
11-108150340-T-C c.3402+5T>C splice_region ATM 1 81280 1.23031E-5 40640 0 3.99297E-6
11-108151732-C-G p.Ala1138Gly missense ATM 1 83062 1.20392E-5 41531 0 NA
11-108151746-A-T p.Thr1143Ser missense ATM 1 83142 1.20276E-5 41571 0 NA
11-108151758-A-G p.Ile1147Val missense ATM 2 83196 2.40396E-5 41598 0 8.26269E-6
11-108151765-A-G p.Asn1149Ser missense ATM 1 83210 1.20178E-5 41605 0 1.99062E-5
11-108151766-T-G p.Asn1149Lys missense ATM 2 83206 2.40367E-5 41603 0 NA
11-108151768-G-C p.Arg1150Thr missense ATM 1 83216 1.20169E-5 41608 0 1.89794E-4
11-108151786-C-T p.Thr1156Met missense ATM 1 83248 1.20123E-5 41624 0 6.37349E-5
11-108151787-G-A p.Thr1156Thr synonymous ATM 6 83250 7.20721E-5 41625 0 4.37633E-5
11-108151790-G-A p.Leu1157Leu synonymous ATM 1 83256 1.20111E-5 41628 0 NA
11-108151792-T-C p.Ile1158Thr missense ATM 1 83258 1.20109E-5 41629 0 NA
11-108151797-G-C p.Val1160Leu missense ATM 2 83272 2.40177E-5 41636 0 8.24198E-6
11-108151824-G-A p.Glu1169Lys missense ATM 2 83260 2.40211E-5 41630 0 8.24049E-6
11-108151829-A-G p.Lys1170Lys synonymous ATM 1 83264 1.201E-5 41632 0 NA
11-108151833-G-C p.Ala1172Pro missense ATM 2 83258 2.40217E-5 41629 0 3.18593E-5
11-108151836-T-C p.Leu1173Leu synonymous ATM 40 83262 4.80411E-4 41631 0 8.27973E-4
11-108151851-A-G p.Lys1178Glu missense ATM 1 83252 1.20117E-5 41626 0 NA
11-108151857-G-A p.Val1180Met missense ATM 1 83248 1.20123E-5 41624 0 5.03525E-4
11-108151877-A-C p.Glu1186Asp missense ATM 2 83174 2.4046E-5 41587 0 NA
11-108151878-C-A p.Pro1187Thr missense ATM 1 83168 1.20239E-5 41584 0 NA
11-108151888-T-C p.Val1190Ala missense ATM 1 83136 1.20285E-5 41568 0 NA
11-108151895-G-A p.Lys1192Lys splice_region+synonymous ATM 1 83086 1.20357E-5 41543 0 1.65115E-5
11-108153431-G-A c.3577-6G>A splice_region ATM 5 82538 6.05782E-5 41269 0 2.48723E-5
11-108153431-G-T c.3577-6G>T splice_region ATM 2 82542 2.42301E-5 41271 0 NA
11-108153433-G-T c.3577-4G>T splice_region ATM 1 82604 1.2106E-5 41302 0 NA
11-108153437-G-A p.Val1193Ile missense+splice_region ATM 1 82680 1.20948E-5 41340 0 1.59669E-5
11-108153448-A-G p.Lys1196Lys synonymous ATM 3 82790 3.62363E-5 41395 0 3.30743E-5
11-108153450-T-C p.Val1197Ala missense ATM 1 82818 1.20747E-5 41409 0 3.98924E-6
11-108153456-A-G p.Glu1199Gly missense ATM 1 82840 1.20715E-5 41420 0 5.03525E-4
11-108153461-T-A p.Phe1201Ile missense ATM 3 82870 3.62013E-5 41435 0 3.18552E-5
11-108153473-C-T p.Arg1205Cys missense ATM 1 82936 1.20575E-5 41468 0 3.30213E-5
11-108153477-T-C p.Leu1206Ser missense ATM 2 82956 2.41092E-5 41478 0 NA
11-108153488-A-G p.Met1210Val missense ATM 6 82996 7.22926E-5 41498 0 1.91144E-4
11-108153489-T-C p.Met1210Thr missense ATM 1 82994 1.20491E-5 41497 0 8.25396E-6
11-108153490-G-A p.Met1210Ile missense ATM 4 82994 4.81963E-5 41497 0 0.00100705
