Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
11-6416360-G-A p.Cys705Cys synonymous APBB1 1 47082 2.12395E-5 23541 0 3.18492E-5
11-6416362-A-G p.Cys705Arg missense APBB1 1 47078 2.12413E-5 23539 0 3.18492E-5
11-6416386-A-G p.Leu697Leu synonymous APBB1 1 47580 2.10172E-5 23790 0 9.5645E-5
11-6416410-A-AG p.Cys689fs frameshift APBB1 22 48534 4.5329E-4 24267 0 8.60695E-4
11-6416412-G-A p.Pro688Leu missense APBB1 1 48686 2.05398E-5 24343 0 NA
11-6416415-G-A p.Ser687Phe missense APBB1 2 48802 4.09819E-5 24401 0 4.7719E-5
11-6416418-G-A p.Pro686Leu missense APBB1 1 48984 2.04148E-5 24492 0 NA
11-6416420-G-A p.Val685Val synonymous APBB1 2 49130 4.07083E-5 24565 0 6.59631E-4
11-6416426-T-A p.Ala683Ala synonymous APBB1 2 49574 4.03437E-5 24787 0 NA
11-6416443-T-A p.Lys678* stop_gained APBB1 14 50976 2.74639E-4 25488 0 0.00239234
11-6416459-GC-G p.Ser672fs frameshift APBB1 1 52586 1.90165E-5 26293 0 1.42477E-4
11-6416475-T-TGAGGC p.His667fs frameshift APBB1 1 54294 1.84182E-5 27147 0 NA
11-6416479-G-A p.Pro666Ser missense APBB1 2 54904 3.64272E-5 27452 0 NA
11-6416492-C-CA p.Val662fs frameshift APBB1 1 56380 1.77368E-5 28190 0 NA
11-6416492-C-T p.Leu661Leu synonymous APBB1 1 56380 1.77368E-5 28190 0 NA
11-6416494-G-T p.Leu661Met missense APBB1 1 56678 1.76435E-5 28339 0 4.03421E-5
11-6416504-T-A p.Glu657Asp missense APBB1 3 57784 5.19175E-5 28892 0 NA
11-6416512-G-A c.1966-3C>T splice_region APBB1 1 58598 1.70654E-5 29299 0 3.77644E-5
11-6416517-A-T c.1966-8T>A splice_region APBB1 1 59032 1.694E-5 29516 0 NA
11-6416769-G-C p.Pro708Ala missense APBB1 1 76476 1.3076E-5 38238 0 NA
11-6416770-G-A p.Thr707Thr synonymous APBB1 1 76546 1.3064E-5 38273 0 NA
11-6416782-C-T p.Leu703Leu synonymous APBB1 4 77168 5.1835E-5 38584 0 9.56511E-5
11-6416787-G-A p.Arg702Trp missense APBB1 2 77526 2.57978E-5 38763 0 3.85277E-5
11-6416790-T-C p.Lys701Glu missense APBB1 1 77732 1.28647E-5 38866 0 NA
11-6416812-C-T p.Ser693Ser synonymous APBB1 1 78422 1.27515E-5 39211 0 3.19122E-5
11-6416813-G-A p.Ser693Leu missense APBB1 2 78492 2.54803E-5 39246 0 6.37959E-5
11-6416815-C-A p.Gln692His missense APBB1 13 78668 1.65251E-4 39334 0 3.19183E-5
11-6416842-T-G p.Val683Val synonymous APBB1 2 79508 2.51547E-5 39754 0 NA
11-6416844-C-T p.Val683Ile missense APBB1 1 79546 1.25713E-5 39773 0 3.84166E-5
11-6416846-C-T p.Arg682His missense APBB1 2 79578 2.51326E-5 39789 0 3.1902E-5
11-6416850-G-A p.Arg681Trp missense APBB1 22 79662 2.76167E-4 39831 0 6.02612E-4
11-6416857-A-G p.Ser678Ser synonymous APBB1 1 79862 1.25216E-5 39931 0 3.86481E-5
11-6416860-C-T p.Glu677Glu synonymous APBB1 1 79932 1.25106E-5 39966 0 4.23761E-6
11-6416863-A-C p.Ala676Ala synonymous APBB1 1 79950 1.25078E-5 39975 0 1.9088E-5
11-6416871-G-T p.Pro674Thr missense APBB1 1 80062 1.24903E-5 40031 0 4.28123E-6
11-6416878-G-C p.Leu671Leu synonymous APBB1 1 80132 1.24794E-5 40066 0 3.18959E-5
11-6416878-G-A p.Leu671Leu synonymous APBB1 4 80132 4.99176E-5 40066 0 1.37075E-4
11-6416888-G-A p.Thr668Ile missense APBB1 2 80254 2.49209E-5 40127 0 NA
11-6416888-G-T p.Thr668Asn missense APBB1 2 80254 2.49209E-5 40127 0 9.24915E-6
11-6416893-G-A p.Ala666Ala synonymous APBB1 1 80288 1.24552E-5 40144 0 3.19061E-5
11-6416903-C-T p.Arg663His missense APBB1 1 80360 1.2444E-5 40180 0 1.83503E-5
11-6416904-G-A p.Arg663Cys missense APBB1 2 80356 2.48892E-5 40178 0 NA
11-6416905-G-A p.Ala662Ala synonymous APBB1 1 80352 1.24452E-5 40176 0 1.31804E-5
11-6416927-C-T p.Arg655His missense APBB1 2 80424 2.48682E-5 40212 0 3.19244E-5
11-6416931-GCTGCGGAGGCAAGCAGGGCAGTCACTCCCCAGCCTACCTCCCATGGGGCCACGCCACCACCACACCACCCTACTAGTAGCTTAC-G c.1959+1_1960-1delGTAAGCTACTAGTAGGGTGGTGTGGTGGTGGCGTGGCCCCATGGGAGGTAGGCTGGGGAGTGACTGCCCTGCTTGCCTCCGCAG splice_acceptor APBB1 9 80452 1.11868E-4 40226 1 NA
