Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
19-7460013-C-T c.-192C>T 5_prime_UTR_premature_start_codon_gain ARHGEF18 1 22954 4.35654E-5 11477 0 3.18634E-5
19-7460049-G-T c.-156G>T 5_prime_UTR_premature_start_codon_gain ARHGEF18 238 23026 0.0103361 11513 1 0.00943637
19-7460133-GGTGAGGACGGCGGCGGGGCGGT-G c.-72+1_-72+22delGTGAGGACGGCGGCGGGGCGGT splice_donor ARHGEF18 1 22870 4.37254E-5 11435 0 NA
19-7504667-C-T c.-160C>T 5_prime_UTR_premature_start_codon_gain ARHGEF18 17 69618 2.4419E-4 34809 0 5.10758E-4
19-7504774-T-G c.-53T>G 5_prime_UTR_premature_start_codon_gain ARHGEF18 5 78084 6.40336E-5 39042 0 NA
19-7504818-C-G c.-9C>G 5_prime_UTR_premature_start_codon_gain ARHGEF18 2 79516 2.51522E-5 39758 0 NA
19-7504840-G-A p.Gly5Glu missense ARHGEF18 2 79838 2.50507E-5 39919 0 1.39952E-5
19-7504851-C-G p.Leu9Val missense ARHGEF18 1 79914 1.25135E-5 39957 0 3.21502E-5
19-7504865-C-T p.Pro13Pro synonymous ARHGEF18 1 80022 1.24966E-5 40011 0 NA
19-7504871-T-A p.Ala15Ala synonymous ARHGEF18 189 80042 0.00236126 40021 2 0.00700935
19-7504879-A-G p.Asn18Ser missense ARHGEF18 1 80082 1.24872E-5 40041 0 3.21213E-5
19-7504882-C-A p.Thr19Lys missense ARHGEF18 1 80074 1.24884E-5 40037 0 NA
19-7504897-C-T p.Ala24Val missense ARHGEF18 1 80042 1.24934E-5 40021 0 6.40886E-6
19-7504904-G-C p.Leu26Leu synonymous ARHGEF18 1 80020 1.24969E-5 40010 0 1.28394E-4
19-7504926-AGGCATAAAAAC-A p.His35fs frameshift ARHGEF18 4 79946 5.00338E-5 39973 0 3.20677E-5
19-7504932-A-T p.Lys36* stop_gained ARHGEF18 2 79930 2.50219E-5 39965 0 6.41437E-5
19-7504947-C-T p.Gln41* stop_gained ARHGEF18 1 79882 1.25185E-5 39941 0 NA
19-7504948-A-G p.Gln41Arg missense ARHGEF18 1 79884 1.25182E-5 39942 0 NA
19-7504957-C-G p.Ala44Gly missense ARHGEF18 96 79800 0.00120301 39900 0 0.00237575
19-7504959-G-T p.Ala45Ser missense ARHGEF18 17 79792 2.13054E-4 39896 0 2.89073E-4
19-7504963-C-T p.Pro46Leu missense ARHGEF18 37 79766 4.63857E-4 39883 0 0.00125265
19-7504963-C-G p.Pro46Arg missense ARHGEF18 1 79766 1.25367E-5 39883 0 NA
19-7504965-G-C p.Gly47Arg missense ARHGEF18 4 79778 5.01391E-5 39889 0 1.29618E-5
19-7504970-C-T p.Pro48Pro synonymous ARHGEF18 1 79780 1.25345E-5 39890 0 NA
19-7504980-G-A p.Gly52Ser missense ARHGEF18 7 79734 8.77919E-5 39867 0 3.21771E-5
19-7504982-C-T p.Gly52Gly synonymous ARHGEF18 27766 79428 0.349574 39714 4837 0.416667
19-7504997-T-C p.Asn57Asn synonymous ARHGEF18 1 79772 1.25357E-5 39886 0 6.42467E-5
19-7504999-C-G p.Ala58Gly missense ARHGEF18 4 79762 5.01492E-5 39881 0 NA
19-7505000-G-A p.Ala58Ala synonymous ARHGEF18 798 79740 0.0100075 39870 9 0.035503
19-7505012-CG-C p.Asp64fs frameshift ARHGEF18 1 79756 1.25382E-5 39878 0 NA
19-7505012-C-T p.Ser62Ser synonymous ARHGEF18 1 79756 1.25382E-5 39878 0 NA
19-7505013-G-C p.Gly63Arg missense ARHGEF18 2 79784 2.50677E-5 39892 0 NA
19-7505018-C-G p.Asp64Glu missense ARHGEF18 1 79814 1.25291E-5 39907 0 3.20082E-5
19-7505036-C-T p.Pro70Pro synonymous ARHGEF18 15 79868 1.8781E-4 39934 0 5.11967E-4
19-7505039-C-T p.Gly71Gly synonymous ARHGEF18 1 79866 1.2521E-5 39933 0 1.28986E-5
19-7505040-C-T p.Arg72Cys missense ARHGEF18 1 79878 1.25191E-5 39939 0 NA
19-7505041-G-T p.Arg72Leu missense ARHGEF18 1 79874 1.25197E-5 39937 0 6.44729E-6
19-7505046-G-A p.Glu74Lys missense ARHGEF18 1 79930 1.25109E-5 39965 0 NA
19-7505047-A-G p.Glu74Gly missense ARHGEF18 1 79936 1.251E-5 39968 0 6.43641E-6
19-7505051-G-A p.Leu75Leu synonymous ARHGEF18 1 80014 1.24978E-5 40007 0 4.78286E-5
19-7505060-C-T p.Tyr78Tyr synonymous ARHGEF18 3 79994 3.75028E-5 39997 0 4.77281E-5
19-7505069-C-G p.Phe81Leu missense ARHGEF18 1 79996 1.25006E-5 39998 0 NA
19-7505071-C-T p.Pro82Leu missense ARHGEF18 2 80024 2.49925E-5 40012 0 NA
19-7505076-A-C p.Lys84Gln missense ARHGEF18 1 80038 1.24941E-5 40019 0 6.41346E-6
19-7505091-GTCT-G p.Phe90del disruptive_inframe_deletion ARHGEF18 1 80114 1.24822E-5 40057 0 NA
19-7505099-G-A p.Leu91Leu synonymous ARHGEF18 1699 80136 0.0212015 40068 87 0.0456924
19-7505105-C-T c.-196C>T 5_prime_UTR_premature_start_codon_gain ARHGEF18 3 80206 3.74037E-5 40103 1 4.69219E-5
19-7505111-G-A p.Leu95Leu synonymous ARHGEF18 346 80212 0.00431357 40106 6 0.0100434
19-7505132-T-G p.Ser102Ser synonymous ARHGEF18 8 80348 9.95669E-5 40174 0 1.91327E-4
19-7505137-T-C p.Leu104Pro missense ARHGEF18 1 80364 1.24434E-5 40182 0 NA
19-7505146-AG-CT p.Gln107Pro missense ARHGEF18 34 80362 4.23086E-4 40181 0 NA
19-7505146-A-C p.Gln107Pro missense ARHGEF18 1 80362 1.24437E-5 40181 0 0.00107865
19-7505147-G-T p.Gln107His missense ARHGEF18 1 80394 1.24387E-5 40197 0 0.0010773
19-7505154-C-T p.Arg110Trp missense ARHGEF18 3 80368 3.73283E-5 40184 0 5.97922E-6
19-7505155-G-A p.Arg110Gln missense ARHGEF18 5 80406 6.21844E-5 40203 0 8.69187E-5
19-7505158-G-T p.Gly111Val missense ARHGEF18 1 80406 1.24369E-5 40203 0 1.28052E-4
19-7505162-C-G p.Phe112Leu missense ARHGEF18 2 80390 2.48787E-5 40195 0 NA
19-7505163-C-T p.Arg113Cys missense ARHGEF18 306 80396 0.00380616 40198 1 0.00557034
19-7505165-C-T p.Arg113Arg synonymous ARHGEF18 1 80350 1.24456E-5 40175 0 5.70073E-6
19-7505166-G-A p.Ala114Thr missense ARHGEF18 2 80336 2.48954E-5 40168 0 3.19E-5
19-7505166-G-T p.Ala114Ser missense ARHGEF18 1 80336 1.24477E-5 40168 0 NA
19-7505167-C-T p.Ala114Val missense ARHGEF18 2 80372 2.48843E-5 40186 0 9.56877E-5
19-7505168-C-T c.-133C>T 5_prime_UTR_premature_start_codon_gain ARHGEF18 2 80392 2.48781E-5 40196 0 3.18959E-5
19-7505169-G-A p.Gly115Arg missense ARHGEF18 2 80416 2.48707E-5 40208 0 6.25E-4
19-7505172-G-A p.Asp116Asn missense ARHGEF18 1 80438 1.24319E-5 40219 0 5.3392E-6
19-7505177-C-A p.Leu117Leu synonymous ARHGEF18 1 80456 1.24292E-5 40228 0 6.37349E-5
19-7505179-G-A p.Arg118His missense ARHGEF18 7 80442 8.70192E-5 40221 0 5.06868E-6
19-7505180-C-T p.Arg118Arg synonymous ARHGEF18 1 80462 1.24282E-5 40231 0 3.20164E-5
19-7505185-C-T p.Pro120Leu missense ARHGEF18 7 80496 8.69608E-5 40248 0 1.41796E-4
19-7505185-C-G p.Pro120Arg missense ARHGEF18 2 80496 2.4846E-5 40248 0 NA
19-7505186-G-A p.Pro120Pro synonymous ARHGEF18 3 80464 3.72838E-5 40232 0 8.13581E-5
19-7505190-C-T p.His122Tyr missense ARHGEF18 5 80506 6.21072E-5 40253 0 7.12251E-5
19-7505192-C-T p.His122His synonymous ARHGEF18 18 80518 2.23553E-4 40259 0 0.0015121
19-7505206-A-G p.Asn127Ser missense ARHGEF18 2 80580 2.48201E-5 40290 0 4.90918E-5
19-7505208-T-A p.Ser128Thr missense ARHGEF18 1 80586 1.24091E-5 40293 0 NA
19-7505211-G-T p.Val129Phe missense ARHGEF18 1 80582 1.24097E-5 40291 0 3.18674E-5
19-7505212-T-C p.Val129Ala missense ARHGEF18 2 80600 2.48139E-5 40300 0 3.18857E-5
