Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
2-220094490-C-T c.-163C>T 5_prime_UTR_premature_start_codon_gain ANKZF1 51 44162 0.00115484 22081 0 0.00207165
2-220094558-T-C c.-95T>C 5_prime_UTR_premature_start_codon_gain ANKZF1 1 40944 2.44236E-5 20472 0 9.56633E-5
2-220094612-C-T c.-41C>T 5_prime_UTR_premature_start_codon_gain ANKZF1 1 28364 3.5256E-5 14182 0 9.5584E-5
2-220094613-G-T c.-40G>T 5_prime_UTR_premature_start_codon_gain ANKZF1 1 27956 3.57705E-5 13978 0 NA
2-220094617-C-T c.-36C>T 5_prime_UTR_premature_start_codon_gain ANKZF1 1 27146 3.68378E-5 13573 0 3.18593E-5
2-220094623-G-GAGC c.-31+1_-31+2insAGC splice_donor ANKZF1 1 26342 3.79622E-5 13171 0 NA
2-220094702-G-A c.-31G>A splice_region ANKZF1 6 22806 2.63089E-4 11403 0 6.37267E-4
2-220094771-G-T c.-209G>T 5_prime_UTR_premature_start_codon_gain ANKZF1 1 40158 2.49016E-5 20079 0 NA
2-220094789-T-G c.-191T>G 5_prime_UTR_premature_start_codon_gain ANKZF1 628 46636 0.013466 23318 5 0.00978954
2-220094946-C-T c.-30-4C>T splice_region ANKZF1 2 81954 2.44039E-5 40977 0 4.07581E-6
2-220094982-G-T p.Met1? start_lost ANKZF1 1 82936 1.20575E-5 41468 0 NA
2-220094983-TCGC-T p.Pro3del conservative_inframe_deletion ANKZF1 1 82926 1.20589E-5 41463 0 NA
2-220094985-G-A p.Ser2Ser synonymous ANKZF1 24 82916 2.8945E-4 41458 0 0.0020141
2-220095011-C-T p.Pro11Leu missense ANKZF1 1 82996 1.20488E-5 41498 0 3.18431E-5
2-220095039-C-T p.Ser20Ser synonymous ANKZF1 1 82946 1.2056E-5 41473 0 NA
2-220095049-C-G p.Pro24Ala missense ANKZF1 12 82968 1.44634E-4 41484 0 0.00100705
2-220095050-C-A p.Pro24Gln missense ANKZF1 1 82956 1.20546E-5 41478 0 NA
2-220095052-G-A p.Val25Ile missense ANKZF1 6 82928 7.23519E-5 41464 0 5.03525E-4
2-220095053-T-A p.Val25Asp missense ANKZF1 1 82918 1.20601E-5 41459 0 NA
2-220095058-C-G p.Gln27Glu missense ANKZF1 44 82918 5.30645E-4 41459 0 0.00120996
2-220095062-G-T p.Gly28Val missense ANKZF1 1 82886 1.20648E-5 41443 0 NA
2-220095063-C-T p.Gly28Gly synonymous ANKZF1 1 82908 1.20616E-5 41454 0 8.04091E-6
2-220095072-G-C p.Leu31Leu splice_region+synonymous ANKZF1 1 82930 1.20584E-5 41465 0 3.1839E-5
2-220095102-C-T p.Ala41Ala synonymous ANKZF1 1 82840 1.20715E-5 41420 0 NA
2-220095103-C-G p.Arg42Gly missense ANKZF1 1 82846 1.20706E-5 41423 0 NA
2-220095104-G-C p.Arg42Pro missense ANKZF1 1 82880 1.20656E-5 41440 0 6.36902E-5
2-220095108-T-C p.Ala43Ala synonymous ANKZF1 1 82838 1.20718E-5 41419 0 NA
2-220095118-T-G p.Ser47Ala missense ANKZF1 1 82780 1.20802E-5 41390 0 1.6822E-5
2-220095122-G-A p.Cys48Tyr missense ANKZF1 1 82704 1.20913E-5 41352 0 4.07481E-6
2-220095130-A-G c.148+3A>G splice_region ANKZF1 1 82558 1.21127E-5 41279 0 1.63797E-5
2-220095130-ATCCTGGAAGGTT-A c.148+6_148+17delCTGGAAGGTTTC splice_region ANKZF1 2 82558 2.42254E-5 41279 0 8.43868E-6
2-220095133-C-G c.148+6C>G splice_region ANKZF1 1 82522 1.2118E-5 41261 0 NA
2-220095135-G-T c.148+8G>T splice_region ANKZF1 1 82490 1.21227E-5 41245 0 NA
2-220096635-TCTTCC-T c.149-11_149-7delCCCTT splice_region ANKZF1 2 83084 2.4072E-5 41542 0 6.36983E-5
2-220096653-C-T p.Gln33* stop_gained ANKZF1 2 83216 2.40338E-5 41608 0 1.0778E-4
2-220096653-CAG-C p.Glu55fs frameshift ANKZF1 1 83216 1.20169E-5 41608 0 8.29077E-6
2-220096660-G-A p.Arg35Lys missense ANKZF1 1 83244 1.20129E-5 41622 0 2.486E-5
2-220096674-A-C p.Glu58Ala missense ANKZF1 23 83250 2.76276E-4 41625 0 0.00120957
2-220096678-A-C p.Arg59Ser missense ANKZF1 675 83238 0.00810928 41619 7 0.011875
2-220096679-A-C p.Lys60Gln missense ANKZF1 2 83260 2.40211E-5 41630 0 4.00917E-6
2-220096681-G-A p.Ser42Asn missense ANKZF1 33 83258 3.96358E-4 41629 1 9.23861E-4
2-220096683-T-C p.Leu61Pro missense ANKZF1 1 83260 1.20106E-5 41630 0 1.60376E-5
2-220096719-TTTG-T p.Cys74del disruptive_inframe_deletion ANKZF1 1 83202 1.20189E-5 41601 0 4.02628E-6
2-220096734-A-C p.Asp78Ala missense ANKZF1 1 83162 1.20247E-5 41581 0 NA
2-220096744-C-T p.Phe81Phe synonymous ANKZF1 1 83146 1.2027E-5 41573 0 4.11063E-6