11-6416935-C-T c.1960-4G>A splice_region APBB1 3 80388 3.7319E-5 40194 0 3.1957E-5
11-6416935-C-G c.1960-4G>C splice_region APBB1 1 80388 1.24397E-5 40194 0 8.99087E-6
11-6416935-C-A c.1960-4G>T splice_region APBB1 1 80388 1.24397E-5 40194 0 8.99087E-6
11-6416936-G-A c.1960-5C>T splice_region APBB1 2 80410 2.48725E-5 40205 0 3.19489E-5
11-6417011-C-A c.1959+5G>T splice_region APBB1 1 80112 1.24825E-5 40056 0 NA
11-6417022-C-T p.Ala651Ala synonymous APBB1 2 80012 2.49963E-5 40006 0 1.9974E-5
11-6417022-CGCAGCCTGCACAGCCTCTGAGAGGCTG-C p.Ser643_Ala651del disruptive_inframe_deletion APBB1 1 80012 1.24981E-5 40006 0 NA
11-6417024-C-T p.Ala651Thr missense APBB1 1 79980 1.25031E-5 39990 0 NA
11-6417035-G-A p.Ala647Val missense APBB1 1 79878 1.25191E-5 39939 0 NA
11-6417040-T-C p.Ser645Ser synonymous APBB1 1 79866 1.2521E-5 39933 0 NA
11-6417046-G-A p.Ser643Ser synonymous APBB1 2 79800 2.50627E-5 39900 0 3.99119E-6
11-6417061-C-T p.Glu638Glu synonymous APBB1 1 79652 1.25546E-5 39826 0 8.29449E-6
11-6417064-G-A p.Cys637Cys synonymous APBB1 9 79542 1.13148E-4 39771 0 4.7882E-5
11-6417099-C-T p.Gly626Ser missense APBB1 1 78758 1.26971E-5 39379 0 8.29683E-6
11-6417100-G-A p.Ala625Ala synonymous APBB1 5 78794 6.34566E-5 39397 0 9.56572E-5
11-6417129-C-T p.Val616Ile missense APBB1 3 77972 3.84754E-5 38986 0 NA
11-6417142-G-A p.Ala611Ala synonymous APBB1 6 77270 7.76498E-5 38635 0 4.41066E-5
11-6417176-C-G p.Gly600Ala missense APBB1 2 77802 2.57063E-5 38901 0 NA
11-6417178-C-T p.Leu599Leu synonymous APBB1 1 77870 1.28419E-5 38935 0 0.00100705
11-6417186-C-T p.Ala597Thr missense APBB1 2 78098 2.56088E-5 39049 0 NA
11-6417197-A-ATGGAGGGAACTCAGTTAAAAAGGAACACCAACCCCACACTGTGTTCCACATCCATCTTAGCAGCTCTTC c.1783-6_1783-5insGAAGAGCTGCTAAGATGGATGTGGAACACAGTGTGGGGTTGGTGTTCCTTTTTAACTGAGTTCCCTCCA splice_region APBB1 1 78664 1.27123E-5 39332 0 1.60386E-5
11-6417342-G-A p.Ile590Ile synonymous APBB1 9 80674 1.1156E-4 40337 0 0.00151976
11-6417360-G-A p.Ala584Ala synonymous APBB1 3 80636 3.72042E-5 40318 0 6.37146E-5
11-6417367-C-T p.Ser582Asn missense APBB1 1 80636 1.24014E-5 40318 0 NA
11-6417376-C-A p.Ser579Ile missense APBB1 1 80598 1.24073E-5 40299 0 3.18532E-5
11-6417394-C-T p.Arg573His missense APBB1 1 80546 1.24153E-5 40273 0 NA
11-6417395-G-A p.Arg573Cys missense APBB1 2 80526 2.48367E-5 40263 0 6.25016E-6
11-6417415-G-A p.Ser566Leu missense APBB1 1 80428 1.24335E-5 40214 0 NA
11-6417420-G-A p.Leu564Leu synonymous APBB1 1 80378 1.24412E-5 40189 0 3.18857E-5
11-6417427-C-T p.Gly562Glu missense APBB1 6 80340 7.46826E-5 40170 0 4.27936E-5
11-6417435-C-G p.Val559Val synonymous APBB1 1 80316 1.24508E-5 40158 0 5.61167E-4
11-6417435-C-T p.Val559Val synonymous APBB1 1 80316 1.24508E-5 40158 0 NA
11-6417450-AACATATGG-A c.1667-13_1667-6delCCATATGT splice_region APBB1 7 80244 8.72339E-5 40122 0 1.27478E-4
11-6417452-C-T c.1667-7G>A splice_region APBB1 1 80244 1.2462E-5 40122 0 NA
11-6422240-C-T p.Val549Ile missense APBB1 88 81058 0.00108564 40529 0 8.15135E-4
11-6422249-G-C p.Leu546Val missense APBB1 1 81064 1.23359E-5 40532 0 NA
11-6422262-G-C p.Phe541Leu missense APBB1 1 81068 1.23353E-5 40534 0 NA
11-6422265-C-T p.Lys540Lys synonymous APBB1 2 81066 2.46713E-5 40533 0 8.23642E-6
11-6422289-C-T p.Ala532Ala synonymous APBB1 4 81064 4.93437E-5 40532 0 6.37552E-5
11-6422290-G-A p.Ala532Val missense APBB1 5 81064 6.16797E-5 40532 0 6.3743E-5
11-6422305-A-G c.1583-3T>C splice_region APBB1 2 81054 2.46749E-5 40527 0 NA
11-6422309-G-T c.1583-7C>A splice_region APBB1 3 81054 3.70124E-5 40527 0 7.95273E-6
11-6422579-G-A n.1145C>T splice_region APBB1 1 81074 1.23344E-5 40537 0 NA
11-6422590-C-A p.Asp523Tyr missense APBB1 1 81082 1.23332E-5 40541 0 NA
11-6422608-C-T p.Asp517Asn missense APBB1 1 81072 1.23347E-5 40536 0 1.64867E-5
11-6422612-G-C p.Ser515Ser synonymous APBB1 1 81078 1.23338E-5 40539 0 NA
