Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
4-80827328-T-TA c.*642-3dupT splice_region ANTXR2 1 43606 2.29326E-5 21803 0 NA
4-80828506-A-AT c.*76dupA splice_region ANTXR2 1 80362 1.24437E-5 40181 0 NA
4-80828554-C-T c.*641+5G>A splice_region ANTXR2 2 81918 2.44147E-5 40959 0 4.97323E-5
4-80828555-G-A c.*641+4C>T splice_region ANTXR2 8699 81654 0.106535 40827 765 0.132989
4-80828558-C-G c.*641+1G>C splice_donor ANTXR2 1 81988 1.21969E-5 40994 0 4.05824E-6
4-80828589-A-G p.Ser487Ser synonymous ANTXR2 1 82088 1.2182E-5 41044 0 4.04446E-6
4-80828591-A-C p.Ser487Ala missense ANTXR2 10 82102 1.218E-4 41051 0 3.18492E-4
4-80828599-C-T p.Arg484Gln missense ANTXR2 2 82086 2.43647E-5 41043 0 9.55962E-5
4-80828600-G-A p.Arg484* stop_gained ANTXR2 2 82106 2.43588E-5 41053 0 NA
4-80828617-C-T p.Arg478Gln missense ANTXR2 4 82022 4.87674E-5 41011 0 6.37105E-5
4-80828618-G-A p.Arg478Trp missense ANTXR2 1 82016 1.21927E-5 41008 0 6.63251E-5
4-80828627-GA-G c.1429-7delT splice_region ANTXR2 1 81940 1.22041E-5 40970 0 NA
4-80898735-A-C p.Ter490Glyext*? stop_lost ANTXR2 2 82438 2.42607E-5 41219 0 NA
4-80898737-G-A p.Ala489Val missense ANTXR2 7 82454 8.48958E-5 41227 0 0.00151976
4-80898741-T-G p.Thr488Pro missense ANTXR2 11 82484 1.33359E-4 41242 0 3.18532E-4
4-80898755-A-G p.Ile483Thr missense ANTXR2 3 82526 3.63522E-5 41263 0 3.90016E-5
4-80898761-T-A p.Glu481Val missense ANTXR2 1 82560 1.21124E-5 41280 0 NA
4-80898764-C-A p.Trp480Leu missense ANTXR2 1 82562 1.21121E-5 41281 0 5.53716E-6
4-80898801-A-G p.Leu468Leu synonymous ANTXR2 2 82662 2.41949E-5 41331 0 NA
4-80898807-C-A p.Val466Phe missense ANTXR2 1 82666 1.20969E-5 41333 0 4.95869E-6
4-80898808-C-T p.Arg465Arg synonymous ANTXR2 6855 82562 0.0830285 41281 310 0.109306
4-80898809-C-T p.Arg465Gln missense ANTXR2 3 82668 3.62897E-5 41334 0 9.92625E-6
4-80898810-G-A p.Arg465Trp missense ANTXR2 1 82674 1.20957E-5 41337 0 5.79072E-5
4-80898811-G-T p.Asp464Glu missense ANTXR2 7 82676 8.46679E-5 41338 0 0.00125
4-80898821-C-T p.Arg461Gln missense ANTXR2 2 82664 2.41943E-5 41332 0 1.59256E-4
4-80898822-G-A p.Arg461Trp missense ANTXR2 2 82658 2.41961E-5 41329 0 8.63111E-5
4-80898842-G-A p.Ala454Val missense ANTXR2 1 82636 1.21013E-5 41318 0 3.13051E-5
4-80898843-C-T p.Ala454Thr missense ANTXR2 70 82636 8.47088E-4 41318 0 0.0020141
4-80898848-A-G p.Leu452Pro missense ANTXR2 4 82636 4.84051E-5 41318 0 7.00503E-4
4-80898851-C-T p.Arg451His missense ANTXR2 4 82612 4.84191E-5 41306 0 1.21551E-4
4-80898851-C-G p.Arg451Pro missense ANTXR2 1 82612 1.21048E-5 41306 0 5.04032E-4