11-108153491-G-A p.Ala1211Thr missense ATM 1 82992 1.20494E-5 41496 0 NA
11-108153499-T-C p.His1213His synonymous ATM 1 82990 1.20496E-5 41495 0 1.19477E-5
11-108153525-T-C p.Leu1222Pro missense ATM 10 82910 1.20613E-4 41455 0 NA
11-108153540-C-G p.Thr1227Ser missense ATM 2 82836 2.41441E-5 41418 0 NA
11-108153551-T-C p.Leu1231Leu synonymous ATM 1 82748 1.20849E-5 41374 0 4.02979E-6
11-108153553-A-T p.Leu1231Phe missense ATM 1 82704 1.20913E-5 41352 0 NA
11-108153555-C-T p.Ser1232Phe missense ATM 1 82678 1.20951E-5 41339 0 8.52791E-6
11-108153564-CTTTTA-C p.Leu1238fs frameshift ATM 2 82518 2.42371E-5 41259 0 NA
11-108153583-C-T p.Tyr1241Tyr synonymous ATM 2 82048 2.4376E-5 41024 0 3.18593E-5
11-108153603-A-G p.Tyr1248Cys missense ATM 1 81406 1.22841E-5 40703 0 1.88541E-5
11-108153606-G-GATCTT c.3746_3746+1insATCTT splice_donor ATM 3 81210 3.69413E-5 40605 1 NA
11-108154946-A-G c.3747-8A>G splice_region ATM 1 81882 1.22127E-5 40941 0 NA
11-108154967-G-A p.Val1254Ile missense ATM 1 82782 1.20799E-5 41391 0 9.13542E-6
11-108154976-C-T p.Pro1257Ser missense ATM 1 82878 1.20659E-5 41439 0 NA
11-108154992-G-T p.Arg1262Ile missense ATM 3 83012 3.61394E-5 41506 0 NA
11-108154997-C-T p.His1264Tyr missense ATM 1 83032 1.20435E-5 41516 0 NA
11-108155000-T-C p.Phe1265Leu missense ATM 2 83026 2.40888E-5 41513 0 9.55657E-5
11-108155007-AG-A p.Val1268fs frameshift ATM 1 83058 1.20398E-5 41529 0 3.98162E-5
11-108155009-G-A p.Val1268Met missense ATM 1 83060 1.20395E-5 41530 0 3.9813E-6
11-108155013-A-G p.Lys1269Arg missense ATM 1 83088 1.20354E-5 41544 0 9.55901E-5
11-108155019-T-C p.Ile1271Thr missense ATM 2 83086 2.40714E-5 41543 0 NA
11-108155030-A-T p.Ile1275Phe missense ATM 3 83110 3.60967E-5 41555 0 NA
11-108155038-G-A p.Glu1277Glu synonymous ATM 1 83086 1.20357E-5 41543 0 NA
11-108155041-C-A p.Asp1278Glu missense ATM 2 83082 2.40726E-5 41541 0 8.256E-6
11-108155046-A-G p.Lys1280Arg missense ATM 2 83082 2.40726E-5 41541 0 NA
11-108155050-T-C p.Ser1281Ser synonymous ATM 2 83076 2.40743E-5 41538 0 NA
11-108155104-C-T p.Ala1299Ala synonymous ATM 1 83122 1.20305E-5 41561 0 NA
11-108155106-A-G p.Tyr1300Cys missense ATM 1 83118 1.20311E-5 41559 0 6.25E-4
11-108155122-C-T p.Asp1305Asp synonymous ATM 4 83126 4.81197E-5 41563 0 NA
11-108155126-G-A p.Gly1307Arg missense ATM 7 83116 8.42196E-5 41558 0 0.0025
11-108155132-G-A p.Ala1309Thr missense ATM 49 83100 5.89651E-4 41550 0 7.00949E-4
11-108155158-G-A p.Lys1317Lys synonymous ATM 1 83074 1.20375E-5 41537 0 NA
11-108155170-G-A p.Met1321Ile missense ATM 6 82994 7.22944E-5 41497 0 1.15452E-4
11-108155185-C-A p.Asn1326Lys missense ATM 4 82880 4.82625E-5 41440 0 6.37267E-5
11-108155185-C-G p.Asn1326Lys missense ATM 1 82882 1.20653E-5 41441 0 NA