19-7505219-C-G p.Ala131Ala synonymous ARHGEF18 1 80634 1.24017E-5 40317 0 NA
19-7505230-C-G p.Ala135Gly missense ARHGEF18 1 80656 1.23983E-5 40328 0 NA
19-7505230-C-T p.Ala135Val missense ARHGEF18 1 80656 1.23983E-5 40328 0 NA
19-7505232-TCGCTCAAGGAGCAC-T p.Leu137fs frameshift ARHGEF18 3 80646 3.71996E-5 40323 0 NA
19-7505234-G-A p.Ser136Ser synonymous ARHGEF18 3 80636 3.72042E-5 40318 0 6.37796E-5
19-7505246-C-A p.His140Gln missense ARHGEF18 1 80666 1.23968E-5 40333 0 NA
19-7505265-T-C p.Ser147Pro missense ARHGEF18 10 80638 1.24011E-4 40319 0 0.00100705
19-7505267-C-T c.-34C>T 5_prime_UTR_premature_start_codon_gain ARHGEF18 6 80656 7.439E-5 40328 0 3.50497E-4
19-7505268-G-T p.Asp148Tyr missense ARHGEF18 1 80640 1.24008E-5 40320 0 8.45266E-6
19-7505284-T-C p.Leu153Pro missense ARHGEF18 1 80514 1.24202E-5 40257 0 NA
19-7505299-G-C p.Gly158Ala missense ARHGEF18 2 80258 2.49196E-5 40129 0 NA
19-7505306-G-A p.Thr2Thr synonymous ARHGEF18 2 80028 2.49913E-5 40014 0 8.23947E-6
19-7505314-A-G p.Gln5Arg missense ARHGEF18 1 79678 1.25505E-5 39839 0 NA
19-7505320-G-T p.Gly7Val missense ARHGEF18 2 79440 2.51762E-5 39720 0 4.15396E-6
19-7505332-C-A p.Pro11Gln missense ARHGEF18 346 78702 0.00439633 39351 2 0.00809433
19-7505339-G-A p.Pro13Pro synonymous ARHGEF18 1 78110 1.28025E-5 39055 0 6.05515E-5
19-7505345-G-A p.Pro15Pro synonymous ARHGEF18 1 77222 1.29497E-5 38611 0 3.18634E-5
19-7505345-G-T p.Pro15Pro synonymous ARHGEF18 2 77222 2.58994E-5 38611 0 NA
19-7505347-C-T p.Ala16Val missense ARHGEF18 1 76994 1.2988E-5 38497 0 4.22165E-6
19-7505367-G-A p.Gly23Arg missense+splice_region ARHGEF18 126 73824 0.00170676 36912 0 0.0028353
19-7505367-G-C p.Gly23Arg missense+splice_region ARHGEF18 1 73830 1.35446E-5 36915 0 9.05207E-6
19-7505368-G-GACCAATCACA c.68_68+1insACCAATCACA splice_donor ARHGEF18 1 73624 1.35825E-5 36812 0 NA
19-7505368-G-A p.Gly23Glu missense+splice_region ARHGEF18 4 73626 5.43286E-5 36813 0 0.0020141
19-7505369-G-T c.68+1G>T splice_donor ARHGEF18 1 73348 1.36336E-5 36674 0 4.31172E-6
19-7506532-C-T c.69-7C>T splice_region ARHGEF18 2 81026 2.46834E-5 40513 0 8.2496E-6
19-7506537-A-G c.69-2A>G splice_acceptor ARHGEF18 2 81068 2.46706E-5 40534 0 NA
19-7506542-A-G p.Pro24Pro synonymous ARHGEF18 1 81074 1.23344E-5 40537 0 NA
19-7506543-A-G p.Ile25Val missense ARHGEF18 2 81084 2.46658E-5 40542 0 7.95437E-6
19-7506543-AT-A p.Ile25fs frameshift ARHGEF18 1 81084 1.23329E-5 40542 0 NA
19-7506553-A-G p.Glu28Gly missense ARHGEF18 1 81076 1.23341E-5 40538 0 NA
19-7506567-G-A p.Asp33Asn missense ARHGEF18 1 81090 1.2332E-5 40545 0 8.2371E-6
19-7506569-T-C p.Asp33Asp synonymous ARHGEF18 1 81092 1.23317E-5 40546 0 NA
19-7506574-C-T p.Ala35Val missense ARHGEF18 38 81090 4.68615E-4 40545 1 0.00755287
19-7506575-G-A p.Ala35Ala synonymous ARHGEF18 3 81094 3.69941E-5 40547 0 6.37064E-5
19-7506595-C-T p.Thr42Ile missense ARHGEF18 7 81098 8.63153E-5 40549 0 1.19292E-5
19-7506604-ACT-A p.Leu47fs frameshift ARHGEF18 1 81098 1.23308E-5 40549 0 3.97633E-6
19-7506607-C-G p.Ser46Cys missense ARHGEF18 4 81100 4.93218E-5 40550 0 3.1839E-5
19-7506616-T-A p.Leu49His missense ARHGEF18 1 81094 1.23314E-5 40547 0 8.23642E-6
19-7506624-C-G p.Pro52Ala missense ARHGEF18 3 81096 3.69932E-5 40548 0 8.23655E-6
19-7506632-C-T p.Thr54Thr synonymous ARHGEF18 14 81080 1.72669E-4 40540 0 1.15326E-4
19-7506641-T-G p.Ile57Met missense ARHGEF18 3 81086 3.69978E-5 40543 0 8.23723E-6
19-7506649-AAGGTATGGTCATCTCCGCTCTCTCGCGGCTGCCACACAGTTCCTGTCTCTCCTGGGAAGAGCTGGGGCTCGTGTCAGCATGTCTACGGGAGGGAATTGGGGTGGCATGGCTCTGGGCCCCCAGCAGCCACACCTCGCTCTTCCCTC-A c.181+1_182-1del splice_acceptor ARHGEF18 2 81072 2.46694E-5 40536 1 NA
19-7506651-G-GATCCCTACACCGCCTCGCTGAGGA c.181_181+1insATCCCTACACCGCCTCGCTGAGGA splice_donor ARHGEF18 4 81074 4.93376E-5 40537 2 NA
19-7506655-T-C c.181+4T>C splice_region ARHGEF18 802 81040 0.00989635 40520 8 0.0175
19-7506656-G-C c.181+5G>C splice_region ARHGEF18 2 81048 2.46767E-5 40524 0 1.6475E-5
19-7506799-T-C p.Asp61Asp splice_region+synonymous ARHGEF18 1 80920 1.23579E-5 40460 0 NA
19-7506800-C-T p.Pro62Ser missense+splice_region ARHGEF18 55 80920 6.79684E-4 40460 0 0.00184725
19-7506802-C-T p.Pro62Pro synonymous ARHGEF18 2 80920 2.47158E-5 40460 0 8.24049E-6
19-7506808-C-T p.Thr64Thr synonymous ARHGEF18 906 80928 0.0111951 40464 20 0.0276939
19-7506809-G-A p.Ala65Thr missense ARHGEF18 1 80944 1.23542E-5 40472 0 5.76844E-5
19-7506813-C-T p.Ser66Leu missense ARHGEF18 2 80954 2.47054E-5 40477 0 8.24008E-6
19-7506819-G-A p.Arg68Lys missense ARHGEF18 1 80976 1.23493E-5 40488 0 NA
19-7506833-T-C p.Ser73Pro missense ARHGEF18 5 80980 6.17436E-5 40490 0 6.38855E-5
19-7506838-C-T p.Asp74Asp synonymous ARHGEF18 2 80976 2.46987E-5 40488 0 3.97839E-6
19-7506868-C-G p.Ser84Arg missense ARHGEF18 1 80972 1.23499E-5 40486 0 NA
19-7506871-C-T p.Leu85Leu synonymous ARHGEF18 2 80972 2.46999E-5 40486 0 6.37146E-5
19-7506872-G-A p.Ala86Thr missense ARHGEF18 1 80966 1.23509E-5 40483 0 7.95488E-6
19-7506873-C-T p.Ala86Val missense ARHGEF18 4 80970 4.9401E-5 40485 0 6.25E-4
19-7506874-C-T p.Ala86Ala splice_region+synonymous ARHGEF18 1 80972 1.23499E-5 40486 0 6.59163E-5
19-7506875-G-A p.Val87Met missense ARHGEF18 3 80968 3.70517E-5 40484 0 3.97747E-5
19-7506878-G-A p.Asp88Asn missense ARHGEF18 1 80964 1.23512E-5 40482 0 2.47178E-5
19-7506889-C-T p.Tyr91Tyr synonymous ARHGEF18 7 80950 8.64731E-5 40475 0 1.40079E-4
19-7506900-A-C p.Gln95Pro missense ARHGEF18 2 80934 2.47115E-5 40467 0 8.24022E-6
19-7506916-G-A p.Val100Val synonymous ARHGEF18 3 80862 3.71002E-5 40431 0 1.64848E-5
19-7506936-A-T p.Tyr107Phe missense+splice_region ARHGEF18 358 80552 0.00444433 40276 8 0.00934013
19-7506944-G-A c.322+6G>A splice_region ARHGEF18 1 80296 1.24539E-5 40148 0 NA
19-7509086-G-A c.323-4G>A splice_region ARHGEF18 2 77800 2.57069E-5 38900 0 1.61663E-5
19-7509092-C-G p.Leu109Val missense+splice_region ARHGEF18 3 78010 3.84566E-5 39005 0 3.18471E-5
19-7509095-A-T p.Met110Leu missense ARHGEF18 1 78138 1.27979E-5 39069 0 3.18451E-5
19-7509100-G-A p.Gln111Gln synonymous ARHGEF18 2 78346 2.55278E-5 39173 0 NA
19-7509109-G-A p.Val114Val synonymous ARHGEF18 3 78536 3.8199E-5 39268 0 3.18451E-5
19-7509115-C-T p.His116His synonymous ARHGEF18 20 78832 2.53704E-4 39416 0 2.42633E-4
19-7509115-C-G p.His116Gln missense ARHGEF18 1 78832 1.26852E-5 39416 0 NA
19-7509116-G-C p.Val117Leu missense ARHGEF18 1 78896 1.26749E-5 39448 0 8.3647E-6
19-7509119-C-T p.Arg118Trp missense ARHGEF18 2 78986 2.53209E-5 39493 0 5.05051E-4