11-6422621-A-C p.Asn512Lys missense APBB1 1 81078 1.23338E-5 40539 0 NA
11-6422628-AAGC-A p.Cys509del disruptive_inframe_deletion APBB1 1 81074 1.23344E-5 40537 0 NA
11-6422635-G-A p.Arg508Cys missense APBB1 3 81068 3.7006E-5 40534 0 2.06101E-4
11-6422636-G-A p.Ala507Ala synonymous APBB1 1 81076 1.23341E-5 40538 0 3.1902E-5
11-6422644-G-A p.Arg505Cys missense APBB1 1 81062 1.23362E-5 40531 0 8.24701E-6
11-6422646-C-T p.Arg504Gln missense APBB1 1 81056 1.23371E-5 40528 0 1.64943E-5
11-6422646-C-A p.Arg504Leu missense APBB1 1 81056 1.23371E-5 40528 0 8.24715E-6
11-6422651-G-A p.Ala502Ala synonymous APBB1 7 81056 8.63601E-5 40528 0 4.12405E-5
11-6422665-G-A c.1498-6C>T splice_region APBB1 1 81042 1.23393E-5 40521 0 NA
11-6422799-C-T c.1497+5G>A splice_region APBB1 1 81050 1.23381E-5 40525 0 1.19299E-5
11-6422800-G-A c.1497+4C>T splice_region APBB1 6 81038 7.40393E-5 40519 0 9.56145E-5
11-6422806-T-C p.Lys499Glu missense+splice_region APBB1 1 81060 1.23365E-5 40530 0 8.24008E-6
11-6422811-C-A p.Cys497Phe missense APBB1 1 81058 1.23368E-5 40529 0 NA
11-6422824-G-A p.Leu493Leu synonymous APBB1 2 81058 2.46737E-5 40529 0 5.03525E-4
11-6422833-C-T p.Ala490Thr missense APBB1 1 81040 1.23396E-5 40520 0 0.00125
11-6422834-G-A p.Ile489Ile synonymous APBB1 67 81040 8.26752E-4 40520 1 0.0024876
11-6422838-T-A p.Asn488Ile missense APBB1 1 81042 1.23393E-5 40521 0 NA
11-6422848-G-A p.Pro485Ser missense APBB1 1 81026 1.23417E-5 40513 0 6.58924E-5
11-6422859-C-T p.Arg481His missense APBB1 4 81012 4.93754E-5 40506 0 8.23655E-6
11-6422860-G-A p.Arg481Cys missense APBB1 5 81016 6.17162E-5 40508 0 5.56673E-5
11-6422866-C-T p.Val479Met missense APBB1 1 81014 1.23435E-5 40507 0 3.97624E-6
11-6422867-G-A p.His478His synonymous APBB1 43 81012 5.30786E-4 40506 1 0.00149904
11-6422893-T-G p.Lys470Gln missense APBB1 1 80974 1.23496E-5 40487 0 NA
11-6422894-A-G p.Asp469Asp synonymous APBB1 1 80974 1.23496E-5 40487 0 3.9764E-6
11-6422898-C-T p.Arg468His missense APBB1 36 80954 4.44697E-4 40477 0 2.23157E-4
11-6422906-G-A c.-25C>T 5_prime_UTR_premature_start_codon_gain APBB1 1 80886 1.23631E-5 40443 0 6.25E-4
11-6422917-C-T p.Asp462Asn missense+splice_region APBB1 1 80786 1.23784E-5 40393 0 NA
11-6422921-G-A c.1383-3C>T splice_region APBB1 3 80706 3.7172E-5 40353 0 NA
11-6423201-T-C n.786+6A>G splice_region APBB1 3 80282 3.73683E-5 40141 0 7.99624E-5
11-6423203-G-C n.786+4C>G splice_region APBB1 4 80306 4.98095E-5 40153 0 9.83052E-6
11-6423211-C-T p.Glu203Lys missense+splice_region APBB1 7 80244 8.72339E-5 40122 0 1.92334E-5
11-6423215-G-A n.781-3C>T splice_region APBB1 1 80272 1.24576E-5 40136 0 1.90002E-5
11-6423216-G-A n.781-4C>T splice_region APBB1 3 80248 3.73841E-5 40124 0 3.18898E-5
11-6423218-T-C n.781-6A>G splice_region APBB1 1 80238 1.24629E-5 40119 0 NA
11-6423317-A-G p.Ser459Ser synonymous APBB1 1 80928 1.23567E-5 40464 0 3.1902E-5
11-6423319-T-A p.Ser459Cys missense APBB1 1 80924 1.23573E-5 40462 0 3.18593E-5
11-6423320-G-A p.Asp458Asp synonymous APBB1 3 80930 3.70691E-5 40465 1 NA
11-6423329-G-A c.-55C>T 5_prime_UTR_premature_start_codon_gain APBB1 1 80914 1.23588E-5 40457 0 1.19515E-5
11-6423331-C-T p.Val455Ile missense APBB1 3 80914 3.70764E-5 40457 0 3.58537E-5
11-6423332-G-A p.Gly454Gly synonymous APBB1 4 80906 4.94401E-5 40453 0 1.99184E-5
11-6423341-G-A p.Arg451Arg synonymous APBB1 140 80918 0.00173015 40459 0 0.00166705
11-6423342-C-T p.Arg451His missense APBB1 2 80942 2.47091E-5 40471 0 3.18492E-5
11-6423343-G-A p.Arg451Cys missense APBB1 19 80936 2.34753E-4 40468 0 1.11474E-4
11-6423347-G-A p.Ser449Ser synonymous APBB1 1 80956 1.23524E-5 40478 0 8.24892E-6
11-6423349-T-C p.Ser449Gly missense APBB1 3 80948 3.70608E-5 40474 0 NA
11-6423355-T-C p.Ile447Val missense APBB1 1 80960 1.23518E-5 40480 0 8.24701E-6