11-108155203-A-G c.3993+3A>G splice_region ATM 1 82640 1.21007E-5 41320 0 1.65262E-5
11-108155205-G-T c.3993+5G>T splice_region ATM 91 82598 0.00110172 41299 0 0.00258028
11-108158320-C-T c.3994-7C>T splice_region ATM 4 78980 5.06457E-5 39490 0 3.18695E-5
11-108158326-G-T c.3994-1G>T splice_acceptor ATM 1 79208 1.2625E-5 39604 0 NA
11-108158334-A-G p.His1334Arg missense ATM 2 79412 2.51851E-5 39706 0 8.35673E-6
11-108158344-T-C p.Ile1337Ile synonymous ATM 1 79556 1.25698E-5 39778 0 NA
11-108158353-A-G p.Leu1340Leu synonymous ATM 1 79664 1.25527E-5 39832 0 NA
11-108158365-G-C p.Val1344Val synonymous ATM 1 79788 1.25332E-5 39894 0 3.18593E-5
11-108158375-T-C p.Leu1348Leu synonymous ATM 207 79830 0.00259301 39915 1 0.00563766
11-108158382-C-T p.Thr1350Met missense ATM 1 79814 1.25291E-5 39907 0 5.22563E-5
11-108158383-G-A p.Thr1350Thr synonymous ATM 3 79804 3.75921E-5 39902 0 5.18135E-4
11-108158389-T-C p.His1352His synonymous ATM 2 79832 2.50526E-5 39916 0 4.01958E-6
11-108158393-C-A p.Pro1354Thr missense ATM 36 79820 4.51015E-4 39910 0 6.25E-4
11-108158399-A-G p.Asn1356Asp missense ATM 10 79814 1.25291E-4 39907 0 1.59236E-4
11-108158412-G-A p.Ser1360Asn missense ATM 1 79788 1.25332E-5 39894 0 3.18532E-5
11-108158415-A-G p.Gln1361Arg missense ATM 13 79788 1.62932E-4 39894 0 6.25E-4
11-108158426-C-G p.Leu1365Val missense ATM 1 79748 1.25395E-5 39874 0 4.02301E-6
11-108158443-G-GGA c.4109+1_4109+2insGA splice_donor ATM 4 79510 5.03081E-5 39755 2 NA
11-108158448-T-C c.4109+6T>C splice_region ATM 5 79452 6.29311E-5 39726 0 5.13567E-5
11-108159700-T-C c.4110-4T>C splice_region ATM 1 83014 1.20462E-5 41507 0 8.24525E-6
11-108159714-C-T p.Pro1374Ser missense ATM 1 83058 1.20398E-5 41529 0 1.64867E-5
11-108159718-C-A p.Ala1375Asp missense ATM 1 83068 1.20383E-5 41534 0 NA
11-108159719-T-C p.Ala1375Ala synonymous ATM 2 83064 2.40778E-5 41532 0 NA
11-108159732-C-T p.His1380Tyr missense ATM 812 83044 0.00977795 41522 27 0.0210191
11-108159742-C-T p.Ser1383Leu missense ATM 4 83030 4.81754E-5 41515 0 6.37267E-5
11-108159743-G-A p.Ser1383Ser synonymous ATM 3 83008 3.61411E-5 41504 0 8.24552E-6
11-108159747-G-T p.Val1385Leu missense ATM 1 83018 1.20456E-5 41509 0 3.97953E-6
11-108159761-A-G p.Thr1389Thr synonymous ATM 7 82970 8.43678E-5 41485 0 1.1143E-4
11-108159773-C-G p.Ile1393Met missense ATM 1 82970 1.20525E-5 41485 0 3.98054E-6
11-108159778-A-G p.Asn1395Ser missense ATM 1 82956 1.20546E-5 41478 0 NA
11-108159808-T-TTCTACTG p.Leu1405fs frameshift ATM 2 82708 2.41815E-5 41354 0 NA
11-108159810-G-A p.Glu1406Lys missense ATM 1 82676 1.20954E-5 41338 0 NA
11-108159829-C-A p.Pro1412His missense+splice_region ATM 1 82082 1.21829E-5 41041 0 NA
11-108159831-G-GATTCC c.4236+1_4236+2insATTCC splice_donor ATM 3 81996 3.65871E-5 40998 1 NA