19-7509120-G-A p.Arg118Gln missense ARHGEF18 65 79070 8.22056E-4 39535 1 7.11278E-4
19-7509127-C-G p.Leu120Leu synonymous ARHGEF18 3 79380 3.77929E-5 39690 0 5.05561E-4
19-7509128-A-G p.Lys121Glu missense ARHGEF18 1 79438 1.25884E-5 39719 0 NA
19-7509131-A-G p.Ile122Val missense ARHGEF18 3 79508 3.77321E-5 39754 0 5.05561E-4
19-7509156-C-T p.Ala130Val missense ARHGEF18 1 79826 1.25272E-5 39913 0 8.33389E-6
19-7509178-C-T p.Phe137Phe synonymous ARHGEF18 1 79996 1.25006E-5 39998 0 NA
19-7509183-G-A p.Ser139Asn missense ARHGEF18 1 79982 1.25028E-5 39991 0 8.32959E-6
19-7509188-G-T p.Ala141Ser missense ARHGEF18 1 79970 1.25047E-5 39985 0 3.18634E-5
19-7509197-C-T p.Arg144Cys missense ARHGEF18 3 79924 3.75357E-5 39962 0 2.49879E-5
19-7509198-G-T p.Arg144Leu missense ARHGEF18 7 79862 8.76512E-5 39931 0 6.37267E-5
19-7509198-G-A p.Arg144His missense ARHGEF18 2 79862 2.50432E-5 39931 0 1.19826E-5
19-7509209-T-C p.Cys148Arg missense ARHGEF18 5 79818 6.26425E-5 39909 0 9.55536E-5
19-7509211-C-T p.Cys148Cys synonymous ARHGEF18 1 79698 1.25474E-5 39849 0 7.99156E-6
19-7509212-G-A p.Ala149Thr missense ARHGEF18 2 79624 2.51181E-5 39812 0 1.66633E-5
19-7509217-C-T p.Asp150Asp synonymous ARHGEF18 4 79504 5.03119E-5 39752 0 4.1659E-5
19-7509218-G-A p.Asp151Asn missense ARHGEF18 1 79510 1.2577E-5 39755 0 NA
19-7509223-G-A p.Leu152Leu synonymous ARHGEF18 1093 79388 0.0137678 39694 19 0.0287009
19-7509231-C-T p.Thr155Met missense ARHGEF18 9 79172 1.13677E-4 39586 0 7.50113E-5
19-7509245-C-T p.Leu160Phe missense ARHGEF18 1 78774 1.26945E-5 39387 0 NA
19-7509247-C-T p.Leu160Leu synonymous ARHGEF18 1 78626 1.27184E-5 39313 0 2.40215E-5
19-7509248-G-A p.Ala161Thr missense ARHGEF18 1 78412 1.27532E-5 39206 0 8.33889E-6
19-7509252-G-A p.Arg162Gln missense ARHGEF18 3 78260 3.83338E-5 39130 0 4.17091E-5
19-7509263-C-T p.Arg166Cys missense ARHGEF18 4 78094 5.12203E-5 39047 0 8.34516E-6
19-7509266-C-T p.Arg167Cys missense ARHGEF18 5 78016 6.40894E-5 39008 0 6.37146E-5
19-7509283-G-T p.Glu172Asp missense ARHGEF18 1 78388 1.27571E-5 39194 0 NA
19-7509296-C-T p.Arg177Trp missense ARHGEF18 1 78438 1.27489E-5 39219 0 9.18105E-5
19-7509297-G-A p.Arg177Gln missense ARHGEF18 2 78526 2.54693E-5 39263 0 5.03525E-4
19-7509298-G-A p.Arg177Arg synonymous ARHGEF18 2 78546 2.54628E-5 39273 0 4.00802E-6
19-7509304-T-C p.Tyr179Tyr synonymous ARHGEF18 2 78702 2.54123E-5 39351 0 1.6031E-5
19-7509307-C-T p.Val180Val synonymous ARHGEF18 1 78712 1.27045E-5 39356 0 NA
19-7509315-A-G p.Lys183Arg missense ARHGEF18 1 78780 1.26936E-5 39390 0 NA
19-7509319-C-T p.Ile184Ile synonymous ARHGEF18 1 78672 1.2711E-5 39336 0 4.01623E-6
19-7509323-G-A p.Asp186Asn missense ARHGEF18 3 78676 3.81311E-5 39338 0 6.02584E-5
19-7509326-C-T p.Leu187Phe missense ARHGEF18 1 78742 1.26997E-5 39371 0 NA
19-7509332-G-A p.Val189Ile missense ARHGEF18 21 78856 2.66308E-4 39428 0 7.37018E-4
19-7509340-G-GAAAATTGGCAACTTCTCCATC c.573_573+1insAAAATTGGCAACTTCTCCATC splice_donor ARHGEF18 1 78918 1.26714E-5 39459 0 NA
19-7511919-TGTTTATCA-T c.574-9_574-2delGTTTATCA splice_acceptor ARHGEF18 1 80970 1.23503E-5 40485 0 NA
19-7511923-T-C c.574-6T>C splice_region ARHGEF18 1 80984 1.23481E-5 40492 0 2.01266E-5
19-7511932-T-G p.Ser193Ala missense ARHGEF18 1 81002 1.23454E-5 40501 0 3.18715E-5
19-7511934-A-C p.Ser193Ser synonymous ARHGEF18 1 81000 1.23457E-5 40500 0 NA
19-7511946-G-A p.Gly197Gly synonymous ARHGEF18 3 81024 3.70261E-5 40512 0 9.56023E-5
19-7511964-G-C p.Lys203Asn missense ARHGEF18 1 81034 1.23405E-5 40517 0 NA
19-7511965-T-C p.Tyr204His missense ARHGEF18 1 81028 1.23414E-5 40514 0 NA
19-7511967-C-T p.Tyr204Tyr synonymous ARHGEF18 23 81030 2.83845E-4 40515 0 2.46933E-4
19-7511968-G-A p.Gly205Ser missense ARHGEF18 2 81032 2.46816E-5 40516 0 4.96385E-5
19-7511969-G-C p.Gly205Ala missense ARHGEF18 1 81030 1.23411E-5 40515 0 NA
19-7511983-G-C p.Gly210Arg missense ARHGEF18 1 81042 1.23393E-5 40521 0 NA
19-7511987-A-G p.His211Arg missense ARHGEF18 1 81040 1.23396E-5 40520 0 NA
19-7511990-A-G p.Asn212Ser missense ARHGEF18 1 81040 1.23396E-5 40520 0 1.27405E-4
19-7511991-T-C p.Asn212Asn synonymous ARHGEF18 1 81040 1.23396E-5 40520 0 NA
19-7511996-C-G p.Ala214Gly missense ARHGEF18 1 81038 1.23399E-5 40519 0 7.964E-6
19-7512012-G-A p.Lys219Lys synonymous ARHGEF18 1 81024 1.2342E-5 40512 0 NA
19-7512016-C-G p.Leu221Val missense ARHGEF18 241 81012 0.00297487 40506 0 0.00306376
19-7512024-G-T p.Gln223His missense ARHGEF18 7 80992 8.64283E-5 40496 0 9.57549E-5
19-7512028-A-G p.Asn225Asp missense ARHGEF18 1 80988 1.23475E-5 40494 0 3.99987E-6
19-7512045-C-T p.Asn230Asn synonymous ARHGEF18 3 80930 3.70691E-5 40465 0 0.00125
19-7512055-G-A c.699+1G>A splice_donor ARHGEF18 1 80864 1.23664E-5 40432 0 NA
19-7516031-C-T c.700-4C>T splice_region ARHGEF18 1 80992 1.23469E-5 40496 0 NA
19-7516031-C-G c.700-4C>G splice_region ARHGEF18 1 80992 1.23469E-5 40496 0 1.19389E-5
19-7516043-C-T p.Gly236Gly synonymous ARHGEF18 1 81014 1.23435E-5 40507 0 8.25314E-6
19-7516053-A-G p.Ile240Val missense ARHGEF18 2 81028 2.46828E-5 40514 0 6.25E-4
19-7516055-C-T p.Ile240Ile synonymous ARHGEF18 3 81016 3.70297E-5 40508 0 3.30109E-5
19-7516056-G-A p.Val241Met missense ARHGEF18 5 81018 6.17147E-5 40509 0 6.94107E-5
19-7516060-G-A p.Arg242Gln missense ARHGEF18 2 81022 2.46847E-5 40511 0 1.01951E-4
19-7516066-T-G p.Leu244Arg missense ARHGEF18 2 81026 2.46834E-5 40513 0 1.48561E-4
19-7516070-C-T p.Gly245Gly synonymous ARHGEF18 1741 80968 0.0215023 40484 22 0.035625
19-7516071-G-A p.Val246Met missense ARHGEF18 5 81018 6.17147E-5 40509 0 1.81611E-4
19-7516073-G-A p.Val246Val synonymous ARHGEF18 1 81018 1.23429E-5 40509 0 8.25505E-6
19-7516075-A-C p.Gln247Pro missense ARHGEF18 1 81022 1.23423E-5 40511 0 NA
19-7516076-G-A p.Gln247Gln synonymous ARHGEF18 2 81026 2.46834E-5 40513 0 3.97823E-6
19-7516079-G-A p.Glu248Glu synonymous ARHGEF18 121 81020 0.00149346 40510 1 0.00258439
19-7516091-G-C p.Leu252Leu synonymous ARHGEF18 1 81000 1.23457E-5 40500 0 3.9788E-6
19-7516100-A-G p.Gln255Gln synonymous ARHGEF18 1 80962 1.23515E-5 40481 0 NA
19-7516101-C-T p.Arg256Cys missense ARHGEF18 1 80952 1.2353E-5 40476 0 5.03525E-4
19-7516105-T-C p.Ile257Thr missense ARHGEF18 2 80940 2.47097E-5 40470 0 5.17421E-5
19-7516131-C-T p.Arg266Cys missense ARHGEF18 21 80568 2.60649E-4 40284 0 7.51077E-5
19-7516132-G-A p.Arg266His missense ARHGEF18 2 80522 2.48379E-5 40261 0 6.25E-4
19-7516137-A-C p.Ile268Leu missense ARHGEF18 22 80466 2.73407E-4 40233 0 2.55249E-4
19-7516143-A-T p.Asn270Tyr missense ARHGEF18 1 80320 1.24502E-5 40160 0 NA