4-80898854-C-T p.Gly450Asp missense+splice_region ANTXR2 1 82582 1.21092E-5 41291 0 6.17742E-5
4-80898856-C-CT c.1348-2_1348-1insA splice_acceptor ANTXR2 6 82588 7.26498E-5 41294 2 NA
4-80899162-T-C p.Lys449Arg missense+splice_region ANTXR2 1 82816 1.2075E-5 41408 0 NA
4-80899166-T-C p.Ile448Val missense ANTXR2 1 82826 1.20735E-5 41413 0 NA
4-80899172-T-A p.Thr446Ser missense ANTXR2 2 82832 2.41453E-5 41416 0 8.92288E-4
4-80899185-C-T p.Gln441Gln synonymous ANTXR2 1 82850 1.207E-5 41425 0 NA
4-80899197-G-A p.His437His synonymous ANTXR2 1 82860 1.20685E-5 41430 0 4.08493E-6
4-80899200-T-G p.Thr436Thr synonymous ANTXR2 1 82864 1.2068E-5 41432 0 6.37146E-5
4-80899213-C-G p.Arg432Pro missense ANTXR2 1 82872 1.20668E-5 41436 0 NA
4-80899216-G-A p.Pro431Leu missense ANTXR2 2 82876 2.41324E-5 41438 0 4.0294E-6
4-80899264-A-G p.Val415Ala missense ANTXR2 1 82886 1.20648E-5 41443 0 8.285E-6
4-80899268-C-CTACTTGAAAG p.Ala414fs frameshift ANTXR2 1 82878 1.20659E-5 41439 0 NA
4-80899276-G-C p.Ala411Gly missense ANTXR2 2 82864 2.41359E-5 41432 1 NA
4-80899290-T-C p.Ala406Ala synonymous ANTXR2 1 82834 1.20723E-5 41417 0 4.01278E-6
4-80899303-G-A p.Thr402Ile missense ANTXR2 1 82814 1.20753E-5 41407 0 NA
4-80899311-T-C p.Lys399Lys synonymous ANTXR2 1 82796 1.20779E-5 41398 0 1.20524E-5
4-80899324-C-T p.Arg395His missense ANTXR2 3 82762 3.62485E-5 41381 0 6.37674E-5
4-80899325-G-A p.Arg395Cys missense ANTXR2 2 82760 2.41663E-5 41380 0 8.31642E-6
4-80899329-C-CTCCATTCT c.1180-2_1180-1insAGAATGGA splice_acceptor ANTXR2 2 82756 2.41674E-5 41378 1 NA
4-80899331-G-T c.1180-3C>A splice_region ANTXR2 1 82720 1.2089E-5 41360 0 NA
4-80899332-TA-T c.1180-5delT splice_region ANTXR2 2 82710 2.41809E-5 41355 0 NA
4-80899335-A-T c.1180-7T>A splice_region ANTXR2 4 82710 4.83617E-5 41355 0 1.66792E-5
4-80905025-T-A c.1179+7A>T splice_region ANTXR2 1 81768 1.22297E-5 40884 0 NA
4-80905029-A-G c.1179+3T>C splice_region ANTXR2 7 81884 8.54868E-5 40942 1 6.8717E-4
4-80905038-T-C p.Arg391Arg synonymous ANTXR2 1 82010 1.21936E-5 41005 0 NA
4-80905052-C-T p.Gly387Arg missense ANTXR2 1 82110 1.21788E-5 41055 0 NA
4-80905082-C-T p.Asp377Asn missense ANTXR2 2 82116 2.43558E-5 41058 0 NA
4-80905094-A-G p.Trp373Arg missense ANTXR2 1 82024 1.21916E-5 41012 0 NA
4-80905095-C-T p.Lys372Lys synonymous ANTXR2 1 82034 1.21901E-5 41017 0 NA
4-80905112-G-T p.Pro367Thr missense ANTXR2 8 81944 9.76276E-5 40972 0 1.276E-4
4-80905112-G-A p.Pro367Ser missense ANTXR2 1 81944 1.22035E-5 40972 0 NA
4-80905121-C-T p.Glu364Lys missense ANTXR2 3 81854 3.66506E-5 40927 0 4.39789E-6