11-6423364-C-T p.Ala444Thr missense APBB1 1 80948 1.23536E-5 40474 0 2.47415E-5
11-6423365-G-A c.-91C>T 5_prime_UTR_premature_start_codon_gain APBB1 38 80960 4.69368E-4 40480 0 6.37308E-4
11-6423419-C-T p.Gln425Gln synonymous APBB1 30 80852 3.71048E-4 40426 0 2.54801E-4
11-6423431-A-T p.Asp421Glu missense APBB1 3 80774 3.71407E-5 40387 0 8.25791E-6
11-6423815-G-A p.Gly415Gly synonymous APBB1 3 80958 3.70563E-5 40479 0 5.03525E-4
11-6423826-T-C p.Met412Val missense APBB1 8 80994 9.87727E-5 40497 0 2.96971E-4
11-6423834-T-C p.His409Arg missense APBB1 1 81028 1.23414E-5 40514 0 NA
11-6423838-G-A p.Leu408Leu synonymous APBB1 1 81048 1.23384E-5 40524 0 NA
11-6423841-T-C p.Asn407Asp missense APBB1 2 81054 2.46749E-5 40527 0 NA
11-6423842-G-GT p.Asn406fs frameshift APBB1 1 81056 1.23371E-5 40528 0 NA
11-6423857-G-C p.Leu401Leu synonymous APBB1 4 81072 4.93389E-5 40536 0 NA
11-6423864-C-T p.Arg399His missense APBB1 3 81058 3.70105E-5 40529 0 6.37633E-5
11-6423865-G-A p.Arg399Cys missense APBB1 1 81056 1.23371E-5 40528 0 3.97649E-6
11-6423872-A-G p.Asn396Asn synonymous APBB1 1 81064 1.23359E-5 40532 0 NA
11-6423873-T-C p.Asn396Ser missense APBB1 137 81054 0.00169023 40527 0 0.0014036
11-6423878-G-A p.Val394Val synonymous APBB1 2 81046 2.46773E-5 40523 0 NA
11-6423881-T-G p.Ala393Ala synonymous APBB1 3 81034 3.70215E-5 40517 0 NA
11-6423893-G-T p.Arg389Arg synonymous APBB1 1 81002 1.23454E-5 40501 0 NA
11-6423894-C-T p.Arg389His missense APBB1 1 80998 1.2346E-5 40499 0 3.18119E-5
11-6423895-G-A p.Arg389Cys missense APBB1 1 80986 1.23478E-5 40493 0 4.11875E-5
11-6423901-G-C p.Pro387Ala missense APBB1 1 80994 1.23466E-5 40497 0 8.23764E-6
11-6423907-G-A p.Leu385Leu synonymous APBB1 150 80974 0.00185245 40487 2 0.004842
11-6423917-G-A p.Thr381Thr synonymous APBB1 1 80942 1.23545E-5 40471 0 3.18552E-5
11-6423917-G-T p.Thr381Thr synonymous APBB1 1 80942 1.23545E-5 40471 0 NA
11-6423918-G-A p.Thr381Ile missense APBB1 1 80926 1.2357E-5 40463 0 3.97678E-6
11-6423930-C-G p.Trp377Ser missense APBB1 2 80908 2.47194E-5 40454 0 NA
11-6423935-T-G p.Leu375Leu synonymous APBB1 2 80870 2.4731E-5 40435 0 NA
11-6423939-G-C p.Ser374Cys missense APBB1 1 80880 1.2364E-5 40440 0 3.97842E-6
11-6423941-G-A p.Arg373Arg synonymous APBB1 75 80858 9.27552E-4 40429 0 0.00375
11-6423943-G-A p.Arg373Cys missense APBB1 8 80848 9.89511E-5 40424 0 6.25E-4
11-6423947-G-A p.Ala371Ala synonymous APBB1 125 80844 0.00154619 40422 1 0.00248598
11-6423950-G-A p.Phe370Phe synonymous APBB1 6 80816 7.42427E-5 40408 0 0.00125
11-6424397-C-T p.Arg361Gln missense APBB1 1 81042 1.23393E-5 40521 0 3.18857E-5
11-6424398-G-A p.Arg361Trp missense APBB1 4 81046 4.93547E-5 40523 0 1.5986E-4
11-6424402-G-C p.Pro359Pro synonymous APBB1 2 81058 2.46737E-5 40529 0 9.56084E-5
11-6424421-T-C p.Gln353Arg missense APBB1 1 81070 1.2335E-5 40535 0 1.67238E-5
11-6424429-C-T p.Pro350Pro synonymous APBB1 14 81058 1.72716E-4 40529 0 3.18837E-4
11-6424429-C-G p.Pro350Pro synonymous APBB1 1 81060 1.23365E-5 40530 0 NA
11-6424430-G-A p.Pro350Leu missense APBB1 2 81060 2.46731E-5 40530 0 1.19752E-5
11-6424431-G-A p.Pro350Ser missense APBB1 2 81064 2.46719E-5 40532 0 6.78253E-5
11-6424438-GCTGAAGGCAGATGGTAATACTTGGCACAGGGCTCCCATAAATGGAGCTGTCCCAAGGCCCCTTCCAGACAGATCCATCCCACTGCCAGCTCACTGCATCTGGCAGCTCAC-G c.1040+1_1041-1del splice_acceptor APBB1 11 81046 1.35725E-4 40523 5 NA
11-6424575-C-T p.Thr338Thr synonymous APBB1 2 80820 2.47464E-5 40410 0 3.98057E-6
11-6424576-G-A p.Thr338Met missense APBB1 1 80810 1.23747E-5 40405 0 3.18456E-5
11-6424577-T-C p.Thr338Ala missense APBB1 1 80808 1.2375E-5 40404 0 NA
11-6424581-C-A p.Glu336Asp missense APBB1 2 80826 2.47445E-5 40413 0 NA
11-6424582-T-C p.Glu336Gly missense APBB1 4 80808 4.95E-5 40404 0 0.00100705
11-6424588-G-A p.Pro334Leu missense APBB1 1 80810 1.23747E-5 40405 0 NA