19-7516147-C-T p.Thr271Met missense ARHGEF18 19 80198 2.36914E-4 40099 0 1.19826E-4
19-7516148-G-A p.Thr271Thr synonymous ARHGEF18 5 80148 6.23846E-5 40074 0 6.25E-4
19-7516149-G-A p.Glu272Lys missense ARHGEF18 1 80142 1.24779E-5 40071 0 NA
19-7516154-T-A c.817+2T>A splice_donor ARHGEF18 1 79946 1.25084E-5 39973 0 3.18979E-5
19-7516158-C-T c.817+6C>T splice_region ARHGEF18 1 79780 1.25345E-5 39890 0 3.19081E-5
19-7516158-C-G c.817+6C>G splice_region ARHGEF18 2 79780 2.50689E-5 39890 0 NA
19-7518348-G-A c.818-5G>A splice_region ARHGEF18 1 81014 1.23435E-5 40507 0 1.72084E-5
19-7518350-C-A c.818-3C>A splice_region ARHGEF18 1 81018 1.23429E-5 40509 0 NA
19-7518375-C-A p.Asp280Glu missense ARHGEF18 4 81052 4.9351E-5 40526 0 1.12078E-4
19-7518396-C-T p.Leu287Leu synonymous ARHGEF18 1 81066 1.23356E-5 40533 0 NA
19-7518397-A-G p.Ile288Val missense ARHGEF18 6 81064 7.40156E-5 40532 0 2.97295E-4
19-7518401-A-G p.Lys289Arg missense ARHGEF18 14 81066 1.72699E-4 40533 0 0.00100806
19-7518423-C-T p.Asp296Asp synonymous ARHGEF18 4 81062 4.93449E-5 40531 0 4.12106E-5
19-7518424-G-A p.Ala297Thr missense ARHGEF18 2 81058 2.46737E-5 40529 0 6.59359E-5
19-7518430-G-A p.Val299Ile missense ARHGEF18 2 81054 2.46749E-5 40527 0 8.24131E-6
19-7518432-C-T p.Val299Val synonymous ARHGEF18 1 81056 1.23371E-5 40528 0 8.24117E-6
19-7518434-G-A p.Ser300Asn missense ARHGEF18 2 81060 2.46731E-5 40530 0 NA
19-7518439-T-C p.Cys302Arg missense ARHGEF18 1 81054 1.23375E-5 40527 0 NA
19-7518448-G-A p.Gly305Ser missense ARHGEF18 1 81052 1.23378E-5 40526 0 NA
19-7518453-G-C p.Gln306His missense ARHGEF18 2 81060 2.46731E-5 40530 0 NA
19-7518455-G-A p.Arg307His missense ARHGEF18 1 81046 1.23387E-5 40523 0 0.00201613
19-7518465-G-T p.Glu310Asp missense ARHGEF18 1 81036 1.23402E-5 40518 0 NA
19-7518468-C-T p.Ile311Ile synonymous ARHGEF18 4 81028 4.93657E-5 40514 0 3.18471E-5
19-7518469-G-T p.Ala312Ser missense ARHGEF18 2 81022 2.46847E-5 40511 0 5.17475E-5
19-7518479-T-G p.Met315Arg missense ARHGEF18 1 81020 1.23426E-5 40510 0 NA
19-7518507-G-A p.Lys324Lys synonymous ARHGEF18 2 80980 2.46975E-5 40490 0 2.78924E-5
19-7518510-C-T p.Asn325Asn synonymous ARHGEF18 3 80964 3.70535E-5 40482 0 6.36821E-5
19-7518523-C-T p.Arg330Cys missense ARHGEF18 2 80942 2.47091E-5 40471 0 3.1837E-5
19-7518524-G-A p.Arg330His missense ARHGEF18 7 80928 8.64966E-5 40464 0 0.005
19-7518538-C-T p.Leu335Phe missense ARHGEF18 1 80876 1.23646E-5 40438 0 NA
19-7518540-T-G p.Leu335Leu synonymous ARHGEF18 1 80862 1.23667E-5 40431 0 NA
19-7518542-A-T p.Gln336Leu missense ARHGEF18 1 80864 1.23664E-5 40432 0 4.01345E-6
19-7518545-G-A p.Arg337Gln missense ARHGEF18 3 80816 3.71214E-5 40408 0 8.04622E-5
19-7518548-A-G p.Gln338Arg missense ARHGEF18 1 80786 1.23784E-5 40393 0 NA
19-7518584-C-T p.Thr350Ile missense ARHGEF18 20 80304 2.49054E-4 40152 0 5.45022E-4
19-7518592-C-T p.Arg353Cys missense ARHGEF18 2 79896 2.50325E-5 39948 0 3.1839E-5
19-7518593-G-A p.Arg353His missense ARHGEF18 1 79788 1.25332E-5 39894 0 9.52962E-6
19-7518601-G-GATATCCTGGCTATCCTGCTGACCGAC c.1066_1066+1insATATCCTGGCTATCCTGCTGACCGAC splice_donor ARHGEF18 2 79652 2.51092E-5 39826 1 NA
19-7518605-A-C c.1066+4A>C splice_region ARHGEF18 17 79542 2.13724E-4 39771 0 1.08837E-4
19-7521209-C-T c.1067-4C>T splice_region ARHGEF18 1 80968 1.23506E-5 40484 0 3.29468E-5
19-7521210-C-G c.1067-3C>G splice_region ARHGEF18 1 80978 1.2349E-5 40489 0 NA
19-7521216-T-C p.Ile357Thr missense ARHGEF18 1 80994 1.23466E-5 40497 0 NA
19-7521229-G-C p.Leu361Leu synonymous ARHGEF18 10 81026 1.23417E-4 40513 0 5.03525E-4
19-7521233-A-G p.Thr363Ala missense ARHGEF18 1 81016 1.23432E-5 40508 0 2.78337E-5
19-7521235-C-T p.Thr363Thr synonymous ARHGEF18 7 81020 8.63984E-5 40510 0 5.16919E-5
19-7521238-C-T p.Asp364Asp synonymous ARHGEF18 4 81016 4.9373E-5 40508 0 5.03525E-4
19-7521239-G-A p.Val365Ile missense ARHGEF18 2 81014 2.46871E-5 40507 0 3.18471E-5
19-7521256-A-G p.Gln370Gln synonymous ARHGEF18 1 81010 1.23442E-5 40505 0 NA
19-7521274-C-T p.Tyr376Tyr synonymous ARHGEF18 6 80934 7.41345E-5 40467 0 2.47101E-5
19-7521275-G-A p.Val377Ile missense ARHGEF18 1 80932 1.23561E-5 40466 0 3.29468E-5
19-7521275-G-T p.Val377Phe missense ARHGEF18 1 80932 1.23561E-5 40466 0 NA
19-7521280-T-C p.Phe378Phe synonymous ARHGEF18 2 80914 2.47176E-5 40457 0 5.03525E-4
19-7523391-C-T c.1144-7C>T splice_region ARHGEF18 13 80990 1.60514E-4 40495 0 6.25E-4
19-7523392-A-G c.1144-6A>G splice_region ARHGEF18 1 80996 1.23463E-5 40498 0 8.32487E-6
19-7523407-C-A p.Pro385Thr missense ARHGEF18 1 81038 1.23399E-5 40519 0 NA
19-7523410-C-T p.Pro386Ser missense ARHGEF18 3 81044 3.70169E-5 40522 0 1.19326E-5
19-7523421-G-A p.Ser389Ser synonymous ARHGEF18 1 81080 1.23335E-5 40540 0 NA
19-7523437-G-A p.Val395Met missense ARHGEF18 1 81086 1.23326E-5 40543 0 7.95292E-6
19-7523439-G-A p.Val395Val synonymous ARHGEF18 1 81088 1.23323E-5 40544 0 NA
19-7523455-G-C p.Glu401Gln missense ARHGEF18 1 81094 1.23314E-5 40547 0 3.97646E-6
19-7523460-G-A p.Glu402Glu synonymous ARHGEF18 1 81100 1.23305E-5 40550 0 NA
19-7523466-G-T p.Ala404Ala synonymous ARHGEF18 4 81092 4.93267E-5 40546 0 0.00125
19-7523466-G-A p.Ala404Ala synonymous ARHGEF18 4 81092 4.93267E-5 40546 0 3.8715E-4
19-7523478-C-T p.Ile408Ile synonymous ARHGEF18 3 81080 3.70005E-5 40540 0 3.18492E-5
19-7523481-C-T p.Ser409Ser synonymous ARHGEF18 3 81078 3.70014E-5 40539 0 7.55539E-5
19-7523482-G-A p.Ala410Thr missense ARHGEF18 1 81078 1.23338E-5 40539 0 6.59044E-5
19-7523493-A-G p.Gln413Gln synonymous ARHGEF18 13 81060 1.60375E-4 40530 0 9.14615E-5
19-7523499-G-A p.Pro415Pro synonymous ARHGEF18 4 81060 4.93462E-5 40530 0 3.2962E-5
19-7523505-G-A p.Met417Ile missense ARHGEF18 12 81054 1.48049E-4 40527 0 1.74996E-4
19-7523529-A-G p.Lys425Lys synonymous ARHGEF18 2 80972 2.46999E-5 40486 0 NA
19-7523541-C-T p.Asn429Asn synonymous ARHGEF18 2 80914 2.47176E-5 40457 0 1.65503E-5
19-7523542-G-A p.Ala430Thr missense ARHGEF18 1 80892 1.23622E-5 40446 0 3.18451E-5
19-7523552-C-T p.Ala433Val missense ARHGEF18 1 80816 1.23738E-5 40408 0 1.19519E-5
19-7523581-G-C c.1322+5G>C splice_region ARHGEF18 1 80366 1.24431E-5 40183 0 1.60832E-5
19-7524797-A-G p.Asp444Gly missense ARHGEF18 2 78954 2.53312E-5 39477 0 NA
19-7524805-G-A p.Glu447Lys missense ARHGEF18 1 79062 1.26483E-5 39531 0 NA
19-7524822-G-A p.Leu452Leu synonymous ARHGEF18 2 79150 2.52685E-5 39575 0 6.27628E-5
19-7524825-C-T p.Pro453Pro synonymous ARHGEF18 2 79134 2.52736E-5 39567 0 5.17945E-4
19-7524828-A-G p.Glu454Glu synonymous ARHGEF18 1 79142 1.26355E-5 39571 0 9.43049E-6