4-80905129-G-T c.1087-5C>A splice_region ANTXR2 1 81594 1.22558E-5 40797 0 3.19081E-5
4-80905966-C-T c.1086+7G>A splice_region ANTXR2 2 81754 2.44636E-5 40877 0 NA
4-80905972-C-T c.1086+1G>A splice_donor ANTXR2 1 81740 1.22339E-5 40870 0 NA
4-80905973-C-T p.Glu362Glu splice_region+synonymous ANTXR2 1 81758 1.22312E-5 40879 0 1.09232E-5
4-80905977-T-C p.Lys361Arg missense ANTXR2 1 81756 1.22315E-5 40878 0 NA
4-80905983-G-A p.Ala359Val missense ANTXR2 1 81796 1.22255E-5 40898 0 NA
4-80905984-CA-C p.Ala359fs frameshift ANTXR2 3 81770 3.66883E-5 40885 0 4.12446E-5
4-80905984-C-CA p.Ala359fs frameshift ANTXR2 1 81770 1.22294E-5 40885 0 3.24359E-5
4-80905985-A-AG p.Ala359fs frameshift ANTXR2 21 81674 2.5712E-4 40837 1 0.00262354
4-80905985-A-AGG p.Ala359fs frameshift ANTXR2 3 81734 3.67044E-5 40867 0 2.15045E-5
4-80905985-A-C p.Pro358Pro synonymous ANTXR2 3 81734 3.67044E-5 40867 0 1.66199E-5
4-80905987-G-T p.Pro358Thr missense ANTXR2 1 81788 1.22267E-5 40894 0 6.44081E-5
4-80905987-G-C p.Pro358Ala missense ANTXR2 1 81788 1.22267E-5 40894 0 3.2204E-5
4-80905988-G-C p.Ala357Ala synonymous ANTXR2 2 81798 2.44505E-5 40899 0 8.26371E-6
4-80905988-GGC-TGG p.Ala357Pro missense ANTXR2 1 81798 1.22252E-5 40899 0 NA
4-80905989-G-C p.Ala357Gly missense ANTXR2 31 81780 3.79066E-4 40890 0 4.01808E-4
4-80905989-GC-CG p.Ala357Arg missense ANTXR2 5 81782 6.11381E-5 40891 0 NA
4-80905989-G-T p.Ala357Asp missense ANTXR2 7 81782 8.55934E-5 40891 0 1.13009E-4
4-80905990-C-G p.Ala357Pro missense ANTXR2 57624 79266 0.72697 39633 22028 0.770338
4-80905990-CG-GT p.ProAla356ProPro missense ANTXR2 1496 81636 0.0183252 40818 154 NA
4-80905990-C-T p.Ala357Thr missense ANTXR2 34 81692 4.16197E-4 40846 0 3.62201E-5
4-80905990-CG-GC p.ProAla356ProPro missense ANTXR2 3 81692 3.67233E-5 40846 0 NA
4-80905990-C-A p.Ala357Ser missense ANTXR2 1 81692 1.22411E-5 40846 0 3.01127E-5
4-80905990-CG-GA p.ProAla356ProPro missense ANTXR2 2 81692 2.44822E-5 40846 0 NA
4-80905991-G-T p.Pro356Pro synonymous ANTXR2 5276 81570 0.0646806 40785 143 0.0876644
4-80905991-G-C p.Pro356Pro synonymous ANTXR2 29 81772 3.54645E-4 40886 0 0.00148607
4-80905991-G-A p.Pro356Pro synonymous ANTXR2 3 81776 3.66856E-5 40888 0 6.85871E-4
4-80905992-G-T p.Pro356His missense ANTXR2 1 81786 1.2227E-5 40893 0 2.14009E-5
4-80905993-G-T p.Pro356Thr missense ANTXR2 2 81766 2.446E-5 40883 0 4.13935E-6
4-80906022-CA-C c.1042-6delT splice_region ANTXR2 1 81402 1.22847E-5 40701 0 4.31419E-5
4-80929713-C-T p.Gly335Ser missense ANTXR2 3 82102 3.65399E-5 41051 0 3.18715E-5