2-220096744-C-A p.Phe81Leu missense ANKZF1 1 83146 1.2027E-5 41573 0 NA
2-220096745-C-T p.Gln82* stop_gained ANKZF1 2 83150 2.40529E-5 41575 0 5.91596E-5
2-220096748-AACC-A p.His84del disruptive_inframe_deletion ANKZF1 135 83136 0.00162385 41568 0 0.00211699
2-220096748-A-AACC p.His84dup disruptive_inframe_insertion ANKZF1 1 83140 1.20279E-5 41570 0 NA
2-220096756-A-C p.Gln85His missense ANKZF1 1 83144 1.20273E-5 41572 0 4.15648E-6
2-220096756-A-G p.Gln85Gln synonymous ANKZF1 1 83144 1.20273E-5 41572 0 4.15648E-5
2-220096757-G-A p.Glu86Lys missense ANKZF1 55 83142 6.61519E-4 41571 0 0.0016242
2-220096984-G-A p.Gly51Arg missense+splice_region ANKZF1 2 83318 2.40044E-5 41659 0 8.28487E-6
2-220096991-T-C p.Tyr91His missense ANKZF1 2 83320 2.40038E-5 41660 0 7.45552E-5
2-220096992-A-G p.Tyr91Cys missense ANKZF1 2 83314 2.40056E-5 41657 0 3.1839E-5
2-220097001-A-C p.Asp94Ala missense ANKZF1 1 83314 1.20028E-5 41657 0 NA
2-220097010-G-A p.Arg97Gln missense ANKZF1 2 83324 2.40027E-5 41662 0 2.40412E-5
2-220097014-TAACCTAAAGC-T p.Leu100fs frameshift ANKZF1 1 83334 1.19999E-5 41667 0 8.01366E-6
2-220097027-C-T p.Arg103Cys missense ANKZF1 2 83352 2.39946E-5 41676 0 6.25E-4
2-220097045-C-T p.Leu109Phe missense ANKZF1 1 83368 1.1995E-5 41684 0 8.28171E-6
2-220097048-C-T p.Leu110Leu synonymous ANKZF1 3 83370 3.59842E-5 41685 0 NA
2-220097048-C-CT p.Ser111fs frameshift ANKZF1 1 83370 1.19947E-5 41685 0 8.01359E-6
2-220097052-C-T p.Ser111Phe missense ANKZF1 3 83366 3.59859E-5 41683 0 3.1837E-5
2-220097054-G-T p.Ala112Ser missense ANKZF1 3 83362 3.59876E-5 41681 0 1.20203E-5
2-220097058-T-C p.Leu113Pro missense ANKZF1 2 83370 2.39894E-5 41685 0 5.03525E-4
2-220097065-T-G p.Phe115Leu missense ANKZF1 2 83360 2.39923E-5 41680 0 1.60276E-5
2-220097080-C-T p.Ser120Ser synonymous ANKZF1 1 83358 1.19964E-5 41679 0 NA
2-220097222-C-T p.Ser125Ser synonymous ANKZF1 13 83370 1.55931E-4 41685 0 4.14039E-4
2-220097231-G-A p.Ser128Ser synonymous ANKZF1 1 83366 1.19953E-5 41683 0 1.65752E-5
2-220097234-A-G p.Gly129Gly synonymous ANKZF1 1 83360 1.19962E-5 41680 0 2.48567E-5
2-220097257-G-C p.Ser137Thr missense ANKZF1 2115 83354 0.0253737 41677 59 0.0489172
2-220097264-G-A p.Glu139Glu synonymous ANKZF1 1 83378 1.19936E-5 41689 0 NA
2-220097274-A-G p.Thr143Ala missense ANKZF1 1 83374 1.19941E-5 41687 0 NA
2-220097283-C-T p.Arg146Trp missense ANKZF1 19 83378 2.27878E-4 41689 0 3.82336E-4
2-220097283-C-G p.Arg146Gly missense ANKZF1 1 83378 1.19936E-5 41689 0 4.00728E-6
2-220097283-C-A p.Arg146Arg synonymous ANKZF1 1 83378 1.19936E-5 41689 0 NA
2-220097284-G-A p.Arg146Gln missense ANKZF1 31 83376 3.7181E-4 41688 0 2.244E-4
2-220097286-G-A p.Glu147Lys missense ANKZF1 714 83368 0.00856444 41684 6 0.0225
2-220097288-G-A p.Glu147Glu synonymous ANKZF1 1 83370 1.19947E-5 41685 0 NA
2-220097291-G-A p.Arg148Arg synonymous ANKZF1 1 83372 1.19944E-5 41686 0 NA
2-220097301-G-C p.Glu152Gln missense ANKZF1 1 83384 1.19927E-5 41692 0 8.28171E-6
2-220097301-G-A p.Glu152Lys missense ANKZF1 8 83384 9.59417E-5 41692 0 6.25E-4
2-220097314-G-A p.Arg156Gln missense ANKZF1 1 83372 1.19944E-5 41686 0 3.31296E-5
2-220097320-C-T p.Pro158Leu missense ANKZF1 3 83378 3.59807E-5 41689 0 1.65637E-5
2-220097332-C-T p.Pro162Leu missense ANKZF1 13 83378 1.55916E-4 41689 0 5.03525E-4
2-220097337-C-T p.Arg164* stop_gained ANKZF1 2 83374 2.39883E-5 41687 0 2.00346E-5
2-220097338-G-A p.Arg164Gln missense ANKZF1 1 83370 1.19947E-5 41685 0 8.28322E-6
2-220097339-A-G p.Arg164Arg synonymous ANKZF1 2 83370 2.39894E-5 41685 0 NA
2-220097349-C-A p.Gln168Lys missense ANKZF1 1 83382 1.1993E-5 41691 0 NA
2-220097359-A-G p.Gln171Arg missense ANKZF1 1 83372 1.19944E-5 41686 0 NA
2-220097371-T-C p.Leu175Pro missense ANKZF1 1 83362 1.19959E-5 41681 0 1.65857E-5
2-220097380-A-G p.Tyr178Cys missense ANKZF1 1 83346 1.19982E-5 41673 0 8.30192E-6
2-220097380-A-AC p.Arg179fs frameshift ANKZF1 1 83346 1.19982E-5 41673 0 0.00100806