11-6424600-C-T p.Gly330Glu missense APBB1 1 80800 1.23762E-5 40400 0 3.18634E-5
11-6424602-C-G p.Leu329Leu synonymous APBB1 1 80822 1.23729E-5 40411 0 NA
11-6424605-C-G p.Glu328Asp missense APBB1 16 80802 1.98015E-4 40401 0 0.00151057
11-6424610-T-C p.Met327Val missense APBB1 634 80790 0.00784751 40395 3 0.00956697
11-6424613-G-C p.Pro326Ala missense APBB1 3 80784 3.71361E-5 40392 0 3.18756E-5
11-6424615-G-C p.Ala325Gly missense APBB1 3 80784 3.71361E-5 40392 0 NA
11-6424622-C-G p.Asp323His missense APBB1 2 80814 2.47482E-5 40407 0 NA
11-6424628-G-A p.Pro321Ser missense APBB1 3 80834 3.71131E-5 40417 1 NA
11-6424632-A-T p.Asp319Glu missense+splice_region APBB1 5 80852 6.18414E-5 40426 0 NA
11-6424633-T-C p.Asp319Gly missense+splice_region APBB1 17 80852 2.10261E-4 40426 0 6.37349E-5
11-6424633-TCCTTGGGAAGGGGATTGAGGAATCAGTATCAAAATGATGCCCCTCCTCCAGCTATCCCGTGGTAAAGCAGGTCCCCTTACCCA-T p.Asp319fs frameshift APBB1 12 80852 1.48419E-4 40426 6 NA
11-6424714-C-A c.954+4G>T splice_region APBB1 1 81050 1.23381E-5 40525 0 NA
11-6424736-C-T p.Glu312Glu synonymous APBB1 4 81078 4.93352E-5 40539 0 NA
11-6424745-T-C p.Glu309Glu synonymous APBB1 6 81078 7.40028E-5 40539 0 9.5584E-5
11-6424752-T-A p.His307Leu missense APBB1 1 81078 1.23338E-5 40539 0 3.97659E-6
11-6424770-G-C p.Thr301Ser missense APBB1 1 81060 1.23365E-5 40530 0 3.97684E-6
11-6424774-GCTAGGAGGAGGGATGGGAGTAGTGAGTGAGTGTCCTATCCTACTCCAGCAGCACACACTCCCTCCACCCCTGGCCCAAAATCAACAGGCCTGTGAGCCTCAC-G c.897+1_898-1del splice_acceptor APBB1 7 81064 8.63515E-5 40532 3 NA
11-6424869-AG-CC c.897+7_897+8delCTinsGG splice_region APBB1 9 81014 1.11092E-4 40507 0 NA
11-6424869-A-C c.897+8T>G splice_region APBB1 1 81014 1.23435E-5 40507 0 9.55962E-5
11-6424870-G-C c.897+7C>G splice_region APBB1 1 81008 1.23445E-5 40504 0 9.55536E-5
11-6424883-C-G p.Glu297Asp missense APBB1 1 81012 1.23439E-5 40506 0 NA
11-6424903-C-G p.Gly291Arg missense APBB1 20 80988 2.4695E-4 40494 0 4.14039E-4
11-6424911-G-A p.Pro288Leu missense APBB1 1 80962 1.23515E-5 40481 0 NA
11-6424917-G-T p.Ala286Asp missense APBB1 1 80948 1.23536E-5 40474 0 8.13723E-6
11-6424920-C-T p.Arg285Gln missense APBB1 2 80946 2.47078E-5 40473 0 1.62577E-5
11-6424925-G-A p.Pro283Pro synonymous APBB1 5 80948 6.1768E-5 40474 0 0.00100705
11-6424928-G-T p.Pro282Pro synonymous APBB1 1 80940 1.23548E-5 40470 0 NA
11-6424930-G-A p.Pro282Ser missense APBB1 1 80924 1.23573E-5 40462 0 4.03275E-6
11-6424985-C-T p.Gln263Gln synonymous APBB1 2 80860 2.47341E-5 40430 0 3.18532E-5
11-6425006-C-T p.Pro256Pro synonymous APBB1 2 80784 2.47574E-5 40392 0 6.37186E-5
11-6425014-C-T p.Asp254Asn missense APBB1 21 80732 2.6012E-4 40366 0 0.00100705
11-6425015-G-A c.-19C>T 5_prime_UTR_premature_start_codon_gain APBB1 1 80736 1.2386E-5 40368 0 4.4023E-6
11-6425018-A-C p.Asp252Glu missense APBB1 2 80732 2.47733E-5 40366 0 NA
11-6425021-C-T p.Thr251Thr synonymous APBB1 1 80712 1.23897E-5 40356 0 9.10996E-6
11-6425022-G-A p.Thr251Met missense APBB1 4 80700 4.95663E-5 40350 0 6.37024E-5
11-6425026-C-T p.Glu250Lys missense APBB1 1 80662 1.23974E-5 40331 0 NA
11-6425027-G-A c.-31C>T 5_prime_UTR_premature_start_codon_gain APBB1 1 80652 1.23989E-5 40326 0 5.03525E-4
11-6425276-T-C c.-165A>G 5_prime_UTR_premature_start_codon_gain APBB1 1 18344 5.45137E-5 9172 0 NA
11-6425289-C-T c.-177-1G>A splice_acceptor APBB1 1 17412 5.74317E-5 8706 0 NA
11-6425839-C-T p.Arg5Gln missense+splice_region APBB1 2 65360 3.05998E-5 32680 0 3.18878E-5
11-6425840-G-A p.Arg5* stop_gained APBB1 1 65442 1.52807E-5 32721 0 NA
11-6425852-T-C p.Met1? start_lost APBB1 1 69182 1.44546E-5 34591 0 NA
11-6425868-G-A c.-16C>T 5_prime_UTR_premature_start_codon_gain APBB1 2 71240 2.80741E-5 35620 0 8.60289E-5
11-6425967-C-T n.119+8G>A splice_region APBB1 1 74696 1.33876E-5 37348 0 NA