4-80929714-G-A p.Ile334Ile synonymous ANTXR2 4 82084 4.87306E-5 41042 0 3.18898E-5
4-80929746-CAAT-C p.Ile323del conservative_inframe_deletion ANTXR2 1 82056 1.21868E-5 41028 0 4.15334E-6
4-80929758-C-T p.Ala320Thr missense ANTXR2 3 81868 3.66444E-5 40934 0 3.18857E-5
4-80929759-G-A p.Ile319Ile synonymous ANTXR2 4 81892 4.88448E-5 40946 0 4.36552E-5
4-80929764-C-T p.Gly318Arg missense ANTXR2 2 81740 2.44678E-5 40870 0 6.37511E-5
4-80929765-G-A p.Asn317Asn synonymous ANTXR2 1 81746 1.2233E-5 40873 0 3.52361E-5
4-80929770-A-AACATTCTGTGGCTGTGACAATTAATGATCCTGAAATGACAGATTTTCCTC c.946-1_946insGAGGAAAATCTGTCATTTCAGGATCATTAATTGTCACAGCCACAGAATGT splice_acceptor ANTXR2 2 81670 2.44888E-5 40835 1 NA
4-80929770-A-AACATTCTGTGGCTGTGACAATTAATGATCCTGAAATGACAGATTTTC c.946-1_946insGAAAATCTGTCATTTCAGGATCATTAATTGTCACAGCCACAGAATGT splice_acceptor ANTXR2 4 81666 4.898E-5 40833 2 NA
4-80940045-T-C c.945+7A>G splice_region ANTXR2 40 81010 4.93766E-4 40505 0 7.49295E-4
4-80940067-G-A p.Val310Val synonymous ANTXR2 1 81392 1.22862E-5 40696 0 3.18492E-5
4-80940081-C-G p.Gly306Arg missense ANTXR2 52 81404 6.38789E-4 40702 0 0.00200688
4-80940099-C-T p.Gly300Arg missense ANTXR2 12 81328 1.47551E-4 40664 0 1.59246E-4
4-80940130-T-TTCTCCAGCTTTATTCAGGATAGGTGCAGGACAAAGCATAGAATTAAG c.867-1_867insCTTAATTCTATGCTTTGTCCTGCACCTATCCTGAATAAAGCTGGAGA splice_acceptor ANTXR2 2 80458 2.48577E-5 40229 1 NA
4-80940134-AAAAAG-A c.867-9_867-5delCTTTT splice_region ANTXR2 4 80294 4.98169E-5 40147 0 2.09004E-5
4-80945813-GGC-AGA p.Ala321Ser missense ANTXR2 7 19964 3.50631E-4 9982 0 NA
4-80945813-G-A p.Ala321Ala synonymous ANTXR2 1 19964 5.00902E-5 9982 0 7.48503E-4
4-80945815-C-A p.Ala321Ser missense ANTXR2 2070 19812 0.104482 9906 89 0.17504
4-80945824-G-A p.Pro318Ser missense ANTXR2 1 22270 4.49035E-5 11135 0 7.98365E-6
4-80945832-C-T p.Gly315Asp missense ANTXR2 2 23938 8.35492E-5 11969 0 NA
4-80945842-A-G p.Ser312Pro missense ANTXR2 3 26874 1.11632E-4 13437 0 2.22987E-4
4-80945866-G-A p.Leu304Leu synonymous ANTXR2 4 33162 1.2062E-4 16581 0 9.55536E-5
4-80945889-T-C p.Gln296Arg missense ANTXR2 2 38526 5.1913E-5 19263 0 NA
4-80945899-T-C p.Thr293Ala missense ANTXR2 1 40114 2.4929E-5 20057 0 6.25782E-4
4-80945904-C-T p.Gly291Asp missense ANTXR2 5 40824 1.22477E-4 20412 1 1.79151E-4
4-80945909-C-T p.Glu289Glu splice_region+synonymous ANTXR2 1 41678 2.39935E-5 20839 0 NA
4-80952787-T-C p.Lys286Glu missense ANTXR2 1 79766 1.25367E-5 39883 0 1.276E-4
4-80952819-T-C p.Asn275Ser missense ANTXR2 4 79836 5.01027E-5 39918 0 0.00151515