11-108159831-G-GATTCCTATCAGAAAATTCTTCTTGCCA c.4236+1_4236+2insATTCCTATCAGAAAATTCTTCTTGCCA splice_donor ATM 1 81996 1.21957E-5 40998 0 NA
11-108160331-T-C p.Asp1413Asp splice_region+synonymous ATM 1 81144 1.23238E-5 40572 0 NA
11-108160350-C-T p.Leu1420Phe missense ATM 964 81754 0.0117915 40877 8 0.0127074
11-108160371-G-A p.Ala1427Thr missense ATM 14 82342 1.70023E-4 41171 0 9.55779E-5
11-108160372-C-T p.Ala1427Val missense ATM 1 82352 1.2143E-5 41176 0 NA
11-108160396-A-G p.Lys1435Arg missense ATM 1 82796 1.20779E-5 41398 0 8.42801E-6
11-108160398-C-T p.His1436Tyr missense ATM 1 82808 1.20761E-5 41404 0 5.0551E-5
11-108160413-A-C p.Ile1441Leu missense ATM 2 82930 2.41167E-5 41465 0 2.51847E-5
11-108160416-T-C p.Tyr1442His missense ATM 22 82952 2.65214E-4 41476 0 4.27824E-4
11-108160417-A-G p.Tyr1442Cys missense ATM 1 82954 1.20549E-5 41477 0 3.98606E-6
11-108160421-C-A p.His1443Gln missense ATM 1 82974 1.2052E-5 41487 0 5.04032E-4
11-108160424-G-A p.Leu1444Leu synonymous ATM 2 83000 2.40964E-5 41500 0 1.19548E-5
11-108160424-G-C p.Leu1444Leu synonymous ATM 3 83000 3.61446E-5 41500 0 8.37212E-6
11-108160425-T-C p.Phe1445Leu missense ATM 1 82996 1.20488E-5 41498 0 NA
11-108160439-A-C p.Leu1449Phe missense ATM 1 83072 1.20378E-5 41536 0 8.35785E-6
11-108160449-A-T p.Ile1453Leu missense ATM 1 83104 1.20331E-5 41552 0 NA
11-108160453-A-G p.Lys1454Arg missense ATM 1 83134 1.20288E-5 41567 0 3.98143E-6
11-108160454-A-C p.Lys1454Asn missense ATM 15 83138 1.80423E-4 41569 0 3.75877E-4
11-108160467-G-A p.Gly1459Arg missense ATM 8 83154 9.6207E-5 41577 0 1.27372E-4
11-108160480-T-G p.Phe1463Cys missense ATM 252 83138 0.0030311 41569 1 0.00302115
11-108160488-C-G p.Arg1466Gly missense ATM 3 83080 3.61098E-5 41540 0 3.18573E-5
11-108160490-A-G p.Arg1466Arg synonymous ATM 3 83074 3.61124E-5 41537 0 3.98267E-6
11-108160494-G-A p.Val1468Ile missense ATM 7 83026 8.43109E-5 41513 0 2.23044E-4
11-108160496-T-C p.Val1468Val synonymous ATM 1 83042 1.20421E-5 41521 0 NA
11-108160506-T-G p.Leu1472Val missense ATM 5 82924 6.02962E-5 41462 0 1.59195E-4
11-108160508-G-A p.Leu1472Leu synonymous ATM 3 82916 3.61812E-5 41458 0 NA
11-108160512-C-G p.His1474Asp missense ATM 1 82898 1.2063E-5 41449 0 7.98754E-6
11-108160512-C-A p.His1474Asn missense ATM 1 82898 1.2063E-5 41449 0 NA
11-108160516-A-G p.Tyr1475Cys missense ATM 54 82782 6.52316E-4 41391 0 5.99506E-4
11-108160518-A-G p.Ile1476Val missense ATM 1 82752 1.20843E-5 41376 0 NA
11-108160523-C-A p.Asn1477Lys missense ATM 1 82670 1.20963E-5 41335 0 NA
11-108160528-G-GGCCTTCTT c.4436+1_4436+2insCCTTCTTG splice_donor ATM 1 82590 1.2108E-5 41295 0 NA
11-108163339-A-G c.4437-7A>G splice_region ATM 3 82858 3.62065E-5 41429 0 4.94291E-5