2-220097382-C-T p.Arg179Cys missense ANKZF1 1 83326 1.20011E-5 41663 0 2.4914E-5
2-220097387-T-C p.Cys115Cys splice_region+synonymous ANKZF1 1 83290 1.20062E-5 41645 0 NA
2-220097390-C-G p.Val181Val synonymous ANKZF1 1 83262 1.20103E-5 41631 0 NA
2-220097391-C-T p.Leu182Leu synonymous ANKZF1 2 83256 2.40223E-5 41628 0 NA
2-220097398-C-G p.Pro184Arg missense ANKZF1 3 83190 3.6062E-5 41595 0 NA
2-220097410-G-A c.558+5G>A splice_region ANKZF1 6 83054 7.22422E-5 41527 0 6.36943E-5
2-220097479-G-A n.568G>A splice_region ANKZF1 4 81122 4.93084E-5 40561 0 NA
2-220097480-C-T n.569C>T splice_region ANKZF1 4 81044 4.93559E-5 40522 0 NA
2-220097754-C-G n.991C>G splice_region ANKZF1 17 81328 2.0903E-4 40664 0 1.41268E-4
2-220097806-C-T p.Pro188Pro synonymous ANKZF1 11 82782 1.32879E-4 41391 0 3.60745E-5
2-220097819-G-A p.Glu193Lys missense ANKZF1 12 83008 1.44564E-4 41504 0 6.36862E-5
2-220097821-ACTG-A p.Leu196del disruptive_inframe_deletion ANKZF1 4 83054 4.81614E-5 41527 0 3.1839E-5
2-220097836-C-T c.*319C>T splice_region ANKZF1 1 83234 1.20143E-5 41617 0 NA
2-220097863-C-T p.Cys207Cys synonymous ANKZF1 5 83336 5.99981E-5 41668 0 6.36659E-5
2-220097864-G-A p.Val208Met missense ANKZF1 3 83344 3.59954E-5 41672 0 4.80823E-5
2-220097869-G-A p.Val209Val synonymous ANKZF1 1 83342 1.19988E-5 41671 0 8.28075E-6
2-220097872-C-T p.Leu210Leu synonymous ANKZF1 2 83352 2.39946E-5 41676 0 3.3123E-5
2-220097880-C-T p.Ala213Val missense ANKZF1 1 83348 1.19979E-5 41674 0 4.00702E-6
2-220097884-TG-T p.His216fs frameshift ANKZF1 1 83346 1.19982E-5 41673 0 NA
2-220097890-C-T p.His216His synonymous ANKZF1 3 83344 3.59954E-5 41672 0 8.01385E-6
2-220097890-C-G p.His216Gln missense ANKZF1 1 83344 1.19985E-5 41672 0 4.00692E-6
2-220097895-C-G p.Ala218Gly missense ANKZF1 1 83334 1.19999E-5 41667 0 NA
2-220097897-G-A p.Gly219Ser missense ANKZF1 2 83338 2.39987E-5 41669 0 4.80858E-5
2-220097903-A-G p.Ile221Val missense ANKZF1 3 83344 3.59954E-5 41672 0 4.14058E-5
2-220097912-GGGTGAGAGGGTGCTGCATGGGGGTAAGGATGGAGTGGATCCTGTTAGCCAGGGAGCACCAGCTGGTCTCCAGTACTGAGTCTGTGCTGTCTACA-G c.671+1_672-1delGTGAGAGGGTGCTGCATGGGGGTAAGGATGGAGTGGATCCTGTTAGCCAGGGAGCACCAGCTGGTCTCCAGTACTGAGTCTGTGCTGTCTACAG splice_acceptor ANKZF1 8 83354 9.59762E-5 41677 0 NA
2-220097917-A-C c.671+4A>C splice_region ANKZF1 2 83354 2.3994E-5 41677 0 4.00705E-6
2-220098005-CAGAAG-C p.Arg225fs frameshift ANKZF1 3 83390 3.59755E-5 41695 0 8.28102E-6
2-220098005-CAGA-C p.Arg225del conservative_inframe_deletion ANKZF1 1 83390 1.19918E-5 41695 0 NA
2-220098005-C-T c.672-3C>T splice_region ANKZF1 1 83390 1.19918E-5 41695 0 4.00683E-6
2-220098013-A-G p.Glu226Gly missense ANKZF1 9 83390 1.07927E-4 41695 0 5.04032E-4
2-220098035-T-C p.Phe233Phe synonymous ANKZF1 1 83378 1.19936E-5 41689 0 6.3674E-5
2-220098039-C-T p.Arg235Cys missense ANKZF1 3 83374 3.59824E-5 41687 0 5.03525E-4
2-220098040-G-A p.Arg235His missense ANKZF1 4 83376 4.79754E-5 41688 0 8.28322E-6
2-220098041-C-T p.Arg235Arg synonymous ANKZF1 1 83368 1.1995E-5 41684 0 NA
2-220098043-A-G p.Tyr236Cys missense ANKZF1 1 83378 1.19936E-5 41689 0 8.28349E-6
2-220098045-A-G p.Thr237Ala missense ANKZF1 2 83372 2.39889E-5 41686 0 4.14175E-5
2-220098046-C-T p.Thr237Met missense ANKZF1 2 83370 2.39894E-5 41685 0 4.80831E-5
2-220098047-G-A p.Thr237Thr synonymous ANKZF1 5 83362 5.99794E-5 41681 0 1.20218E-5
2-220098051-C-T p.Arg239Trp missense ANKZF1 2 83362 2.39917E-5 41681 0 8.285E-6
2-220098053-G-C p.Arg239Arg synonymous ANKZF1 1 83364 1.19956E-5 41682 0 NA
2-220098060-C-T p.Arg242Trp missense ANKZF1 6 83364 7.19735E-5 41682 0 1.56298E-4
2-220098077-G-A p.Gly247Gly synonymous ANKZF1 1 83354 1.1997E-5 41677 0 NA
2-220098088-C-A p.Ala251Asp missense ANKZF1 1 83332 1.20002E-5 41666 0 8.02324E-6
2-220098089-C-T p.Ala251Ala synonymous ANKZF1 2 83330 2.4001E-5 41665 0 4.01245E-6
2-220098090-C-T p.Arg252* stop_gained ANKZF1 13 83328 1.5601E-4 41664 0 1.27372E-4