4-80952826-G-T p.Gln273Lys missense ANTXR2 1 79406 1.25935E-5 39703 0 NA
4-80952835-C-T p.Val270Ile missense ANTXR2 239 78770 0.00303415 39385 0 0.00707071
4-80952845-A-G p.Ser266Ser splice_region+synonymous ANTXR2 14 78370 1.7864E-4 39185 0 0.00353535
4-80952846-C-CTCGTTGTATATGTTTCATTTACAGTGTAAGTGCAGAGAACACTGCCATT c.797-1_797insAATGGCAGTGTTCTCTGCACTTACACTGTAAATGAAACATATACAACGA splice_acceptor ANTXR2 2 78282 2.55487E-5 39141 1 NA
4-80952846-C-CTCGTTGTATATGTTTCATTTACAGTGTAAGTGCAGAGAACACTGCCATTCCGA c.797-1_797insTCGGAATGGCAGTGTTCTCTGCACTTACACTGTAAATGAAACATATACAACGA splice_acceptor ANTXR2 4 78282 5.10973E-5 39141 2 NA
4-80952846-C-CTCGTTGTATATGTTTCATTTACAGTGTAAGTGCAGAGAACACTG c.797-1_797insCAGTGTTCTCTGCACTTACACTGTAAATGAAACATATACAACGA splice_acceptor ANTXR2 2 78282 2.55487E-5 39141 1 NA
4-80954621-C-A c.796+5G>T splice_region ANTXR2 1 80538 1.24165E-5 40269 0 NA
4-80954627-C-T p.Thr265Thr splice_region+synonymous ANTXR2 1 80716 1.23891E-5 40358 0 3.18939E-5
4-80954630-T-C p.Thr264Thr synonymous ANTXR2 1 80848 1.23689E-5 40424 0 NA
4-80954636-T-G p.Thr262Thr synonymous ANTXR2 1 81002 1.23454E-5 40501 0 4.24193E-6
4-80954650-T-C p.Thr258Ala missense ANTXR2 2 81172 2.4639E-5 40586 0 3.18837E-5
4-80954651-G-A p.Tyr257Tyr synonymous ANTXR2 64 81172 7.88449E-4 40586 0 0.0015622
4-80954668-TGC-AGT p.GlySer251AspCys missense ANTXR2 2 81304 2.4599E-5 40652 0 NA
4-80954676-C-T p.Arg249Gln missense ANTXR2 4 81266 4.92211E-5 40633 0 4.73232E-5
4-80954677-G-A p.Arg249Trp missense ANTXR2 2 81242 2.46178E-5 40621 0 0.00125
4-80954700-C-T p.Gly241Glu missense ANTXR2 1 81288 1.23019E-5 40644 0 NA
4-80954704-T-C p.Ser240Gly missense ANTXR2 3 81244 3.69258E-5 40622 0 NA
4-80954710-C-T p.Val238Ile missense ANTXR2 1 81172 1.23195E-5 40586 0 1.80445E-5
4-80954724-T-TCCCCCACACAGACA c.698-1_698insTGTCTGTGTGGGGG splice_acceptor ANTXR2 4 80932 4.94242E-5 40466 2 NA
4-80954727-A-G c.698-3T>C splice_region ANTXR2 2 80860 2.47341E-5 40430 0 NA
4-80957125-C-T c.697+1G>A splice_donor ANTXR2 1 81352 1.22923E-5 40676 0 4.06174E-5
4-80957130-C-A p.Val231Val synonymous ANTXR2 1 81452 1.22772E-5 40726 0 3.20492E-5
4-80957139-A-G p.Ser228Ser synonymous ANTXR2 1 81492 1.22711E-5 40746 0 3.96448E-5
4-80957149-T-A p.Gln225Leu missense ANTXR2 1 81524 1.22663E-5 40762 0 NA
4-80957180-C-T p.Ala215Thr missense ANTXR2 4 81304 4.91981E-5 40652 0 6.52784E-5
4-80957183-G-T p.Leu214Ile missense ANTXR2 2 81068 2.46706E-5 40534 0 1.7804E-5
4-80957186-T-TAGAATTAATTATTCCTTTAAGAGCCTGAAATCCACCTTTGA c.637-1_637insTCAAAGGTGGATTTCAGGCTCTTAAAGGAATAATTAATTCT splice_acceptor ANTXR2 1 81124 1.23268E-5 40562 0 NA