19-7524830-A-G p.Glu455Gly missense ARHGEF18 2 79154 2.52672E-5 39577 0 4.71529E-6
19-7524843-G-T p.Val459Val synonymous ARHGEF18 2 79056 2.52985E-5 39528 0 9.56084E-5
19-7524846-C-T p.Val460Val synonymous ARHGEF18 17939 78714 0.227901 39357 2042 0.302242
19-7524847-G-A p.Glu461Lys missense ARHGEF18 1 79014 1.2656E-5 39507 0 6.60124E-5
19-7524852-C-G p.Ala462Ala synonymous ARHGEF18 4 78974 5.06496E-5 39487 0 9.56572E-5
19-7524853-CGC-GGT p.Arg463Gly missense ARHGEF18 9 78938 1.14014E-4 39469 0 NA
19-7524853-C-G p.Arg463Gly missense ARHGEF18 2 78938 2.53363E-5 39469 0 8.96499E-5
19-7524853-C-T p.Arg463Cys missense ARHGEF18 2 78938 2.53363E-5 39469 0 4.90326E-6
19-7524854-GC-AT p.Arg463His missense ARHGEF18 1 78920 1.26711E-5 39460 0 NA
19-7524854-G-A p.Arg463His missense ARHGEF18 3 78920 3.80132E-5 39460 0 9.56267E-5
19-7524855-C-T p.Arg463Arg synonymous ARHGEF18 18230 78582 0.231987 39291 2102 0.307484
19-7524856-G-A p.Ala464Thr missense ARHGEF18 1 78868 1.26794E-5 39434 0 0.00152749
19-7524860-C-G p.Thr465Arg missense ARHGEF18 2 78840 2.53678E-5 39420 0 5.04068E-6
19-7524860-C-T p.Thr465Met missense ARHGEF18 1 78840 1.26839E-5 39420 0 5.70386E-5
19-7524861-G-A p.Thr465Thr synonymous ARHGEF18 3 78828 3.80575E-5 39414 0 5.85103E-5
19-7524868-C-T p.Arg468Trp missense ARHGEF18 7 78742 8.88979E-5 39371 0 1.27527E-4
19-7524869-G-A p.Arg468Gln missense ARHGEF18 1 78698 1.27068E-5 39349 0 0.00101833
19-7524882-TGAGCGG-T c.1414+3_1414+8delGAGCGG splice_region ARHGEF18 6 78372 7.6558E-5 39186 0 NA
19-7524884-A-T c.1414+4A>T splice_region ARHGEF18 3 78324 3.83024E-5 39162 0 2.3208E-5
19-7524886-C-A c.1414+6C>A splice_region ARHGEF18 3 78244 3.83416E-5 39122 0 1.27551E-4
19-7524887-G-A c.1414+7G>A splice_region ARHGEF18 64 78218 8.18226E-4 39109 0 0.00184937
19-7527037-G-C c.1415-1G>C splice_acceptor ARHGEF18 1 80778 1.23796E-5 40389 0 NA
19-7527041-G-A p.Arg473Gln missense ARHGEF18 10 80816 1.23738E-4 40408 0 1.91241E-4
19-7527043-T-C p.Leu474Leu synonymous ARHGEF18 4 80822 4.94915E-5 40411 0 9.95057E-5
19-7527049-A-G p.Met476Val missense ARHGEF18 4 80874 4.94597E-5 40437 0 1.31322E-4
19-7527051-G-A p.Met476Ile missense ARHGEF18 1 80886 1.23631E-5 40443 0 8.27363E-6
19-7527061-C-G p.Leu480Val missense ARHGEF18 1 80906 1.236E-5 40453 0 3.97912E-6
19-7527067-G-A p.Ala482Thr missense ARHGEF18 1 80914 1.23588E-5 40457 0 3.18573E-5
19-7527069-A-G p.Ala482Ala synonymous ARHGEF18 1 80930 1.23564E-5 40465 0 NA
19-7527077-T-G p.Leu485Arg missense ARHGEF18 1 80928 1.23567E-5 40464 0 3.18613E-5
19-7527081-A-G p.Leu486Leu synonymous ARHGEF18 1 80930 1.23564E-5 40465 0 1.65333E-5
19-7527084-G-A p.Glu487Glu synonymous ARHGEF18 3 80938 3.70654E-5 40469 0 2.47991E-5
19-7527094-A-G p.Ile491Val missense ARHGEF18 1 80912 1.23591E-5 40456 0 3.97896E-6
19-7527102-G-A p.Leu493Leu synonymous ARHGEF18 1 80878 1.23643E-5 40439 0 8.27034E-6
19-7527105-G-A p.Glu494Glu synonymous ARHGEF18 1 80874 1.23649E-5 40437 0 9.55171E-5
19-7527111-C-T p.Ala496Ala synonymous ARHGEF18 1 80832 1.23713E-5 40416 0 3.18492E-5
19-7527120-C-T p.Gly499Gly synonymous ARHGEF18 2 80824 2.47451E-5 40412 0 6.37024E-5
19-7527121-G-A p.Gly500Ser missense ARHGEF18 36 80840 4.45324E-4 40420 0 0.00151057
19-7527126-C-T p.Leu501Leu synonymous ARHGEF18 23 80832 2.84541E-4 40416 0 9.94646E-5
19-7527126-C-G p.Leu501Leu synonymous ARHGEF18 1 80832 1.23713E-5 40416 0 8.28871E-6
19-7527127-G-A p.Glu502Lys missense ARHGEF18 1 80838 1.23704E-5 40419 0 2.48641E-5
19-7527129-A-G p.Glu502Glu synonymous ARHGEF18 1 80826 1.23723E-5 40413 0 NA
19-7527131-ACCTGCCCCAGCCCCGAGG-A p.Pro505_Leu510del disruptive_inframe_deletion ARHGEF18 2 80804 2.47513E-5 40402 0 NA
19-7527137-C-G p.Pro505Arg missense ARHGEF18 3 80860 3.71012E-5 40430 0 2.86679E-4
19-7527143-C-T p.Pro507Leu missense ARHGEF18 3 80848 3.71067E-5 40424 0 1.59462E-5
19-7527145-C-T p.Arg508* stop_gained ARHGEF18 1 80822 1.23729E-5 40411 0 NA
19-7527146-G-C p.Arg508Pro missense ARHGEF18 5 80820 6.18659E-5 40410 0 0.00293012
19-7527146-G-T p.Arg508Leu missense ARHGEF18 1 80820 1.23732E-5 40410 0 3.98785E-6
19-7527151-C-G p.Leu510Val missense ARHGEF18 3 80792 3.71324E-5 40396 0 NA
19-7527154-T-A p.Phe511Ile missense ARHGEF18 4 80800 4.95049E-5 40400 0 1.66948E-5
19-7527154-T-G p.Phe511Val missense ARHGEF18 1 80800 1.23762E-5 40400 0 3.18552E-5
19-7527157-C-T p.Arg512Cys missense ARHGEF18 1 80778 1.23796E-5 40389 0 5.03525E-4
19-7527158-G-A p.Arg512His missense ARHGEF18 26 80792 3.21814E-4 40396 0 4.77585E-4
19-7527164-G-A p.Gly514Glu missense ARHGEF18 2 80768 2.47623E-5 40384 0 3.1839E-5
19-7527174-C-T p.Ser517Ser synonymous ARHGEF18 11 80654 1.36385E-4 40327 0 7.64136E-5
19-7527175-G-A p.Glu518Lys missense ARHGEF18 1 80626 1.24029E-5 40313 0 3.18451E-5
19-7527187-G-T p.Gly522Trp missense ARHGEF18 12 80494 1.49079E-4 40247 0 6.25E-4
19-7527193-C-G p.Leu524Val missense ARHGEF18 2 80438 2.48639E-5 40219 0 NA
19-7527195-A-G p.Leu524Leu synonymous ARHGEF18 179 80388 0.0022267 40194 1 0.00221154
19-7527198-T-A p.Ile525Ile synonymous ARHGEF18 2 80350 2.48911E-5 40175 0 1.75664E-5
19-7527206-C-T p.Ser528Leu missense ARHGEF18 1 80176 1.24726E-5 40088 0 4.35343E-6
19-7527207-G-A p.Ser528Ser synonymous ARHGEF18 15 80178 1.87084E-4 40089 0 7.74657E-4
19-7527216-C-T p.Ser531Ser synonymous ARHGEF18 235 79930 0.00294007 39965 4 0.0067251
19-7527216-C-A p.Ser531Arg missense ARHGEF18 1 79930 1.25109E-5 39965 0 4.50442E-6
19-7527217-G-A p.Glu532Lys missense ARHGEF18 2 79902 2.50307E-5 39951 0 3.81061E-5
19-7528719-G-A p.Ser538Asn missense ARHGEF18 2 77940 2.56608E-5 38970 0 6.37186E-5
19-7528733-CA-TG p.Gln543Trp missense ARHGEF18 1 77982 1.28235E-5 38991 0 NA
19-7528733-C-T p.Gln543* stop_gained ARHGEF18 2 77982 2.56469E-5 38991 0 8.07214E-5
19-7528734-A-G p.Gln543Arg missense ARHGEF18 60362 76626 0.787748 38313 23929 0.841599
19-7528744-C-T p.Ser546Ser synonymous ARHGEF18 41 78034 5.25412E-4 39017 0 6.11963E-4
19-7528745-G-A p.Ala547Thr missense ARHGEF18 1 78054 1.28116E-5 39027 0 0.00557809
19-7528750-C-T p.Asn548Asn synonymous ARHGEF18 2 78328 2.55337E-5 39164 0 0.00101626
19-7528751-G-A p.Gly549Ser missense ARHGEF18 1 78348 1.27636E-5 39174 0 3.80735E-4
19-7528758-C-T p.Ala551Val missense ARHGEF18 25 78392 3.1891E-4 39196 0 5.08647E-4
19-7528766-G-A p.Gly554Arg missense ARHGEF18 2 78538 2.54654E-5 39269 0 3.18512E-5
19-7528776-C-T p.Ser557Phe missense ARHGEF18 2 78652 2.54285E-5 39326 0 4.45816E-6
19-7528777-C-T p.Ser557Ser synonymous ARHGEF18 250 78708 0.0031763 39354 0 0.00761421
19-7528785-C-T p.Pro560Leu missense ARHGEF18 1 78712 1.27045E-5 39356 0 1.35224E-5