11-6425975-C-T p.Asp21Asn missense+splice_region APBB1 4 74738 5.35203E-5 37369 0 0.00137185
11-6425977-G-A p.Ala20Val missense+splice_region APBB1 2 74738 2.67601E-5 37369 0 NA
11-6425978-C-T p.Ala20Thr missense APBB1 6 74738 8.02804E-5 37369 0 1.59408E-4
11-6425979-G-A p.Ser19Ser synonymous APBB1 1 74732 1.33811E-5 37366 0 6.25E-4
11-6425998-A-C p.Ile13Ser missense APBB1 1 74758 1.33765E-5 37379 0 3.19203E-5
11-6425999-T-C p.Ile13Val missense APBB1 1 74760 1.33761E-5 37380 0 2.22081E-5
11-6426000-G-A p.Ala12Ala synonymous APBB1 34 74752 4.54837E-4 37376 0 7.35012E-4
11-6426025-A-G p.Met4Thr missense APBB1 2 74730 2.6763E-5 37365 0 7.40466E-6
11-6426026-T-A p.Met4Leu missense APBB1 1 74730 1.33815E-5 37365 0 NA
11-6426026-T-C p.Met4Val missense APBB1 1 74730 1.33815E-5 37365 0 NA
11-6426027-G-A p.Ala3Ala synonymous APBB1 1 74718 1.33837E-5 37359 0 7.40423E-6
11-6426029-C-T p.Ala3Thr missense APBB1 2 74702 2.6773E-5 37351 0 1.6372E-4
11-6426029-C-G p.Ala3Pro missense APBB1 1 74702 1.33865E-5 37351 0 7.4073E-6
11-6426040-G-A c.-5C>T 5_prime_UTR_premature_start_codon_gain APBB1 10 74624 1.34005E-4 37312 0 3.19673E-5
11-6426385-G-T c.-119C>A 5_prime_UTR_premature_start_codon_gain APBB1 1 35104 2.84868E-5 17552 0 NA
11-6426549-G-C c.-283C>G 5_prime_UTR_premature_start_codon_gain APBB1 2 63488 3.1502E-5 31744 0 NA
11-6426602-C-T c.-336G>A 5_prime_UTR_premature_start_codon_gain APBB1 1 64360 1.55376E-5 32180 0 NA
11-6426607-C-A c.-341G>T 5_prime_UTR_premature_start_codon_gain APBB1 12 64398 1.86341E-4 32199 0 2.23257E-4
11-6426611-C-T c.-309+6G>A splice_region APBB1 1 64432 1.55202E-5 32216 0 NA
11-6426619-G-T c.-311C>A splice_region APBB1 1 64458 1.5514E-5 32229 0 NA
11-6426643-G-A c.-335C>T 5_prime_UTR_premature_start_codon_gain APBB1 5 64508 7.75098E-5 32254 0 3.1904E-5
11-6426651-G-A c.-343C>T 5_prime_UTR_premature_start_codon_gain APBB1 1 64520 1.54991E-5 32260 0 NA
11-6426672-G-A c.-112C>T 5_prime_UTR_premature_start_codon_gain APBB1 3 64544 4.64799E-5 32272 0 NA
11-6426697-G-A c.-137C>T 5_prime_UTR_premature_start_codon_gain APBB1 1 64542 1.54938E-5 32271 0 NA
11-6426796-C-T c.-236G>A 5_prime_UTR_premature_start_codon_gain APBB1 1 64416 1.55241E-5 32208 0 NA
11-6426816-G-A c.-256C>T 5_prime_UTR_premature_start_codon_gain APBB1 1 64058 1.56109E-5 32029 0 6.37227E-5
11-6426839-C-A c.-279G>T 5_prime_UTR_premature_start_codon_gain APBB1 19 63308 3.0012E-4 31654 0 2.55004E-4
11-6431851-A-G c.721+6T>C splice_region APBB1 2 79526 2.5149E-5 39763 0 NA
11-6431864-C-A p.Glu238Asp missense APBB1 3 80108 3.74494E-5 40054 0 3.18532E-5
11-6431871-G-A p.Ser236Phe missense APBB1 1 80318 1.24505E-5 40159 0 5.66906E-6
11-6431877-T-C p.Tyr234Cys missense APBB1 4 80568 4.96475E-5 40284 0 9.09438E-6
11-6431882-G-A p.Pro232Pro synonymous APBB1 10 80670 1.23962E-4 40335 0 1.01569E-4
11-6431900-G-T p.Thr226Thr synonymous APBB1 3 80896 3.70847E-5 40448 0 9.05814E-6
11-6431917-C-G p.Asp221His missense APBB1 1 80964 1.23512E-5 40482 0 NA
11-6431925-C-G p.Ser218Thr missense APBB1 1 80980 1.23487E-5 40490 0 NA
11-6431931-G-A p.Ala216Val missense APBB1 1 80974 1.23496E-5 40487 0 3.18613E-5
11-6431940-C-T p.Arg213Gln missense APBB1 2 80968 2.47011E-5 40484 0 5.03525E-4
11-6431943-A-C p.Met212Arg missense APBB1 2 80946 2.47078E-5 40473 0 1.48243E-5
11-6431944-T-G p.Met212Leu missense APBB1 1 80952 1.2353E-5 40476 0 NA
11-6431945-G-C p.Gly211Gly synonymous APBB1 2 80952 2.4706E-5 40476 0 6.36983E-5
11-6431961-G-A p.Ala206Val missense APBB1 2 80932 2.47121E-5 40466 0 NA
11-6431965-T-A p.Ser205Cys missense APBB1 2 80926 2.47139E-5 40463 0 2.76113E-5
11-6431975-T-C p.Glu201Glu synonymous APBB1 1 80920 1.23579E-5 40460 0 NA
11-6431978-C-T p.Arg200Arg synonymous APBB1 2 80900 2.47219E-5 40450 0 4.42976E-6
11-6431979-C-T p.Arg200Gln missense APBB1 1 80894 1.23619E-5 40447 0 NA