2-220098090-C-G p.Arg252Gly missense ANKZF1 1 83328 1.20008E-5 41664 0 NA
2-220098091-G-A p.Arg252Gln missense ANKZF1 1 83336 1.19996E-5 41668 0 6.25E-4
2-220098099-C-T p.Pro255Ser missense ANKZF1 1 83336 1.19996E-5 41668 0 4.01513E-6
2-220098108-T-G p.Ser258Ala missense ANKZF1 1 83334 1.19999E-5 41667 0 NA
2-220098129-C-T p.Arg265Cys missense ANKZF1 1 83310 1.20034E-5 41655 0 6.3678E-5
2-220098130-G-A p.Arg265His missense ANKZF1 2 83306 2.40079E-5 41653 0 2.82438E-5
2-220098151-A-G p.Tyr272Cys missense ANKZF1 470 83196 0.00564931 41598 3 0.0124475
2-220098161-T-C c.819+6T>C splice_region ANKZF1 1 83148 1.20267E-5 41574 0 NA
2-220098163-A-G c.819+8A>G splice_region ANKZF1 1 83116 1.20314E-5 41558 0 8.57442E-6
2-220098163-A-C c.819+8A>C splice_region ANKZF1 1 83116 1.20314E-5 41558 0 NA
2-220098164-A-G n.514A>G splice_region ANKZF1 1 83108 1.20325E-5 41554 0 4.31928E-6
2-220098436-G-C c.820-1G>C splice_acceptor ANKZF1 3 82392 3.64113E-5 41196 0 NA
2-220098444-G-A p.Arg276His missense ANKZF1 6 82492 7.27343E-5 41246 0 1.91168E-4
2-220098451-G-A p.Leu278Leu synonymous ANKZF1 20 82596 2.42142E-4 41298 0 8.50003E-5
2-220098467-T-C p.Trp284Arg missense ANKZF1 2 82676 2.41908E-5 41338 0 NA
2-220098469-G-C p.Trp284Cys missense ANKZF1 1 82668 1.20966E-5 41334 0 NA
2-220098477-C-T p.Ala287Val missense ANKZF1 3 82686 3.62818E-5 41343 0 3.62059E-5
2-220098484-G-A p.Glu289Glu synonymous ANKZF1 2 82740 2.41721E-5 41370 0 8.31463E-6
2-220098486-A-G p.Glu290Gly missense ANKZF1 1 82702 1.20916E-5 41351 0 1.41332E-4
2-220098501-T-A p.Leu295Gln missense ANKZF1 2 82734 2.41739E-5 41367 0 NA
2-220098506-C-T p.Arg297Cys missense ANKZF1 38 82684 4.59581E-4 41342 0 0.00137141
2-220098507-G-A p.Arg297His missense ANKZF1 1 82706 1.2091E-5 41353 0 3.1841E-5
2-220098514-C-A p.Pro299Pro synonymous ANKZF1 2 82736 2.41733E-5 41368 0 NA
2-220098514-C-T p.Pro299Pro synonymous ANKZF1 1 82736 1.20866E-5 41368 0 NA
2-220098515-C-G p.Arg300Gly missense ANKZF1 14 82744 1.69197E-4 41372 0 7.48179E-5
2-220098524-C-T p.Arg303Trp missense ANKZF1 1 82764 1.20825E-5 41382 0 8.3131E-6
2-220098528-C-A p.Ser304Tyr missense ANKZF1 1 82846 1.20706E-5 41423 0 4.01455E-6
2-220098530-T-C p.Leu305Leu synonymous ANKZF1 2 82876 2.41324E-5 41438 0 NA
2-220098537-T-C p.Phe307Ser missense ANKZF1 1 82854 1.20694E-5 41427 0 NA
2-220098540-G-C p.Gly308Ala missense ANKZF1 1 82800 1.20773E-5 41400 0 NA
2-220098559-GC-G p.Gln315fs frameshift ANKZF1 1 82834 1.20723E-5 41417 0 NA
2-220098563-A-AG p.Asp318fs frameshift ANKZF1 1 82864 1.2068E-5 41432 0 NA
2-220098568-G-T p.Gly317Gly synonymous ANKZF1 8 82938 9.64576E-5 41469 0 2.86606E-4
2-220098569-G-GA p.Asp318fs frameshift ANKZF1 1 82932 1.20581E-5 41466 0 4.03792E-6
2-220098573-C-T p.Pro319Leu missense ANKZF1 1 82928 1.20587E-5 41464 0 4.0405E-6
2-220098575-C-T p.Arg320* stop_gained ANKZF1 1 82986 1.20502E-5 41493 0 8.36722E-6
2-220098576-G-C p.Arg320Pro missense ANKZF1 1 82998 1.20485E-5 41499 0 NA
2-220098592-C-T p.Pro325Pro synonymous ANKZF1 1 83034 1.20433E-5 41517 0 NA
2-220098595-C-T p.Leu326Leu synonymous ANKZF1 34 83014 4.09569E-4 41507 0 5.03525E-4
2-220098596-G-A p.Ala327Thr missense ANKZF1 1 83012 1.20465E-5 41506 0 1.22079E-5
2-220098602-C-T p.Arg329Cys missense ANKZF1 4 83036 4.81719E-5 41518 0 1.43465E-4
2-220098603-G-A p.Arg329His missense ANKZF1 9 83030 1.08395E-4 41515 0 2.54907E-4
2-220098623-C-CTACA p.Gln337fs frameshift ANKZF1 2 83148 2.40535E-5 41574 0 1.74055E-5
2-220098627-AGCGTGT-A p.Arg338_Val339del disruptive_inframe_deletion ANKZF1 2 83150 2.40529E-5 41575 0 NA
2-220098630-G-A p.Arg338His missense ANKZF1 2 83158 2.40506E-5 41579 0 6.25E-4
2-220098630-G-C p.Arg338Pro missense ANKZF1 1 83158 1.20253E-5 41579 0 6.36943E-5
2-220098631-T-C p.Arg338Arg synonymous ANKZF1 1 83172 1.20233E-5 41586 0 NA
2-220098654-T-C p.Leu346Ser missense ANKZF1 3 83172 3.60698E-5 41586 0 3.1835E-5
2-220098659-G-A p.Val348Ile missense ANKZF1 1 83164 1.20244E-5 41582 0 NA