19-7528786-G-A p.Pro560Pro synonymous ARHGEF18 3 78644 3.81466E-5 39322 0 6.25E-4
19-7528789-CAGGAGGGCT-C p.Arg562_Ala564del conservative_inframe_deletion ARHGEF18 2 78750 2.53968E-5 39375 0 6.81849E-5
19-7528802-A-G p.Thr566Ala missense ARHGEF18 1 78890 1.26759E-5 39445 0 NA
19-7528807-C-T p.Phe567Phe synonymous ARHGEF18 1 78938 1.26682E-5 39469 0 0.00101523
19-7528808-G-A p.Ala568Thr missense ARHGEF18 4 78894 5.07009E-5 39447 0 3.18573E-5
19-7528809-C-T p.Ala568Val missense ARHGEF18 4 78920 5.06842E-5 39460 0 3.83907E-5
19-7528809-C-A p.Ala568Glu missense ARHGEF18 2 78920 2.53421E-5 39460 0 NA
19-7528810-G-A p.Ala568Ala synonymous ARHGEF18 14 78968 1.77287E-4 39484 0 6.25E-4
19-7528816-C-T p.Tyr570Tyr synonymous ARHGEF18 2 79030 2.53068E-5 39515 0 5.0813E-4
19-7528817-G-A p.Asp571Asn missense ARHGEF18 1 79026 1.26541E-5 39513 0 0.00125
19-7528835-A-G p.Thr577Ala missense ARHGEF18 2 79088 2.52883E-5 39544 0 6.47864E-5
19-7528849-C-T c.1735+8C>T splice_region ARHGEF18 3 78930 3.80084E-5 39465 0 7.43494E-5
19-7529462-G-A p.Lys584Lys synonymous ARHGEF18 2 80810 2.47494E-5 40405 0 8.32861E-6
19-7529463-A-C p.Lys585Gln missense ARHGEF18 3 80822 3.71186E-5 40411 0 3.18492E-5
19-7529466-G-C p.Val586Leu missense ARHGEF18 1 80840 1.23701E-5 40420 0 NA
19-7529487-C-T p.Pro593Ser missense ARHGEF18 1 80904 1.23603E-5 40452 0 NA
19-7529490-C-A p.Arg594Arg synonymous ARHGEF18 9 80934 1.11202E-4 40467 0 3.18552E-5
19-7529490-C-T p.Arg594* stop_gained ARHGEF18 2 80934 2.47115E-5 40467 0 NA
19-7529491-G-A p.Arg594Gln missense ARHGEF18 18 80940 2.22387E-4 40470 0 0.00198265
19-7529500-G-A p.Arg597Gln missense ARHGEF18 1 80948 1.23536E-5 40474 0 7.46467E-5
19-7529508-C-T p.Pro600Ser missense ARHGEF18 2 80954 2.47054E-5 40477 0 NA
19-7529516-C-T p.Ser602Ser synonymous ARHGEF18 78 80958 9.63463E-4 40479 0 0.0020141
19-7529518-C-T p.Pro603Leu missense ARHGEF18 4 80954 4.94108E-5 40477 0 0.0025
19-7529519-G-A p.Pro603Pro synonymous ARHGEF18 2 80948 2.47072E-5 40474 0 1.9926E-5
19-7529528-G-C p.Lys606Asn missense ARHGEF18 1 80968 1.23506E-5 40484 0 NA
19-7529535-G-A p.Asp609Asn missense ARHGEF18 2 80954 2.47054E-5 40477 0 NA
19-7529538-A-G p.Ser610Gly missense ARHGEF18 4 80952 4.9412E-5 40476 0 2.48884E-5
19-7529561-G-A p.Glu617Glu synonymous ARHGEF18 1 80858 1.23674E-5 40429 0 8.31656E-6
19-7529561-G-C p.Glu617Asp missense ARHGEF18 1 80858 1.23674E-5 40429 0 1.66331E-5
19-7529569-C-T p.Pro620Leu missense ARHGEF18 1 80774 1.23802E-5 40387 0 4.78988E-5
19-7529570-G-A p.Pro620Pro synonymous ARHGEF18 1 80766 1.23814E-5 40383 0 4.16653E-5
19-7529577-G-A c.1866+1G>A splice_donor ARHGEF18 1 80746 1.23845E-5 40373 0 NA
19-7529580-C-T c.1866+4C>T splice_region ARHGEF18 2 80756 2.4766E-5 40378 0 7.99048E-6
19-7531821-G-A p.Thr628Thr synonymous ARHGEF18 441 80734 0.00546238 40367 2 0.0156093
19-7531832-C-A p.Pro632His missense ARHGEF18 3 80658 3.71941E-5 40329 0 5.03525E-4
19-7531832-C-T p.Pro632Leu missense ARHGEF18 2 80658 2.47961E-5 40329 0 8.27595E-6
19-7531835-G-C p.Arg633Pro missense ARHGEF18 1 80606 1.2406E-5 40303 0 3.98483E-6
19-7531845-C-T p.Thr636Thr synonymous ARHGEF18 1 80564 1.24125E-5 40282 0 1.99283E-5
19-7531846-G-A p.Val637Ile missense ARHGEF18 1 80532 1.24174E-5 40266 0 1.99308E-5
19-7531851-G-A p.Leu638Leu synonymous ARHGEF18 2 80530 2.48355E-5 40265 0 3.31246E-5
19-7531852-G-A p.Glu639Lys missense ARHGEF18 1 80530 1.24177E-5 40265 0 NA
19-7531856-C-T p.Ser640Leu missense ARHGEF18 87 80464 0.00108123 40232 0 0.00242687
19-7531857-G-A p.Ser640Ser synonymous ARHGEF18 4 80494 4.96931E-5 40247 0 5.97943E-5
19-7531858-GAGGTAGGCGCCCGCGGGTCTCCATCTCCCCAGGGCCTTGTGCACGCGCGTGTGGCCTCAGCCCGATAACTAGCATCAATCTCCCTCTCCTCTCCGC-G p.Glu641fs frameshift ARHGEF18 9 80502 1.11798E-4 40251 2 NA
19-7531954-C-T c.1924-3C>T splice_region ARHGEF18 1 80800 1.23762E-5 40400 0 8.3894E-6
19-7531977-A-G p.Thr648Thr synonymous ARHGEF18 1 80700 1.23916E-5 40350 0 NA
19-7531989-GC-CT p.LeuLeu652LeuPhe missense ARHGEF18 4 80630 4.96093E-5 40315 0 NA
19-7532001-TCAGGTACAGGGGCGGGGTGGGGCCGGCCACGCGTGCCCTTTCCTGGTTGGCTGGGGCGCAGGTGCGGCTCTCACTCGCCTGGCCCTGGCCCTCCG-T p.Gln657del splice_donor ARHGEF18 7 80524 8.69306E-5 40262 0 NA
19-7532011-G-C c.1971+7G>C splice_region ARHGEF18 344 80370 0.0042802 40185 10 0.0136642
19-7532097-C-T c.1972-3C>T splice_region ARHGEF18 1 77566 1.28922E-5 38783 0 NA
19-7532101-C-T p.Ala658Val missense+splice_region ARHGEF18 4 77244 5.1784E-5 38622 0 NA
19-7532102-G-T p.Ala658Ala splice_region+synonymous ARHGEF18 1 77196 1.2954E-5 38598 0 NA
19-7532123-C-T p.Ser665Ser synonymous ARHGEF18 1 75390 1.32644E-5 37695 0 NA
19-7532126-T-C p.Tyr666Tyr synonymous ARHGEF18 1 75178 1.33018E-5 37589 0 NA
19-7532134-C-T p.Thr669Met missense ARHGEF18 4 73934 5.41023E-5 36967 0 3.18573E-5
19-7532164-A-G p.Lys679Arg missense ARHGEF18 2 69214 2.88959E-5 34607 0 3.18654E-5
19-7532176-T-C p.Leu683Pro missense ARHGEF18 1 67180 1.48854E-5 33590 0 3.18796E-5
19-7532183-G-A p.Ser685Ser synonymous ARHGEF18 1 65310 1.53116E-5 32655 0 NA
19-7532186-G-A p.Thr686Thr synonymous ARHGEF18 2 64326 3.10916E-5 32163 0 6.37511E-5
19-7532208-C-A p.Gln694Lys missense ARHGEF18 59 61154 9.64777E-4 30577 2 0.00219885
19-7532216-G-T p.Arg696Arg synonymous ARHGEF18 10 59298 1.6864E-4 29649 0 0.00324675
19-7532228-C-T p.Phe700Phe synonymous ARHGEF18 2 57286 3.49125E-5 28643 0 3.18898E-5
19-7532249-C-T p.Arg707Arg synonymous ARHGEF18 1 52470 1.90585E-5 26235 0 3.18918E-5
19-7532252-G-C p.Ala708Ala synonymous ARHGEF18 11893 50734 0.234419 25367 1499 0.258145
19-7532258-G-C p.Leu710Leu synonymous ARHGEF18 12 50668 2.36836E-4 25334 0 3.41432E-4
19-7532258-G-A p.Leu710Leu synonymous ARHGEF18 1 50668 1.97363E-5 25334 0 1.51747E-5
19-7532296-G-T p.Arg723Leu missense ARHGEF18 2 44332 4.51141E-5 22166 0 NA
19-7532296-G-A p.Arg723His missense ARHGEF18 1 44332 2.25571E-5 22166 0 NA
19-7532298-T-G p.Trp724Gly missense ARHGEF18 1 44138 2.26562E-5 22069 0 NA
19-7532307-G-A p.Glu727Lys missense ARHGEF18 42 42780 9.81767E-4 21390 0 0.00223757
19-7532309-G-T p.Glu727Asp missense ARHGEF18 1 42480 2.35405E-5 21240 0 NA
19-7532335-A-T p.Glu736Val missense ARHGEF18 6 40668 1.47536E-4 20334 0 6.40451E-5
19-7532342-G-T p.Ala738Ala synonymous ARHGEF18 1 40252 2.48435E-5 20126 0 9.31289E-6
19-7532342-G-A p.Ala738Ala synonymous ARHGEF18 3 40252 7.45305E-5 20126 0 3.21854E-5
19-7532343-G-A p.Gly739Ser missense ARHGEF18 3 40126 7.47645E-5 20063 0 9.65456E-6
19-7532347-C-T p.Ala740Val missense ARHGEF18 3 39672 7.56201E-5 19836 0 0.00132979
19-7532349-C-T p.Arg741Trp missense ARHGEF18 1 39498 2.53177E-5 19749 0 4.18524E-5