4-80975429-A-ATAG p.Asn211_Ser212insTyr disruptive_inframe_insertion ANTXR2 1 80838 1.23704E-5 40419 0 NA
4-80975437-T-C p.Ile209Val missense ANTXR2 4 81010 4.93766E-5 40505 0 6.667E-5
4-80975440-C-T p.Gly208Arg missense ANTXR2 1 81042 1.23393E-5 40521 0 NA
4-80975465-G-A p.Val199Val synonymous ANTXR2 2 81200 2.46305E-5 40600 0 8.52878E-6
4-80975473-A-G p.Phe197Leu missense ANTXR2 6 81180 7.39098E-5 40590 0 NA
4-80975506-G-A p.Leu186Phe missense+splice_region ANTXR2 4 80744 4.95393E-5 40372 0 8.92777E-6
4-80975508-T-TGTGC c.556-3_556-2insGCAC splice_region ANTXR2 4 80684 4.95761E-5 40342 2 NA
4-80975508-T-TG c.556-3_556-2insC splice_region ANTXR2 2 80684 2.47881E-5 40342 1 NA
4-80975511-A-T c.556-5T>A splice_region ANTXR2 2 80606 2.4812E-5 40303 0 4.44808E-6
4-80976313-T-C p.Glu182Glu synonymous ANTXR2 1 81506 1.2269E-5 40753 0 5.68738E-6
4-80976362-G-T p.Ser166Tyr missense ANTXR2 4 81640 4.89956E-5 40820 0 NA
4-80976366-T-A p.Ile165Leu missense ANTXR2 1 81640 1.22489E-5 40820 0 NA
4-80976369-T-C p.Lys164Glu missense ANTXR2 2 81620 2.45038E-5 40810 0 NA
4-80976371-GCCTATGGAGAATGAGGAGGGAAAGAGAGAAAAAAAGAGAGGGGAGAGGGAGAAAGTGAATTATTCAAATATCAAGCTATACATTCCGAGACACACAGCGATGTACAGTGGGGTGTAGAGAACAGTCTCAGTTCAATACTCA-G p.Ala163fs frameshift ANTXR2 8 81620 9.80152E-5 40810 4 NA
4-80976371-G-A p.Ala163Val missense+splice_region ANTXR2 1 81620 1.22519E-5 40810 0 NA
4-80976517-T-C p.Lys161Lys synonymous ANTXR2 1 81146 1.23235E-5 40573 0 4.07445E-6
4-80976543-C-T p.Gly153Ser missense ANTXR2 1 81008 1.23445E-5 40504 0 9.06569E-6
4-80976544-G-A p.Asp152Asp synonymous ANTXR2 7 81022 8.63963E-5 40511 0 0.00302115
4-80976593-C-A p.Gly136Val missense ANTXR2 1 81254 1.23071E-5 40627 0 NA
4-80976610-T-C p.Gln130Gln synonymous ANTXR2 1 81222 1.23119E-5 40611 0 3.18898E-5
4-80976619-C-T p.Ala127Ala splice_region+synonymous ANTXR2 1 81122 1.23271E-5 40561 0 3.19183E-5
4-80977078-T-G c.378+8A>C splice_region ANTXR2 46717 77858 0.600028 38929 14250 0.702314
4-80977078-TAA-GAT c.378+6_378+8delTTAinsATC splice_region ANTXR2 1 79630 1.25581E-5 39815 0 NA
4-80977080-A-T c.378+6T>A splice_region ANTXR2 6 79750 7.52351E-5 39875 0 3.34327E-5
4-80977094-G-A p.Leu124Leu synonymous ANTXR2 2 80108 2.49663E-5 40054 0 1.17855E-5
4-80977097-C-T p.Gly123Arg missense ANTXR2 1 80124 1.24807E-5 40062 0 5.7499E-6
4-80977101-A-G p.His121His synonymous ANTXR2 1 80198 1.24691E-5 40099 0 2.71887E-5
4-80977110-T-TA p.Tyr119fs frameshift ANTXR2 1 80276 1.2457E-5 40138 0 NA
4-80977121-C-T p.Val115Ile missense ANTXR2 1 80270 1.2458E-5 40135 0 NA