2-220098662-T-C p.Tyr349His missense ANKZF1 2 83112 2.40639E-5 41556 0 4.90542E-6
2-220098849-T-C c.1049-6T>C splice_region ANKZF1 73 83072 8.78756E-4 41536 0 0.00117812
2-220098852-CAGA-C p.Glu351fs frameshift ANKZF1 2 83052 2.40813E-5 41526 0 1.243E-5
2-220098857-G-A p.Glu351Lys missense+splice_region ANKZF1 7 83066 8.42703E-5 41533 0 1.27413E-4
2-220098859-A-C p.Glu351Asp missense ANKZF1 92 83054 0.00110771 41527 0 0.00100705
2-220098859-AG-CC p.GluAsp351AspHis missense ANKZF1 2 83058 2.40796E-5 41529 0 NA
2-220098866-C-T p.Arg354Trp missense ANKZF1 7 83044 8.42927E-5 41522 2 6.25E-4
2-220098867-G-A p.Arg354Gln missense ANKZF1 1 83032 1.20435E-5 41516 0 6.36821E-5
2-220098880-A-C p.Arg358Ser missense ANKZF1 1 83054 1.20404E-5 41527 0 NA
2-220098884-C-T p.His360Tyr missense ANKZF1 1 83060 1.20395E-5 41530 0 NA
2-220098885-A-G p.His360Arg missense ANKZF1 1 83064 1.20389E-5 41532 0 5.03525E-4
2-220098886-C-T p.His360His synonymous ANKZF1 4 83078 4.81475E-5 41539 0 3.33706E-5
2-220098903-G-A p.Trp366* stop_gained ANKZF1 2 83054 2.40807E-5 41527 0 3.33823E-5
2-220098906-A-T p.Lys367Ile missense ANKZF1 5 83060 6.01974E-5 41530 0 3.33868E-5
2-220098909-C-T p.Thr368Ile missense ANKZF1 2 83040 2.40848E-5 41520 0 8.34878E-6
2-220098912-TAA-T p.Glu371fs frameshift ANKZF1 3 83022 3.6135E-5 41511 0 8.35059E-6
2-220098913-A-C p.Val369Val synonymous ANKZF1 194 83020 0.00233679 41510 0 0.00327921
2-220098933-C-T p.Pro376Leu missense ANKZF1 1 82854 1.20694E-5 41427 0 NA
2-220098936-C-T p.Thr377Ile missense ANKZF1 1 82808 1.20761E-5 41404 0 4.01497E-6
2-220098943-A-G p.Glu379Glu synonymous ANKZF1 1 82708 1.20907E-5 41354 0 8.35603E-6
2-220098947-A-T p.Ile381Leu missense ANKZF1 1 82636 1.21013E-5 41318 0 NA
2-220098949-A-G p.Ile381Met missense ANKZF1 2 82596 2.42142E-5 41298 0 NA
2-220098962-A-G p.Arg386Gly missense ANKZF1 1 82224 1.21619E-5 41112 0 3.18451E-5
2-220098978-C-T p.Ala391Val missense ANKZF1 7 81132 8.62791E-5 40566 0 6.37227E-5
2-220098979-G-A p.Ala391Ala synonymous ANKZF1 16 80970 1.97604E-4 40485 0 4.04057E-5
2-220098988-G-T p.Gln394His missense ANKZF1 1 80324 1.24496E-5 40162 0 NA
2-220098995-G-C p.Glu397Gln missense ANKZF1 2 79632 2.51155E-5 39816 0 3.64904E-5
2-220099005-A-G p.Lys400Arg missense ANKZF1 3 78440 3.82458E-5 39220 0 NA
2-220099015-G-T c.1204+5G>T splice_region ANKZF1 1 76892 1.30053E-5 38446 0 NA
2-220099136-A-T n.559A>T splice_region ANKZF1 4 48902 8.17962E-5 24451 0 6.36699E-5
2-220099415-C-T n.1566C>T splice_region ANKZF1 1 74396 1.34416E-5 37198 0 NA
2-220099546-A-G c.1205-2A>G splice_acceptor ANKZF1 4 81778 4.89129E-5 40889 0 2.40252E-4
2-220099557-C-T p.Ser405Leu missense ANKZF1 1 81944 1.22035E-5 40972 0 1.7511E-5
2-220099563-G-A p.Gly407Glu missense ANKZF1 20 82150 2.43457E-4 41075 0 0.00151057
2-220099577-C-T p.Gln412* stop_gained ANKZF1 2 82542 2.42301E-5 41271 0 3.18471E-5
2-220099579-G-C p.Gln412His missense ANKZF1 2 82608 2.42107E-5 41304 0 NA
2-220099585-G-A p.Glu414Glu synonymous ANKZF1 2 82750 2.41692E-5 41375 0 4.00747E-6
2-220099586-T-G p.Leu415Val missense ANKZF1 1 82746 1.20852E-5 41373 0 9.55779E-5
2-220099600-G-A p.Glu419Glu synonymous ANKZF1 1 82988 1.20499E-5 41494 0 NA
2-220099606-T-G p.Thr421Thr synonymous ANKZF1 1 83088 1.20354E-5 41544 0 1.66898E-5
2-220099626-G-T p.Cys428Phe missense ANKZF1 1 83256 1.20111E-5 41628 0 NA
2-220099639-A-G p.Val432Val synonymous ANKZF1 7 83302 8.40316E-5 41651 0 1.27364E-4
2-220099640-T-C p.Leu433Leu synonymous ANKZF1 3 83304 3.60127E-5 41652 0 NA
2-220099649-C-T p.Arg436Trp missense ANKZF1 3 83316 3.60075E-5 41658 0 3.31928E-5
2-220099649-CGGA-C p.Arg439del disruptive_inframe_deletion ANKZF1 3 83316 3.60075E-5 41658 0 9.12802E-5
2-220099651-G-A p.Arg436Arg synonymous ANKZF1 1 83328 1.20008E-5 41664 0 NA
2-220099668-A-G p.Asn442Ser missense ANKZF1 10 83338 1.19993E-4 41669 0 1.82424E-4
2-220099669-T-G p.Asn442Lys missense ANKZF1 1 83338 1.19993E-5 41669 0 NA