19-7532354-G-A p.Leu742Leu synonymous ARHGEF18 1 39352 2.54117E-5 19676 0 NA
19-7532374-C-T p.Ala749Val missense ARHGEF18 1 38576 2.59229E-5 19288 0 NA
19-7532388-G-A p.Glu754Lys missense ARHGEF18 5 38242 1.30746E-4 19121 0 6.49351E-5
19-7532411-C-G p.Ala761Ala synonymous ARHGEF18 57 37920 0.00150316 18960 0 0.00911854
19-7532430-C-T p.Gln768* stop_gained ARHGEF18 1 37878 2.64005E-5 18939 0 NA
19-7532444-C-G p.His772Gln missense ARHGEF18 4 37776 1.05887E-4 18888 0 1.28708E-4
19-7532444-C-T p.His772His synonymous ARHGEF18 1 37776 2.64718E-5 18888 0 NA
19-7532448-C-T p.Leu774Leu synonymous ARHGEF18 2 37768 5.29549E-5 18884 0 1.06263E-5
19-7532461-G-A p.Arg778His missense ARHGEF18 1 37480 2.66809E-5 18740 0 NA
19-7532466-GC-G p.Gln781fs frameshift ARHGEF18 1 37404 2.67351E-5 18702 0 NA
19-7532478-G-A p.Val784Met missense ARHGEF18 2 37330 5.35762E-5 18665 0 9.53416E-6
19-7532486-C-G p.Arg786Arg synonymous ARHGEF18 1 37158 2.69121E-5 18579 0 0.0048
19-7532487-G-C p.Glu787Gln missense ARHGEF18 2 37168 5.38097E-5 18584 0 NA
19-7532491-G-A p.Arg788Gln missense ARHGEF18 1 37246 2.68485E-5 18623 0 1.87484E-5
19-7532511-C-T p.Arg795Cys missense ARHGEF18 1 37010 2.70197E-5 18505 0 1.80731E-5
19-7532534-C-G p.Thr802Thr synonymous ARHGEF18 1 36870 2.71223E-5 18435 0 5.11476E-4
19-7532545-C-T p.Ala806Val missense ARHGEF18 12 36642 3.27493E-4 18321 0 1.37061E-4
19-7532555-C-G p.Pro809Pro synonymous ARHGEF18 1 36392 2.74786E-5 18196 0 NA
19-7532565-G-A p.Ala813Thr missense ARHGEF18 1 36200 2.76243E-5 18100 0 6.37836E-5
19-7532567-C-T p.Ala813Ala synonymous ARHGEF18 1 36118 2.7687E-5 18059 0 NA
19-7532575-G-A c.2442+5G>A splice_region ARHGEF18 84 35914 0.00233892 17957 2 0.00718507
19-7532576-CG-TA c.2442+6_2442+7delCGinsTA splice_region ARHGEF18 4972 35814 0.138828 17907 359 NA
19-7532576-C-T c.2442+6C>T splice_region ARHGEF18 783 35856 0.0218373 17928 221 0.22191
19-7532577-G-A c.2442+7G>A splice_region ARHGEF18 779 35834 0.0217391 17917 220 0.221835
19-7533705-C-T c.2443-6C>T splice_region ARHGEF18 1 74916 1.33483E-5 37458 0 6.07275E-6
19-7533708-C-T c.2443-3C>T splice_region ARHGEF18 1 74940 1.3344E-5 37470 0 NA
19-7533729-C-T p.Pro821Ser missense ARHGEF18 8 75146 1.06459E-4 37573 0 3.18613E-5
19-7533737-C-G p.Ser823Arg missense ARHGEF18 11 75178 1.46319E-4 37589 0 1.59276E-4
19-7533740-C-T p.Phe824Phe synonymous ARHGEF18 1 75216 1.3295E-5 37608 0 NA
19-7533765-C-T p.Arg833Cys missense ARHGEF18 1 75030 1.3328E-5 37515 0 6.25E-4
19-7533766-G-A p.Arg833His missense ARHGEF18 3 74978 4.00117E-5 37489 0 2.01248E-4
19-7533766-GT-AG p.Arg833Gln missense ARHGEF18 1 74978 1.33372E-5 37489 0 NA
19-7533767-T-G p.Arg833Arg synonymous ARHGEF18 52138 69852 0.746407 34926 19521 0.802051
19-7533768-G-A p.Val834Met missense ARHGEF18 2 74998 2.66674E-5 37499 0 1.61659E-5
19-7533775-T-G p.Met836Arg missense ARHGEF18 1 74892 1.33526E-5 37446 0 NA
19-7533784-C-A p.Ser839Tyr missense ARHGEF18 2 74668 2.67852E-5 37334 0 3.18593E-5
19-7533784-C-T p.Ser839Phe missense ARHGEF18 2 74670 2.67845E-5 37335 0 5.43165E-6
19-7533786-G-A p.Gly840Ser missense ARHGEF18 147 74466 0.00197406 37233 0 0.00253613
19-7533788-C-T p.Gly840Gly synonymous ARHGEF18 1 74330 1.34535E-5 37165 0 1.63329E-5
19-7533789-G-C p.Val841Leu missense ARHGEF18 10 74378 1.34448E-4 37189 0 0.00307377
19-7533789-G-A p.Val841Met missense ARHGEF18 1 74378 1.34448E-5 37189 0 8.25946E-5
19-7533800-G-A p.Glu844Glu synonymous ARHGEF18 1 74062 1.35022E-5 37031 0 NA
19-7533803-C-T p.Tyr845Tyr synonymous ARHGEF18 1 73780 1.35538E-5 36890 0 2.9146E-5
19-7533804-G-A p.Ala846Thr missense ARHGEF18 4 73676 5.42918E-5 36838 0 8.71688E-5
19-7533805-C-T p.Ala846Val missense ARHGEF18 2 73662 2.7151E-5 36831 0 1.09868E-5
19-7533810-C-T p.Arg848Cys missense ARHGEF18 6 73148 8.20255E-5 36574 0 6.37552E-5
19-7533811-G-A p.Arg848His missense ARHGEF18 16 72946 2.1934E-4 36473 0 5.9848E-4
19-7533815-C-T p.Pro849Pro synonymous ARHGEF18 1 72862 1.37246E-5 36431 0 9.1047E-5
19-7533823-C-T p.Ala852Val missense ARHGEF18 458 72684 0.00630125 36342 1 0.00783718
19-7533826-G-A p.Arg853His missense ARHGEF18 2 72226 2.76909E-5 36113 0 5.99269E-5
19-7533829-G-A p.Arg854Gln missense ARHGEF18 5 72486 6.89788E-5 36243 0 3.2224E-4
19-7533837-G-A p.Ala857Thr missense ARHGEF18 1 71718 1.39435E-5 35859 0 3.18898E-5
19-7533838-C-T p.Ala857Val missense ARHGEF18 1 71854 1.39171E-5 35927 0 2.80521E-5
19-7533846-G-A p.Glu860Lys missense ARHGEF18 1 71546 1.3977E-5 35773 0 5.34416E-5
19-7533850-A-G p.Asn861Ser missense ARHGEF18 54068 68842 0.785393 34421 21479 0.836401
19-7533858-G-C p.Ala864Pro missense ARHGEF18 3 71080 4.2206E-5 35540 0 3.19081E-5
19-7533866-C-T p.Ser866Ser synonymous ARHGEF18 1 70596 1.41651E-5 35298 0 1.70114E-5
19-7533867-G-A p.Asp867Asn missense ARHGEF18 2 70572 2.83399E-5 35286 0 3.38306E-5
19-7533887-C-T p.Leu873Leu synonymous ARHGEF18 6 70098 8.55945E-5 35049 0 8.26692E-5
19-7533890-C-T p.Ser874Ser synonymous ARHGEF18 1 69468 1.43951E-5 34734 0 3.29968E-5
19-7533891-G-A p.Ala875Thr missense ARHGEF18 263 69130 0.00380443 34565 0 0.0040568
19-7533908-G-T p.Gln880His missense ARHGEF18 1 68854 1.45235E-5 34427 0 NA
19-7533917-G-A p.Ala883Ala synonymous ARHGEF18 1 66646 1.50047E-5 33323 0 4.72203E-5
19-7533920-C-A p.Ala884Ala synonymous ARHGEF18 1 66308 1.50811E-5 33154 0 NA
19-7533921-G-A p.Val885Met missense ARHGEF18 3 66222 4.53022E-5 33111 0 0.00101626
19-7533958-C-T p.Thr897Ile missense ARHGEF18 1 63514 1.57446E-5 31757 0 NA
19-7533959-C-T p.Thr897Thr synonymous ARHGEF18 2 63478 3.1507E-5 31739 0 3.18431E-5
19-7533964-G-T p.Gly899Val missense ARHGEF18 1 63038 1.58634E-5 31519 0 NA
19-7533967-G-T p.Gly900Val missense ARHGEF18 1 62440 1.60154E-5 31220 0 NA
19-7533981-G-A p.Gly905Ser missense ARHGEF18 5 60212 8.30399E-5 30106 1 0.0010101
19-7533983-C-A p.Gly905Gly synonymous ARHGEF18 3 59696 5.02546E-5 29848 0 5.62425E-5
19-7533988-G-C p.Ser907Thr missense ARHGEF18 1 59282 1.68685E-5 29641 0 2.92252E-5
19-7534003-G-A p.Arg912His missense ARHGEF18 1 56020 1.78508E-5 28010 0 3.18451E-5
19-7534008-G-C p.Glu914Gln missense ARHGEF18 2 55454 3.60659E-5 27727 0 3.1841E-5
19-7534013-C-T p.Ser915Ser synonymous ARHGEF18 49 54460 8.99743E-4 27230 0 0.00123268
19-7534016-A-G p.Ser916Ser splice_region+synonymous ARHGEF18 2 54114 3.6959E-5 27057 0 1.95572E-4
19-7534021-A-G c.2749+4A>G splice_region ARHGEF18 1 52886 1.89086E-5 26443 0 NA
19-7534024-C-T c.2749+7C>T splice_region ARHGEF18 3 51812 5.79016E-5 25906 0 9.55414E-5
19-7534025-G-A c.2749+8G>A splice_region ARHGEF18 2 51474 3.88546E-5 25737 0 6.32111E-4