4-80977127-TA-T p.Ser113fs frameshift ANTXR2 1 80214 1.24667E-5 40107 0 NA
4-80977132-C-T p.Arg111His missense ANTXR2 4 80100 4.99376E-5 40050 0 5.24907E-5
4-80977133-G-A p.Arg111Cys missense ANTXR2 444 80084 0.00554418 40042 7 0.0104034
4-80977135-T-C p.Lys110Arg missense ANTXR2 138 80164 0.00172147 40082 1 0.00449847
4-80977140-A-G p.Asp108Asp synonymous ANTXR2 46 80130 5.74067E-4 40065 0 0.00121204
4-80977142-C-T p.Asp108Asn missense ANTXR2 1 80078 1.24878E-5 40039 0 NA
4-80977155-A-G p.Ser103Ser synonymous ANTXR2 2 79852 2.50463E-5 39926 0 NA
4-80977165-C-T p.Gly100Asp missense+splice_region ANTXR2 1 79486 1.25808E-5 39743 0 2.93186E-5
4-80990599-G-A p.Thr96Ile missense ANTXR2 2 80792 2.47549E-5 40396 0 3.04414E-5
4-80990622-T-C p.Gln88Gln synonymous ANTXR2 1 81236 1.23098E-5 40618 0 1.3988E-5
4-80990653-A-G p.Met1? start_lost ANTXR2 1 81122 1.23271E-5 40561 0 NA
4-80990665-C-T c.225-4G>A splice_region ANTXR2 1746 80712 0.0216325 40356 26 0.0375469
4-80990669-A-G c.225-8T>C splice_region ANTXR2 4 80818 4.94939E-5 40409 0 4.57076E-6
4-80992750-C-G p.Glu71Gln missense ANTXR2 2 82024 2.43831E-5 41012 0 1.66781E-5
4-80992750-C-T p.Glu71Lys missense ANTXR2 1 82024 1.21916E-5 41012 0 NA
4-80992752-G-A p.Ala70Val missense ANTXR2 17 82030 2.07241E-4 41015 0 4.42087E-5
4-80992765-C-T p.Val66Ile missense ANTXR2 1 82040 1.21892E-5 41020 0 3.18573E-5
4-80992766-G-A c.-37C>T 5_prime_UTR_premature_start_codon_gain ANTXR2 57 82096 6.94309E-4 41048 0 3.3355E-4
4-80992802-C-T p.Gly53Gly synonymous ANTXR2 1 81982 1.21978E-5 40991 0 NA
4-80992809-C-CCGTA c.153-2_153-1insTACG splice_acceptor ANTXR2 2 81882 2.44254E-5 40941 0 NA
4-80992810-T-TGTCCAGGAC c.153-3_153-2insGTCCTGGAC splice_region ANTXR2 1 81806 1.2224E-5 40903 0 NA
4-80992811-G-GTCCTGCAGGCCTGGCCTATTTTAGCAGCTGTGCT c.153-4_153-3insAGCACAGCTGCTAAAATAGGCCAGGCCTGCAGGA splice_region ANTXR2 2 81802 2.44493E-5 40901 0 NA
4-80993556-C-T c.152+7G>A splice_region ANTXR2 1 79178 1.26298E-5 39589 0 NA
4-80993557-A-T c.152+6T>A splice_region ANTXR2 1 79184 1.26288E-5 39592 0 NA
4-80993574-G-A p.Phe47Phe synonymous ANTXR2 3 79266 3.78472E-5 39633 0 NA
4-80993579-A-G p.Tyr46His missense ANTXR2 3 79294 3.78339E-5 39647 0 8.43576E-6
4-80993583-A-C p.Asp44Glu missense ANTXR2 1 79308 1.26091E-5 39654 0 NA
4-80993590-G-T p.Ala42Asp missense ANTXR2 1 79264 1.26161E-5 39632 0 NA
4-80993604-G-C p.Pro37Pro synonymous ANTXR2 1 79174 1.26304E-5 39587 0 NA
4-80993613-C-T p.Gln34Gln synonymous ANTXR2 3 79072 3.79401E-5 39536 0 NA