2-220099669-TAAG-T p.Lys444del conservative_inframe_deletion ANKZF1 1 83338 1.19993E-5 41669 0 3.18634E-5
2-220099685-C-T p.Arg448* stop_gained ANKZF1 2 83346 2.39964E-5 41673 0 3.18431E-5
2-220099686-G-A p.Arg448Gln missense ANKZF1 4 83344 4.79939E-5 41672 0 9.55231E-5
2-220099688-G-A p.Asp449Asn missense ANKZF1 1 83346 1.19982E-5 41673 0 8.01616E-6
2-220099694-G-A p.Glu451Lys missense ANKZF1 2 83352 2.39946E-5 41676 0 5.80277E-5
2-220099697-G-A p.Ala452Thr missense ANKZF1 2 83340 2.39981E-5 41670 0 NA
2-220099707-A-G p.His455Arg missense ANKZF1 8 83342 9.599E-5 41671 0 6.63317E-5
2-220099710-G-A p.Arg456Gln missense ANKZF1 1 83328 1.20008E-5 41664 0 3.1837E-5
2-220099713-C-T p.Thr457Ile missense ANKZF1 704 83302 0.00845118 41651 5 0.0225
2-220099723-G-A p.Gln460Gln synonymous ANKZF1 1 83316 1.20025E-5 41658 0 NA
2-220099731-A-C p.Gln463Pro missense ANKZF1 1 83290 1.20062E-5 41645 0 NA
2-220099735-A-G p.Glu464Glu synonymous ANKZF1 2 83280 2.40154E-5 41640 0 4.00879E-6
2-220099748-A-C p.Thr469Pro missense ANKZF1 21 83206 2.52386E-4 41603 0 2.32573E-4
2-220099758-C-T p.Ser472Phe missense ANKZF1 3 83158 3.60759E-5 41579 0 5.72993E-4
2-220099770-C-G p.Ala476Gly missense ANKZF1 1 83042 1.20421E-5 41521 0 NA
2-220099772-G-A p.Ala477Thr missense ANKZF1 1 83002 1.20479E-5 41501 0 4.01184E-6
2-220099774-C-A p.Ala477Ala synonymous ANKZF1 1 82990 1.20496E-5 41495 0 NA
2-220099776-C-T p.Pro478Leu missense ANKZF1 1 82996 1.20488E-5 41498 0 NA
2-220099785-C-T p.Pro481Leu missense ANKZF1 1 82916 1.20604E-5 41458 0 NA
2-220099798-G-A p.Glu485Glu synonymous ANKZF1 9 82732 1.08785E-4 41366 0 6.3674E-5
2-220099799-G-A p.Ala486Thr missense ANKZF1 2 82712 2.41803E-5 41356 0 0.003125
2-220099806-C-T p.Ala488Val missense ANKZF1 1 82710 1.20904E-5 41355 0 8.28803E-6
2-220099808-C-T p.Pro489Ser missense ANKZF1 36 82720 4.35203E-4 41360 0 0.00108253
2-220099827-G-A p.Trp495* stop_gained ANKZF1 1 82770 1.20817E-5 41385 0 NA
2-220099830-A-G p.Asn496Ser missense ANKZF1 3 82772 3.62441E-5 41386 0 1.65733E-5
2-220099834-A-C p.Ala497Ala synonymous ANKZF1 2 82760 2.41663E-5 41380 0 NA
2-220099844-G-T p.Ala501Ser missense ANKZF1 1 82828 1.20732E-5 41414 0 1.20337E-5
2-220099846-T-C p.Ala501Ala synonymous ANKZF1 1 82856 1.20691E-5 41428 0 3.1837E-5
2-220099850-C-T p.Arg503* stop_gained ANKZF1 1 82854 1.20694E-5 41427 0 6.25E-4
2-220099872-T-C p.Leu510Pro missense ANKZF1 4 83008 4.81881E-5 41504 0 8.2861E-6
2-220099874-AAGCTGCAGCT-A p.Gln513fs frameshift ANKZF1 2 83014 2.40923E-5 41507 0 NA
2-220099909-A-T p.Arg522Ser missense ANKZF1 2 83136 2.4057E-5 41568 0 3.31483E-5
2-220099924-C-T p.Leu527Leu synonymous ANKZF1 4 83176 4.80908E-5 41588 0 0.00100705
2-220099932-C-G p.Pro530Arg missense ANKZF1 9 83196 1.08178E-4 41598 0 5.03525E-4
2-220099942-C-T p.Ser533Ser synonymous ANKZF1 2 83168 2.40477E-5 41584 0 4.14855E-5
2-220099944-G-A p.Gly534Asp missense ANKZF1 1 83152 1.20262E-5 41576 0 NA
2-220099967-G-T p.Ala542Ser missense ANKZF1 1 83042 1.20421E-5 41521 0 4.02791E-6
2-220099984-A-C p.Arg547Ser missense ANKZF1 1 82976 1.20517E-5 41488 0 8.33834E-6
2-220099989-CAG-C p.Val550fs frameshift ANKZF1 1 82936 1.20575E-5 41468 0 4.03916E-6
2-220099993-G-C p.Val550Val synonymous ANKZF1 1 82898 1.2063E-5 41449 0 NA
2-220099998-G-A p.Arg552His missense ANKZF1 5 82840 6.03573E-5 41420 0 3.18451E-5
2-220100013-C-T p.Ala557Val missense ANKZF1 1 82786 1.20793E-5 41393 0 8.43227E-6
2-220100024-C-A p.Pro561Thr missense ANKZF1 1 82732 1.20872E-5 41366 0 NA
2-220100028-CTG-C p.Val563fs frameshift ANKZF1 3 82756 3.62511E-5 41378 0 7.32106E-5
2-220100031-T-C p.Val563Ala missense ANKZF1 3 82784 3.62389E-5 41392 0 7.32792E-5
2-220100039-G-A c.1691+5G>A splice_region ANKZF1 1 82828 1.20732E-5 41414 0 8.50948E-6
2-220100191-C-T c.1692-5C>T splice_region ANKZF1 6 83414 7.19304E-5 41707 0 2.54907E-4
2-220100194-A-T c.1692-2A>T splice_acceptor ANKZF1 3 83416 3.59643E-5 41708 0 4.00962E-6