19-7534025-G-T c.2749+8G>T splice_region ARHGEF18 1 51476 1.94265E-5 25738 0 3.18552E-5
19-7534784-T-G c.2750-6T>G splice_region ARHGEF18 1 80348 1.24459E-5 40174 0 7.99834E-6
19-7534785-T-C c.2750-5T>C splice_region ARHGEF18 1 80352 1.24452E-5 40176 0 NA
19-7534790-C-T p.Ala917Val missense+splice_region ARHGEF18 5 80468 6.21365E-5 40234 0 1.27665E-4
19-7534791-G-A p.Ala917Ala splice_region+synonymous ARHGEF18 4 80522 4.96759E-5 40261 0 2.79555E-5
19-7534795-T-G p.Phe919Val missense ARHGEF18 2 80642 2.4801E-5 40321 0 NA
19-7534797-C-T p.Phe919Phe synonymous ARHGEF18 1 80642 1.24005E-5 40321 0 1.1978E-5
19-7534800-C-T p.Asp920Asp synonymous ARHGEF18 1 80706 1.23907E-5 40353 0 NA
19-7534819-C-T p.Leu927Phe missense ARHGEF18 2 80788 2.47562E-5 40394 0 NA
19-7534856-G-A p.Arg939Gln missense ARHGEF18 3 80778 3.71388E-5 40389 0 4.99251E-5
19-7534857-G-A p.Arg939Arg synonymous ARHGEF18 547 80752 0.00677383 40376 3 0.00851195
19-7534864-C-T p.Arg942Cys missense ARHGEF18 1 80856 1.23677E-5 40428 0 3.32392E-5
19-7534865-G-A p.Arg942His missense ARHGEF18 2 80828 2.47439E-5 40414 0 3.98562E-6
19-7534868-C-T p.Ser943Leu missense ARHGEF18 1 80858 1.23674E-5 40429 0 1.59399E-5
19-7534869-G-A p.Ser943Ser synonymous ARHGEF18 3 80842 3.71094E-5 40421 0 6.25E-4
19-7534877-C-T p.Pro946Leu missense ARHGEF18 2 80844 2.4739E-5 40422 0 3.9868E-6
19-7534887-C-T p.Pro949Pro synonymous ARHGEF18 5 80764 6.19088E-5 40382 0 5.03525E-4
19-7534889-G-C p.Gly950Ala missense ARHGEF18 1 80742 1.23851E-5 40371 0 NA
19-7534892-G-C p.Arg951Thr missense ARHGEF18 1 80742 1.23851E-5 40371 0 NA
19-7534896-C-T p.His952His synonymous ARHGEF18 2 80718 2.47776E-5 40359 0 NA
19-7534901-C-T p.Pro954Leu missense ARHGEF18 1 80658 1.2398E-5 40329 0 1.66728E-5
19-7534904-C-T p.Ala955Val missense ARHGEF18 1 80576 1.24106E-5 40288 0 2.08646E-4
19-7534910-C-A p.Pro957Gln missense ARHGEF18 1 80578 1.24103E-5 40289 0 9.56816E-5
19-7534911-ACCAGGTGAGCCCCCACCCCCTGACATGAGCCCAGTCCCAGGGCAGCGGGGCTGCGGCACCACCCGGCGACTGCTCAGTCTGAACCCTCTCTCTGTT-A p.Pro958fs frameshift ARHGEF18 6 80526 7.45101E-5 40263 0 NA
19-7534911-A-G p.Pro957Pro synonymous ARHGEF18 1 80530 1.24177E-5 40265 0 3.20533E-5
19-7534914-A-G p.Pro958Pro splice_region+synonymous ARHGEF18 1 80530 1.24177E-5 40265 0 NA
19-7534916-G-A c.2875+1G>A splice_donor ARHGEF18 1 80512 1.24205E-5 40256 0 NA
19-7535014-C-T p.Pro960Ser missense+splice_region ARHGEF18 2 78804 2.53794E-5 39402 0 3.19305E-5
19-7535025-C-T p.Pro963Pro synonymous ARHGEF18 1 78574 1.27269E-5 39287 0 8.58104E-6
19-7535026-G-A p.Ala964Thr missense ARHGEF18 666 78318 0.00850379 39159 14 0.0160299
19-7535030-C-T p.Pro965Leu missense ARHGEF18 7 78360 8.93313E-5 39180 0 5.17286E-5
19-7535030-C-G p.Pro965Arg missense ARHGEF18 1 78360 1.27616E-5 39180 0 4.06349E-6
19-7535031-G-A p.Pro965Pro synonymous ARHGEF18 4 78306 5.10817E-5 39153 0 1.2782E-4
19-7535034-C-T p.Ser966Ser synonymous ARHGEF18 2 78288 2.55467E-5 39144 0 9.57488E-5
19-7535038-C-A p.Pro968Thr missense ARHGEF18 1 78142 1.27972E-5 39071 0 6.25E-4
19-7535040-G-A p.Pro968Pro synonymous ARHGEF18 6 77924 7.69981E-5 38962 0 1.91681E-4
19-7535041-C-T p.Pro969Ser missense ARHGEF18 1 78002 1.28202E-5 39001 0 4.08797E-6
19-7535058-C-T p.Ser974Ser synonymous ARHGEF18 2 76880 2.60146E-5 38440 0 2.60761E-5
19-7535059-G-A p.Glu975Lys missense ARHGEF18 3 76638 3.91451E-5 38319 0 6.38651E-5
19-7535073-C-G p.Leu979Leu synonymous ARHGEF18 3 75140 3.99255E-5 37570 0 4.09085E-6
19-7535076-G-A p.Lys980Lys synonymous ARHGEF18 2 74504 2.68442E-5 37252 0 3.18959E-5
19-7535079-C-T p.Ala981Ala synonymous ARHGEF18 7 73698 9.49822E-5 36849 0 3.69613E-5
19-7535080-G-A p.Gly982Arg missense ARHGEF18 9 73334 1.22726E-4 36667 0 2.42826E-4
19-7535083-G-A p.Gly983Ser missense ARHGEF18 4 72858 5.49013E-5 36429 0 5.24411E-5
19-7535083-G-C p.Gly983Arg missense ARHGEF18 1 72858 1.37253E-5 36429 0 NA
19-7535084-GC-TT p.Gly983Val missense ARHGEF18 3 72492 4.13839E-5 36246 0 NA
19-7535096-T-A p.Leu987Gln missense ARHGEF18 2 70374 2.84196E-5 35187 0 NA
19-7535100-C-T p.Pro988Pro synonymous ARHGEF18 17 69164 2.45793E-4 34582 1 1.5951E-4
19-7535101-G-A p.Gly989Arg missense ARHGEF18 3 68630 4.37127E-5 34315 0 5.2639E-5
19-7535104-C-T p.Pro990Ser missense ARHGEF18 2 67968 2.94256E-5 33984 0 3.19061E-5
19-7535106-C-G p.Pro990Pro synonymous ARHGEF18 1 67586 1.4796E-5 33793 0 1.27584E-4
19-7535119-C-A p.Pro995Thr missense ARHGEF18 1 64260 1.55618E-5 32130 0 4.20815E-6
19-7535126-C-T p.Pro997Leu missense ARHGEF18 5 62262 8.03058E-5 31131 0 0.0016589
19-7535127-G-A p.Pro997Pro synonymous ARHGEF18 6 62016 9.67492E-5 31008 0 2.11259E-5
19-7535129-C-T p.Ala998Val missense ARHGEF18 3 61560 4.87329E-5 30780 0 8.51274E-6
19-7535130-C-T p.Ala998Ala synonymous ARHGEF18 1 61514 1.62565E-5 30757 0 NA
19-7535135-C-G p.Pro1000Arg missense ARHGEF18 1 60650 1.6488E-5 30325 0 NA
19-7535137-C-T p.Leu1001Phe missense ARHGEF18 2 60252 3.31939E-5 30126 0 1.76494E-5
19-7535143-G-A p.Ala1003Thr missense ARHGEF18 5 58214 8.589E-5 29107 0 7.08981E-5
19-7535144-C-G p.Ala1003Gly missense ARHGEF18 1 58052 1.72259E-5 29026 0 1.40304E-5
19-7535157-C-T p.Ala1007Ala synonymous ARHGEF18 1 54202 1.84495E-5 27101 0 NA
19-7535161-AAAG-A p.Glu1010del disruptive_inframe_deletion ARHGEF18 1 52852 1.89208E-5 26426 0 9.06125E-6
19-7535166-A-C p.Glu1010Asp missense ARHGEF18 1 51328 1.94825E-5 25664 0 3.19448E-5
19-7535169-C-T p.Asp1011Asp synonymous ARHGEF18 4 50012 7.99808E-5 25006 0 2.13497E-5
19-7535170-G-A p.Val1012Ile missense ARHGEF18 11 49626 2.21658E-4 24813 0 2.55477E-4
19-7535173-A-G p.Ile1013Val missense ARHGEF18 1 48948 2.04298E-5 24474 0 1.85443E-5
19-7535173-A-T p.Ile1013Phe missense ARHGEF18 1 48948 2.04298E-5 24474 0 9.27214E-6
19-7535178-C-T p.Phe1014Phe synonymous ARHGEF18 2 47802 4.18393E-5 23901 0 9.44843E-5
19-7535202-G-T c.*17+1G>T splice_donor ARHGEF18 1 41900 2.38663E-5 20950 0 NA
19-7535207-A-C c.*17+6A>C splice_region ARHGEF18 5 40774 1.22627E-4 20387 0 0.001875
19-7535209-G-C c.*17+8G>C splice_region ARHGEF18 351 40234 0.00872396 20117 1 0.0107627
19-7535402-CT-C c.*18-8delT splice_region ARHGEF18 49 20910 0.00234338 10455 0 0.00452237
19-7535402-CTT-C c.*18-9_*18-8delTT splice_region ARHGEF18 72 21758 0.00330913 10879 3 0.00345129
19-7535402-C-CT c.*18-8dupT splice_region ARHGEF18 539 20722 0.026011 10361 12 0.0950492
19-7535402-C-CTT c.*18-9_*18-8dupTT splice_region ARHGEF18 3 21810 1.37552E-4 10905 0 1.9835E-4
19-7535402-C-CTTT c.*18-10_*18-8dupTTT splice_region ARHGEF18 1 21820 4.58295E-5 10910 0 NA