11-6431980-G-C p.Arg200Gly missense APBB1 1 80892 1.23622E-5 40446 0 NA
11-6431984-G-T p.Gly198Gly synonymous APBB1 5 80888 6.18139E-5 40444 0 1.59256E-4
11-6431989-C-A p.Asp197Tyr missense APBB1 2 80880 2.4728E-5 40440 0 NA
11-6431997-G-T p.Ala194Asp missense APBB1 2 80870 2.4731E-5 40435 0 0.00100806
11-6432008-G-A p.Pro190Pro synonymous APBB1 1 80824 1.23726E-5 40412 0 8.14996E-6
11-6432009-G-A p.Pro190Leu missense APBB1 51 80812 6.31094E-4 40406 0 0.00124283
11-6432013-G-A p.Pro189Ser missense APBB1 1 80794 1.23772E-5 40397 0 NA
11-6432022-C-T p.Val186Met missense APBB1 1 80770 1.23808E-5 40385 0 4.02126E-6
11-6432043-G-C p.Leu179Val missense APBB1 1 80614 1.24048E-5 40307 0 1.60324E-5
11-6432051-G-A p.Pro176Leu missense APBB1 4 80592 4.96327E-5 40296 0 1.68802E-5
11-6432052-G-A p.Pro176Ser missense APBB1 1 80562 1.24128E-5 40281 0 NA
11-6432054-G-A p.Ser175Phe missense APBB1 2 80540 2.48324E-5 40270 0 NA
11-6432059-T-G p.Leu173Phe missense APBB1 2 80524 2.48373E-5 40262 0 5.90458E-5
11-6432077-TTCA-T p.Asp166del disruptive_inframe_deletion APBB1 10 80436 1.24322E-4 40218 0 1.86163E-4
11-6432077-TTCATCA-T p.Asp165_Asp166del disruptive_inframe_deletion APBB1 1 80444 1.2431E-5 40222 0 NA
11-6432077-T-TTCA p.Asp166dup disruptive_inframe_insertion APBB1 1 80444 1.2431E-5 40222 0 4.01765E-6
11-6432089-ATCC-A p.Glu162del disruptive_inframe_deletion APBB1 41 78800 5.20305E-4 39400 0 0.0473313
11-6432089-A-C p.Asp163Glu missense APBB1 193 80414 0.00240008 40207 0 0.00247886
11-6432089-ATCCTCC-A p.Glu161_Glu162del disruptive_inframe_deletion APBB1 1 80420 1.24347E-5 40210 0 3.2256E-5
11-6432090-T-C p.Asp163Gly missense APBB1 1 80318 1.24505E-5 40159 0 NA
11-6432091-C-T p.Asp163Asn missense APBB1 3 80312 3.73543E-5 40156 0 1.60741E-4
11-6432095-C-T p.Glu161Glu synonymous APBB1 4 80430 4.97327E-5 40215 0 3.18492E-5
11-6432100-C-G p.Glu160Gln missense APBB1 3 80440 3.72949E-5 40220 0 2.50865E-5
11-6432107-G-A p.Ala157Ala synonymous APBB1 6 80282 7.47366E-5 40141 0 2.50371E-5
11-6432116-G-A p.Ala154Ala synonymous APBB1 5 80340 6.22355E-5 40170 0 1.24597E-4
11-6432128-C-A p.Glu150Asp missense APBB1 3 80692 3.71784E-5 40346 0 NA
11-6432147-T-G p.Gln144Pro missense APBB1 1 80832 1.23713E-5 40416 0 3.3024E-5
11-6432147-T-A p.Gln144Leu missense APBB1 2 80832 2.47427E-5 40416 0 NA
11-6432157-T-C p.Thr141Ala missense APBB1 1 80870 1.23655E-5 40435 0 NA
11-6432164-G-A p.Ile138Ile synonymous APBB1 1 80884 1.23634E-5 40442 0 NA
11-6432180-C-T p.Arg133Gln missense APBB1 3 80916 3.70755E-5 40458 0 1.64889E-5
11-6432185-G-C p.Gly131Gly synonymous APBB1 1 80916 1.23585E-5 40458 0 NA
11-6432186-C-T p.Gly131Asp missense APBB1 9 80918 1.11224E-4 40459 0 5.03525E-4
11-6432187-C-T p.Gly131Ser missense APBB1 3 80926 3.70709E-5 40463 0 2.30814E-4
11-6432189-C-T p.Arg130Gln missense APBB1 5 80930 6.17818E-5 40465 0 3.29739E-5
11-6432192-T-G p.Asn129Thr missense APBB1 9 80942 1.11191E-4 40471 0 2.7839E-5
11-6432192-T-C p.Asn129Ser missense APBB1 2 80942 2.47091E-5 40471 0 NA
11-6432198-G-A p.Ala127Val missense APBB1 1 80952 1.2353E-5 40476 0 NA
11-6432199-C-T p.Ala127Thr missense APBB1 2 80940 2.47097E-5 40470 0 9.55353E-5
11-6432200-G-A p.Asn126Asn synonymous APBB1 368 80930 0.00454714 40465 2 0.00942915
11-6432227-G-A p.Tyr117Tyr synonymous APBB1 1 80982 1.23484E-5 40491 0 NA
11-6432229-A-T p.Tyr117Asn missense APBB1 35 80960 4.32312E-4 40480 0 7.41815E-4
11-6432231-A-G p.Leu116Pro missense APBB1 1 80974 1.23496E-5 40487 0 3.97741E-6
11-6432233-G-A p.His115His synonymous APBB1 2 80954 2.47054E-5 40477 0 5.03525E-4
11-6432239-C-T p.Leu113Leu synonymous APBB1 2 80986 2.46956E-5 40493 0 NA
11-6432243-C-A p.Gly112Val missense APBB1 1 80978 1.2349E-5 40489 0 NA
11-6432246-T-C p.Lys111Arg missense APBB1 3 80970 3.70508E-5 40485 0 1.591E-5
11-6432259-G-A p.Pro107Ser missense APBB1 2 80968 2.47011E-5 40484 0 6.37349E-5