2-220100197-GACTCTCGGGCCCGGCCACCTTAT-G p.Ser566fs frameshift ANKZF1 1 83416 1.19881E-5 41708 0 NA
2-220100198-ACT-A p.Arg567fs frameshift ANKZF1 1 83414 1.19884E-5 41707 0 1.20295E-5
2-220100201-C-G p.Ser566Cys missense ANKZF1 606 83412 0.00726514 41706 20 0.0178251
2-220100201-C-T p.Ser566Phe missense ANKZF1 1 83418 1.19878E-5 41709 0 NA
2-220100203-C-T p.Arg567Trp missense ANKZF1 3 83414 3.59652E-5 41707 0 2.00472E-5
2-220100203-C-G p.Arg567Gly missense ANKZF1 1 83414 1.19884E-5 41707 0 8.28775E-6
2-220100204-G-A p.Arg567Gln missense ANKZF1 4 83418 4.79513E-5 41709 0 6.25E-4
2-220100206-G-A p.Ala568Thr missense ANKZF1 1 83412 1.19887E-5 41706 0 NA
2-220100209-C-T p.Arg569Trp missense ANKZF1 9 83416 1.07893E-4 41708 0 5.41574E-4
2-220100210-G-A p.Arg569Gln missense ANKZF1 5 83412 5.99434E-5 41706 0 3.31378E-5
2-220100212-C-T p.Pro570Ser missense ANKZF1 376 83402 0.00450829 41701 5 0.0161128
2-220100218-T-C p.Tyr572His missense ANKZF1 3 83414 3.59652E-5 41707 0 6.37511E-5
2-220100220-T-C p.Tyr572Tyr synonymous ANKZF1 2 83412 2.39774E-5 41706 0 NA
2-220100225-T-A p.Val574Asp missense ANKZF1 1 83408 1.19893E-5 41704 0 NA
2-220100226-T-C p.Val574Val synonymous ANKZF1 1 83412 1.19887E-5 41706 0 NA
2-220100228-C-T p.Ala575Val missense ANKZF1 2 83398 2.39814E-5 41699 0 NA
2-220100229-G-A p.Ala575Ala synonymous ANKZF1 51 83400 6.11511E-4 41700 1 0.0059315
2-220100230-G-A p.Ala576Thr missense ANKZF1 1 83396 1.1991E-5 41698 0 5.03525E-4
2-220100233-G-A p.Asp577Asn missense ANKZF1 1 83396 1.1991E-5 41698 0 8.28144E-6
2-220100235-C-G p.Asp577Glu missense ANKZF1 2 83396 2.3982E-5 41698 0 NA
2-220100235-C-T p.Asp577Asp synonymous ANKZF1 1 83396 1.1991E-5 41698 0 NA
2-220100246-G-A p.Arg581His missense ANKZF1 1 83390 1.19918E-5 41695 0 3.18695E-5
2-220100257-C-T p.Arg585* stop_gained ANKZF1 3 83386 3.59773E-5 41693 0 8.28185E-6
2-220100258-G-A p.Arg585Gln missense ANKZF1 541 83388 0.00648774 41694 4 0.00617917
2-220100267-T-C p.Met588Thr missense ANKZF1 20 83400 2.39808E-4 41700 0 4.14435E-4
2-220100269-G-T p.Glu589* stop_gained ANKZF1 1 83400 1.19904E-5 41700 0 NA
2-220100289-C-T p.Tyr595Tyr synonymous ANKZF1 16 83374 1.91906E-4 41687 0 2.23157E-4
2-220100290-G-A p.Asp596Asn missense ANKZF1 5 83378 5.99679E-5 41689 0 1.60299E-4
2-220100293-TACA-T p.Asn598del disruptive_inframe_deletion ANKZF1 6 83378 7.19614E-5 41689 0 3.28615E-4
2-220100301-G-C p.Lys599Asn missense ANKZF1 1 83380 1.19933E-5 41690 0 NA
2-220100301-G-A p.Lys599Lys synonymous ANKZF1 1 83380 1.19933E-5 41690 0 NA
2-220100305-C-T p.Gln601* stop_gained ANKZF1 1 83382 1.1993E-5 41691 0 3.18552E-5
2-220100308-G-A c.1803+1G>A splice_donor ANKZF1 1 83376 1.19939E-5 41688 0 NA
2-220100310-C-A c.1803+3C>A splice_region ANKZF1 2 83378 2.39871E-5 41689 0 4.97331E-5
2-220100426-C-A c.1804-4C>A splice_region ANKZF1 1 83064 1.20389E-5 41532 0 NA
2-220100429-G-A c.1804-1G>A splice_acceptor ANKZF1 1 83066 1.20386E-5 41533 0 NA
2-220100437-G-A p.Gly604Glu missense ANKZF1 2 83016 2.40917E-5 41508 0 NA
2-220100448-C-A p.Pro608Thr missense ANKZF1 1 83016 1.20459E-5 41508 0 9.97291E-5
2-220100450-A-G p.Pro608Pro synonymous ANKZF1 12 83022 1.4454E-4 41511 0 4.13855E-4
2-220100451-G-A p.Glu609Lys missense ANKZF1 2 83012 2.40929E-5 41506 0 4.98629E-5
2-220100455-T-C p.Met610Thr missense ANKZF1 2 83016 2.40917E-5 41508 0 4.01387E-6
2-220100463-C-T p.Arg613Trp missense ANKZF1 5 83016 6.02294E-5 41508 0 3.18512E-5
2-220100464-G-A p.Arg613Gln missense ANKZF1 4 83022 4.818E-5 41511 0 3.1839E-5
2-220100465-G-A p.Arg613Arg synonymous ANKZF1 1 83014 1.20462E-5 41507 0 8.02723E-6
2-220100476-G-A p.Arg617Gln missense ANKZF1 224 83012 0.0026984 41506 1 0.00805639
2-220100478-A-C p.Lys618Gln missense ANKZF1 1 83008 1.2047E-5 41504 0 NA
2-220100482-G-A p.Arg619Lys missense ANKZF1 1 83028 1.20441E-5 41514 0 NA
2-220100484-GAGC-G p.Gln621del conservative_inframe_deletion ANKZF1 1 83018 1.20456E-5 41509 0 8.02388E-6
2-220100484-G-A p.Glu620Lys missense ANKZF1 1 83018 1.20456E-5 41509 0 3.1835E-5