4-80993618-C-T p.Ala33Thr missense ANTXR2 3 78948 3.79997E-5 39474 0 NA
4-80993618-C-A p.Ala33Ser missense ANTXR2 3 78948 3.79997E-5 39474 0 3.31698E-4
4-80993624-G-A p.Leu31Leu synonymous ANTXR2 1 78886 1.26765E-5 39443 0 NA
4-80993627-G-GC p.Leu30fs frameshift ANTXR2 1 78812 1.26884E-5 39406 0 3.58777E-5
4-80993627-G-GCCC p.Gly29dup conservative_inframe_insertion ANTXR2 1 78814 1.26881E-5 39407 0 8.96941E-6
4-80993628-C-A p.Gly29Gly synonymous ANTXR2 1 78816 1.26878E-5 39408 0 3.19509E-5
4-80993634-G-A p.Pro27Pro synonymous ANTXR2 2 78670 2.54227E-5 39335 0 1.25156E-5
4-80993636-G-C p.Pro27Ala missense ANTXR2 1 78594 1.27236E-5 39297 0 3.19387E-5
4-80993645-G-A p.Leu24Phe missense ANTXR2 2 78194 2.55774E-5 39097 0 NA
4-80993660-G-A p.Leu19Leu synonymous ANTXR2 1 77520 1.28999E-5 38760 0 3.19203E-5
4-80993663-C-T p.Gly18Arg missense ANTXR2 1 77284 1.29393E-5 38642 0 1.3125E-5
4-80993664-G-A p.Pro17Pro synonymous ANTXR2 1 77386 1.29222E-5 38693 0 NA
4-80993666-G-A p.Pro17Ser missense ANTXR2 4 77292 5.17518E-5 38646 0 2.40668E-4
4-80993676-G-A p.Ser13Ser synonymous ANTXR2 1 76408 1.30876E-5 38204 0 NA
4-80993681-C-T p.Gly12Arg missense ANTXR2 1 75834 1.31867E-5 37917 0 1.5298E-5
4-80993685-G-A p.Ser10Ser synonymous ANTXR2 1 75242 1.32904E-5 37621 0 3.19183E-5
4-80993689-C-T p.Arg9His missense ANTXR2 1 74638 1.3398E-5 37319 0 NA
4-80993695-G-T p.Pro7Gln missense ANTXR2 1 74218 1.34738E-5 37109 0 1.02292E-5
4-80993697-G-C p.Ser6Ser synonymous ANTXR2 2 73914 2.70585E-5 36957 0 3.19468E-5
4-80993706-C-G p.Ala3Ala synonymous ANTXR2 1 72302 1.38309E-5 36151 0 NA
4-80993706-C-T p.Ala3Ala synonymous ANTXR2 1 72302 1.38309E-5 36151 0 NA
4-80993711-C-T p.Val2Met missense ANTXR2 2 72010 2.77739E-5 36005 0 1.2176E-5
4-80993724-G-A c.-10C>T 5_prime_UTR_premature_start_codon_gain ANTXR2 18 68966 2.60998E-4 34483 0 6.5445E-4
4-80993854-G-A c.-140C>T 5_prime_UTR_premature_start_codon_gain ANTXR2 2 37870 5.28123E-5 18935 0 NA
4-80993919-C-A c.-205G>T 5_prime_UTR_premature_start_codon_gain ANTXR2 1 29446 3.39605E-5 14723 0 3.20061E-5
4-80994010-A-G c.-296T>C 5_prime_UTR_premature_start_codon_gain ANTXR2 3 21524 1.39379E-4 10762 0 3.18898E-5
4-80994022-G-A c.-308C>T 5_prime_UTR_premature_start_codon_gain ANTXR2 1 19894 5.02664E-5 9947 0 NA
4-80994029-G-A c.-315C>T 5_prime_UTR_premature_start_codon_gain ANTXR2 1 19002 5.2626E-5 9501 0 NA
4-80994169-G-A c.-455C>T 5_prime_UTR_premature_start_codon_gain ANTXR2 1 5312 1.88253E-4 2656 0 NA
4-80994304-T-A c.-590A>T 5_prime_UTR_premature_start_codon_gain ANTXR2 13 3050 0.0042623 1525 0 0.0136798