11-6432259-G-T p.Pro107Thr missense APBB1 3 80968 3.70517E-5 40484 0 8.24633E-6
11-6432272-C-T p.Glu102Glu synonymous APBB1 1 80966 1.23509E-5 40483 0 NA
11-6432279-C-T p.Ser100Asn missense APBB1 1 80936 1.23554E-5 40468 0 3.98064E-6
11-6432289-C-T p.Glu97Lys missense APBB1 2 80896 2.47231E-5 40448 0 NA
11-6432291-G-A p.Ala96Val missense APBB1 1 80874 1.23649E-5 40437 0 7.43249E-5
11-6432296-G-A p.Thr94Thr synonymous APBB1 1 80866 1.23661E-5 40433 0 NA
11-6432324-C-T p.Arg85His missense APBB1 1 80536 1.24168E-5 40268 0 6.37267E-5
11-6432325-G-A p.Arg85Cys missense APBB1 3 80558 3.72403E-5 40279 0 2.48814E-5
11-6432325-G-T p.Arg85Ser missense APBB1 1 80558 1.24134E-5 40279 0 NA
11-6432331-C-T p.Ala83Thr missense APBB1 5 80348 6.22293E-5 40174 0 2.8292E-5
11-6432338-G-A p.Ala80Ala synonymous APBB1 3 80270 3.73739E-5 40135 0 3.18796E-5
11-6432346-G-A p.Arg78Trp missense APBB1 4 80470 4.9708E-5 40235 0 8.05815E-6
11-6432350-C-T p.Gln76Gln synonymous APBB1 2 80558 2.48268E-5 40279 0 NA
11-6432378-G-T p.Ala67Asp missense APBB1 1 80484 1.24248E-5 40242 0 8.35925E-6
11-6432394-G-A p.Pro62Ser missense APBB1 2 80372 2.48843E-5 40186 0 NA
11-6432401-C-A p.Gly59Gly synonymous APBB1 1 80344 1.24465E-5 40172 0 NA
11-6432405-C-A p.Gly58Val missense APBB1 1 80358 1.24443E-5 40179 0 NA
11-6432408-C-A p.Gly57Val missense APBB1 1 80392 1.2439E-5 40196 0 3.18512E-5
11-6432417-A-G p.Met54Thr missense APBB1 1 80428 1.24335E-5 40214 0 NA
11-6432421-C-T p.Ala53Thr missense APBB1 12 80404 1.49246E-4 40202 0 8.4168E-5
11-6432423-C-T p.Ser52Asn missense APBB1 9 80386 1.1196E-4 40193 0 1.0564E-4
11-6432427-G-A p.Arg51Cys missense APBB1 428 80310 0.00532935 40155 5 0.00832603
11-6432435-T-G p.Lys48Thr missense APBB1 1 80368 1.24428E-5 40184 0 NA
11-6432450-G-A p.Thr43Ile missense APBB1 2 80324 2.48992E-5 40162 0 4.05173E-6
11-6432458-C-T p.Leu40Leu synonymous APBB1 1 80318 1.24505E-5 40159 0 NA
11-6432459-A-G p.Leu40Pro missense APBB1 1 80320 1.24502E-5 40160 0 NA
11-6432464-G-A p.Ala38Ala synonymous APBB1 1 80296 1.24539E-5 40148 0 NA
11-6432466-C-T p.Ala38Thr missense APBB1 3 80262 3.73776E-5 40131 0 4.05614E-6
11-6432467-G-A p.Asn37Asn synonymous APBB1 4 80264 4.98355E-5 40132 0 8.46926E-6
11-6432477-T-C p.Gln34Arg missense APBB1 2 80318 2.4901E-5 40159 0 8.09723E-6
11-6432479-G-C p.Asn33Lys missense APBB1 1 80312 1.24514E-5 40156 0 NA
11-6432490-C-T p.Ala30Thr missense APBB1 7 80240 8.72383E-5 40120 0 2.57945E-5
11-6432513-A-T p.Leu22Gln missense APBB1 1 80060 1.24906E-5 40030 0 NA
11-6432515-T-C p.Ala21Ala synonymous APBB1 1 80046 1.24928E-5 40023 0 NA
11-6432517-C-T p.Ala21Thr missense APBB1 1 79980 1.25031E-5 39990 0 3.61726E-5
11-6432517-C-G p.Ala21Pro missense APBB1 1 79980 1.25031E-5 39990 0 NA
11-6432518-G-A p.Pro20Pro synonymous APBB1 5 79982 6.25141E-5 39991 0 1.27535E-4
11-6432526-C-T p.Gly18Arg missense APBB1 2 79884 2.50363E-5 39942 0 3.18817E-5
11-6432527-G-A p.His17His synonymous APBB1 2 79868 2.50413E-5 39934 0 2.69363E-5
11-6432529-G-C p.His17Asp missense APBB1 1 79866 1.2521E-5 39933 0 3.18695E-5
11-6432533-G-A p.Asn15Asn synonymous APBB1 1 79806 1.25304E-5 39903 0 NA
11-6432534-T-C p.Asn15Ser missense APBB1 2 79794 2.50645E-5 39897 0 3.18735E-5
11-6432536-G-A p.Ala14Ala synonymous APBB1 1 79774 1.25354E-5 39887 0 4.88267E-6
11-6432548-C-T p.Ser10Ser synonymous APBB1 6 79412 7.55553E-5 39706 0 4.55606E-5
11-6432549-G-T p.Ser10* stop_gained APBB1 1 79394 1.25954E-5 39697 0 NA
11-6432555-C-T p.Ser8Asn missense APBB1 1 79180 1.26295E-5 39590 0 NA
11-6432566-T-C p.Pro4Pro synonymous APBB1 2 78862 2.53608E-5 39431 0 1.55133E-5
11-6432571-C-T p.Val3Ile missense APBB1 1 78612 1.27207E-5 39306 0 1.0128E-4
11-6432594-G-GAGCAGGGCT c.-14-4_-14-3insAGCCCTGCT splice_region APBB1 1 76614 1.30524E-5 38307 0 NA