11-108163354-G-A p.Cys1482Tyr missense ATM 3 83078 3.61106E-5 41539 0 2.47129E-5
11-108163358-C-T p.Ile1483Ile synonymous ATM 1 83094 1.20346E-5 41547 0 6.39713E-5
11-108163367-G-T p.Val1486Val synonymous ATM 1 83148 1.20267E-5 41574 0 NA
11-108163374-C-T p.Arg1489Cys missense ATM 2 83156 2.40512E-5 41578 0 5.03525E-4
11-108163375-G-A p.Arg1489His missense ATM 2 83166 2.40483E-5 41583 0 6.38488E-5
11-108163377-A-G p.Ser1490Gly missense ATM 1 83168 1.20239E-5 41584 0 7.95887E-6
11-108163382-C-T p.Phe1491Phe synonymous ATM 142 83184 0.00170706 41592 0 0.00138388
11-108163386-C-T p.Leu1493Phe missense ATM 4 83222 4.80642E-5 41611 0 1.27649E-4
11-108163389-T-C p.Cys1494Arg missense ATM 1 83218 1.20166E-5 41609 0 NA
11-108163401-T-C p.Leu1498Leu synonymous ATM 3 83226 3.60464E-5 41613 0 1.64745E-5
11-108163407-C-T p.Gln1500* stop_gained ATM 1 83232 1.20146E-5 41616 0 NA
11-108163407-C-G p.Gln1500Glu missense ATM 1 83232 1.20146E-5 41616 0 NA
11-108163414-G-T p.Cys1502Phe missense ATM 3 83220 3.6049E-5 41610 0 8.2375E-6
11-108163417-A-G p.Gln1503Arg missense ATM 1 83222 1.20161E-5 41611 0 NA
11-108163438-A-G p.Lys1510Arg missense ATM 1 83250 1.2012E-5 41625 0 3.97855E-6
11-108163444-C-T p.Ala1512Val missense ATM 1 83244 1.20129E-5 41622 0 NA
11-108163453-A-C p.Asn1515Thr missense ATM 1 83254 1.20114E-5 41627 0 NA
11-108163458-C-T p.Leu1517Phe missense ATM 1 83260 1.20106E-5 41630 0 1.6475E-5
11-108163462-A-C p.His1518Pro missense ATM 1 83252 1.20117E-5 41626 0 8.23764E-6
11-108163470-G-C p.Val1521Leu missense ATM 4 83262 4.80411E-5 41631 0 8.23737E-6
11-108163473-G-A p.Gly1522Ser missense ATM 2 83260 2.40211E-5 41630 0 3.97855E-6
11-108163485-C-T p.Pro1526Ser missense ATM 1 83248 1.20123E-5 41624 0 NA
11-108163486-C-A p.Pro1526His missense ATM 1 83240 1.20135E-5 41620 0 6.37511E-5
11-108163487-C-T p.Pro1526Pro synonymous ATM 2884 83160 0.0346801 41580 71 0.0333372
11-108163497-G-T p.Glu1530* stop_gained ATM 1 83230 1.20149E-5 41615 0 NA
11-108163515-A-G p.Lys1536Glu missense ATM 1 83148 1.20267E-5 41574 0 1.99008E-4
11-108163518-CAG-C p.Glu1533fs frameshift ATM 1 83124 1.20302E-5 41562 0 NA
11-108163522-T-TATTGGACTTGTTGA c.4611+2_4611+3insATTGGACTTGTTGA splice_region ATM 1 83106 1.20328E-5 41553 0 NA
11-108164054-G-A p.Leu1542Leu synonymous ATM 2 81080 2.4667E-5 40540 0 8.44901E-6
11-108164059-A-G p.Tyr1544Cys missense ATM 5 81244 6.1543E-5 40622 0 3.32292E-5
11-108164086-A-C p.Glu1553Ala missense ATM 1 82070 1.21847E-5 41035 0 6.37186E-5
11-108164093-C-T p.Leu1555Leu synonymous ATM 6 82228 7.29678E-5 41114 0 4.79386E-5
11-108164094-T-C p.Tyr1556His missense ATM 1 82246 1.21586E-5 41123 0 3.18654E-5
11-108164095-A-G p.Tyr1556Cys missense ATM 3 82238 3.64795E-5 41119 0 3.18634E-5
11-108164101-C-T p.Thr1558Met missense ATM 2 82286 2.43055E-5 41143 0 3.18878E-5
11-108164102-G-A p.Thr1558Thr synonymous ATM 3 82304 3.64502E-5 41152 0 9.57426E-5
11-108164115-G-A p.Asp1563Asn missense ATM 2 82442 2.42595E-5 41221 0 3.19E-5
11-108164131-A-G p.His1568Arg missense ATM 7 82476 8.48732E-5 41238 0 0.00100705
11-108164137-T-C p.Val1570Ala missense ATM 49 82468 5.9417E-4 41234 1 0.00100705
11-108164152-G-A p.Arg1575His missense ATM 8 82440 9.70403E-5 41220 0 1.07206E-4
11-108164159-T-C p.Thr1577Thr synonymous ATM 4 82448 4.85154E-5 41224 0 6.37633E-5
11-108164189-C-T p.Pro1587Pro synonymous ATM 2 82160 2.43427E-5 41080 0 6.25E-4
11-108164196-C-T p.Leu1590Phe missense ATM 15 82044 1.82829E-4 41022 0 6.05404E-4
11-108164206-T-A c.4776+2T>A splice_donor ATM 1 81768 1.22297E-5 40884 0 NA
11-108165669-C-A p.Leu1598Ile missense ATM 5 83064 6.01946E-5 41532 0 6.37105E-5
11-108165679-G-A p.Ser1601Asn missense ATM 4 83112 4.81278E-5 41556 0 6.25E-4
11-108165698-A-G p.Pro1607Pro synonymous ATM 1 83118 1.20311E-5 41559 0 NA
11-108165729-C-T p.Arg1618* stop_gained ATM 1 83180 1.20221E-5 41590 0 8.23873E-6
11-108165730-G-A p.Arg1618Gln missense ATM 4 83172 4.80931E-5 41586 0 4.77452E-5
11-108165733-G-A p.Arg1619Lys missense ATM 1 83186 1.20213E-5 41593 0 3.18431E-5
11-108165748-A-G p.His1624Arg missense ATM 3 83208 3.60542E-5 41604 0 5.03525E-4
11-108165755-T-C p.Asp1626Asp synonymous ATM 5 83216 6.00846E-5 41608 0 1.64769E-5
11-108165786-G-T p.Asp1637Tyr missense+splice_region ATM 1 83148 1.20267E-5 41574 0 NA
11-108165789-G-A c.4909+3G>A splice_region ATM 4 83132 4.81162E-5 41566 0 1.64788E-5
11-108168014-A-G p.Asp1637Gly missense+splice_region ATM 3 82438 3.6391E-5 41219 0 6.25E-4
11-108168020-C-T p.Pro1639Leu missense ATM 1 82494 1.21221E-5 41247 0 2.39149E-5
11-108168021-G-A p.Pro1639Pro synonymous ATM 1 82514 1.21192E-5 41257 0 2.4965E-5
11-108168053-A-G p.Asn1650Ser missense ATM 13 82628 1.57332E-4 41314 0 6.04941E-4
11-108168076-G-A p.Ala1658Thr missense ATM 1 82564 1.21118E-5 41282 0 NA
11-108168079-A-G p.Ile1659Val missense ATM 1 82536 1.21159E-5 41268 0 3.1835E-5
11-108168084-C-T p.Asn1660Asn synonymous ATM 26 82494 3.15174E-4 41247 0 2.51066E-4
11-108168088-A-G p.Thr1662Ala missense ATM 1 82474 1.2125E-5 41237 0 NA
11-108168101-A-C p.Glu1666Ala missense ATM 1 82320 1.21477E-5 41160 0 3.18512E-5
11-108168106-C-T p.Leu1668Leu synonymous ATM 4 82226 4.86464E-5 41113 0 1.99486E-5
11-108168115-CTA-C c.5005+7_5005+8delTA splice_region ATM 16 81990 1.95146E-4 40995 0 2.79481E-4
11-108168116-T-C c.5005+7T>C splice_region ATM 2 81956 2.44033E-5 40978 0 3.19412E-5
11-108170444-C-T p.Ala1670Val missense ATM 7 82544 8.48033E-5 41272 0 3.18512E-5
11-108170471-G-A p.Gly1679Asp missense ATM 1 82768 1.2082E-5 41384 0 NA
11-108170474-C-T p.Pro1680Leu missense ATM 1 82776 1.20808E-5 41388 0 8.24035E-6
11-108170477-T-C p.Ile1681Thr missense ATM 1 82786 1.20793E-5 41393 0 3.98111E-6
11-108170480-A-T p.Asp1682Val missense ATM 1 82802 1.2077E-5 41401 0 NA
11-108170480-A-G p.Asp1682Gly missense ATM 1 82802 1.2077E-5 41401 0 NA
11-108170490-C-T p.Thr1685Thr synonymous ATM 6 82842 7.2427E-5 41421 0 4.37905E-5
11-108170497-A-G p.Ile1688Val missense ATM 1 82826 1.20735E-5 41413 0 8.23913E-6
11-108170504-A-G p.His1690Arg missense ATM 2 82850 2.414E-5 41425 0 NA
11-108170506-A-C p.Ser1691Arg missense ATM 154 82862 0.00185851 41431 0 0.00201865
11-108170515-G-A p.Ala1694Thr missense ATM 2 82864 2.41359E-5 41432 0 1.64791E-5
11-108170523-T-C p.Tyr1696Tyr synonymous ATM 1 82864 1.2068E-5 41432 0 NA
11-108170524-A-G p.Thr1697Ala missense ATM 4 82874 4.8266E-5 41437 0 4.3787E-5
11-108170592-T-C p.Asn1719Asn synonymous ATM 1 82618 1.21039E-5 41309 0 NA
11-108172376-G-A p.Val1727Ile missense+splice_region ATM 1 82812 1.20755E-5 41406 0 NA
11-108172380-A-G p.Lys1728Arg missense ATM 1 82826 1.20735E-5 41413 0 1.19448E-5
11-108172382-G-C p.Val1729Leu missense ATM 19 82840 2.29358E-4 41420 0 0.0015121
11-108172386-G-A p.Arg1730Gln missense ATM 2 82804 2.41534E-5 41402 0 3.2969E-5
11-108172387-A-G p.Arg1730Arg synonymous ATM 1 82830 1.20729E-5 41415 0 NA
11-108172425-C-T p.Thr1743Ile missense ATM 1 82872 1.20668E-5 41436 0 3.18674E-5
11-108172427-A-G p.Lys1744Glu missense ATM 2 82886 2.41295E-5 41443 0 NA
11-108172435-A-G p.Gly1746Gly synonymous ATM 1 82872 1.20668E-5 41436 0 NA
11-108172443-T-G p.Phe1749Cys missense ATM 1 82890 1.20642E-5 41445 0 NA
11-108172446-G-GA p.Trp1750fs frameshift ATM 1 82898 1.2063E-5 41449 0 NA
11-108172448-G-C p.Glu1751Gln missense ATM 1 82880 1.20656E-5 41440 0 5.03525E-4
11-108172464-C-G p.Thr1756Arg missense ATM 1 82846 1.20706E-5 41423 0 NA
11-108172468-A-G p.Thr1757Thr synonymous ATM 2 82836 2.41441E-5 41418 0 NA
11-108172475-A-G p.Met1760Val missense ATM 4 82808 4.83045E-5 41404 0 6.25E-4
11-108172480-GGC-G p.Ala1762fs frameshift ATM 1 82762 1.20828E-5 41381 0 NA
11-108172486-TC-T p.Leu1764fs frameshift ATM 1 82708 1.20907E-5 41354 0 8.25232E-6
11-108172497-T-C p.Phe1767Ser missense ATM 2 82604 2.42119E-5 41302 1 NA
11-108172507-A-G p.Ser1770Ser synonymous ATM 1 82416 1.21336E-5 41208 0 7.96997E-6
11-108172516-G-T p.Lys1773Asn missense+splice_region ATM 1 82232 1.21607E-5 41116 0 NA
11-108172518-TCTC-T c.5319+3_5319+5delCTC splice_region ATM 1 82226 1.21616E-5 41113 0 NA
11-108172523-T-A c.5319+7T>A splice_region ATM 2 82156 2.43439E-5 41078 0 3.99202E-6
11-108172524-A-G c.5319+8A>G splice_region ATM 1 82100 1.21803E-5 41050 0 3.18471E-5
11-108173574-TTCTA-T c.5320-5_5320-2delTCTA splice_acceptor ATM 1 82512 1.21194E-5 41256 0 NA