2-220100499-C-T p.Arg625Trp missense ANKZF1 1 83004 1.20476E-5 41502 0 2.49169E-5
2-220100500-G-A p.Arg625Gln missense ANKZF1 1 83004 1.20476E-5 41502 0 3.18431E-5
2-220100502-C-T p.Arg626Trp missense ANKZF1 9 82990 1.08447E-4 41495 0 1.66099E-5
2-220100503-G-A p.Arg626Gln missense ANKZF1 11 83014 1.32508E-4 41507 0 2.22902E-4
2-220100508-C-T p.Arg628Trp missense ANKZF1 5 82992 6.02468E-5 41496 0 1.2434E-4
2-220100509-G-A p.Arg628Gln missense ANKZF1 1 82988 1.20499E-5 41494 0 3.32116E-5
2-220100517-C-G p.Gln631Glu missense ANKZF1 1 82980 1.20511E-5 41490 0 8.30165E-6
2-220100517-C-A p.Gln631Lys missense ANKZF1 1 82980 1.20511E-5 41490 0 3.18431E-5
2-220100525-G-A p.Gln633Gln synonymous ANKZF1 2 82992 2.40987E-5 41496 0 NA
2-220100527-GGCAGCA-G p.Gln635_Gln636del conservative_inframe_deletion ANKZF1 2 82988 2.40999E-5 41494 0 NA
2-220100529-CAGCAGG-C p.Gln638_Glu639del conservative_inframe_deletion ANKZF1 99 82978 0.00119309 41489 0 0.00181494
2-220100530-A-G p.Gln635Arg missense ANKZF1 1 82994 1.20491E-5 41497 0 NA
2-220100532-CAGGAGCAGG-C p.Gln638_Glu640del disruptive_inframe_deletion ANKZF1 3 82966 3.61594E-5 41483 0 NA
2-220100536-A-G p.Glu637Gly missense ANKZF1 1 82972 1.20523E-5 41486 0 NA
2-220100546-G-A p.Glu640Glu synonymous ANKZF1 1 82970 1.20525E-5 41485 0 NA
2-220100547-C-T p.Arg641Cys missense ANKZF1 7 82950 8.43882E-5 41475 0 1.88493E-4
2-220100548-G-A p.Arg641His missense ANKZF1 4 82964 4.82137E-5 41482 0 0.00100705
2-220100552-A-C p.Glu642Asp missense ANKZF1 1 82946 1.2056E-5 41473 0 NA
2-220100553-C-A p.Arg643Arg synonymous ANKZF1 1850 82878 0.022322 41439 27 0.0255765
2-220100565-C-T p.Arg647Trp missense ANKZF1 3 82916 3.61812E-5 41458 0 6.25E-4
2-220100566-G-A p.Arg647Gln missense ANKZF1 1 82924 1.20592E-5 41462 0 4.14848E-5
2-220100568-C-T p.Arg648* stop_gained ANKZF1 2 82876 2.41324E-5 41438 0 4.01123E-6
2-220100569-G-A p.Arg648Gln missense ANKZF1 1 82932 1.20581E-5 41466 0 3.18532E-5
2-220100577-G-A p.Ala651Thr missense ANKZF1 1 82908 1.20616E-5 41454 0 3.18471E-5
2-220100578-C-T p.Ala651Val missense ANKZF1 1 82920 1.20598E-5 41460 0 5.03525E-4
2-220100582-C-T p.Leu652Leu synonymous ANKZF1 3 82968 3.61585E-5 41484 0 5.03525E-4
2-220100588-C-T p.Asp654Asp synonymous ANKZF1 11 82922 1.32655E-4 41461 0 7.54823E-4
2-220100601-A-G c.1971+4A>G splice_region ANKZF1 2 82946 2.41121E-5 41473 0 1.65873E-5
2-220100604-C-T c.1971+7C>T splice_region ANKZF1 14 82962 1.68752E-4 41481 0 1.80537E-4
2-220100740-G-T p.Leu660Leu synonymous ANKZF1 2 83068 2.40767E-5 41534 0 3.18451E-5
2-220100751-G-A p.Arg664His missense ANKZF1 1 82980 1.20511E-5 41490 0 3.18532E-5
2-220100754-G-A p.Arg665Gln missense ANKZF1 7 83016 8.43211E-5 41508 0 6.01342E-5
2-220100754-G-T p.Arg665Leu missense ANKZF1 2 83016 2.40917E-5 41508 0 NA
2-220100758-C-T p.Leu666Leu synonymous ANKZF1 1 83026 1.20444E-5 41513 0 3.18431E-5
2-220100761-T-C p.Ala667Ala synonymous ANKZF1 1 83044 1.20418E-5 41522 0 8.0179E-6
2-220100777-C-G p.Pro673Ala missense ANKZF1 1 82978 1.20514E-5 41489 0 NA
2-220100778-C-T p.Pro673Leu missense ANKZF1 5 82974 6.02598E-5 41487 0 1.65681E-5
2-220100780-A-G p.Thr674Ala missense ANKZF1 2 82954 2.41097E-5 41477 0 1.59469E-4
2-220100780-A-T p.Thr674Ser missense ANKZF1 2 82954 2.41097E-5 41477 0 NA
2-220100782-C-T p.Thr674Thr synonymous ANKZF1 2 82960 2.4108E-5 41480 0 1.65686E-5
2-220100787-C-T p.Pro676Leu missense ANKZF1 10122 82586 0.122563 41293 708 0.143505
2-220100789-A-G p.Ile677Val missense ANKZF1 1 82950 1.20555E-5 41475 0 NA
2-220100797-C-CTCTGCAATCG p.Asn684fs frameshift ANKZF1 1 82940 1.20569E-5 41470 0 NA
2-220100800-T-C p.Ser680Ser synonymous ANKZF1 4 82926 4.82358E-5 41463 0 2.00491E-5
2-220100806-C-T p.Ile682Ile synonymous ANKZF1 3 82860 3.62056E-5 41430 0 1.65692E-5
2-220100806-C-A p.Ile682Ile synonymous ANKZF1 2 82860 2.41371E-5 41430 0 NA
2-220100809-C-T p.Val683Val synonymous ANKZF1 2 82828 2.41464E-5 41414 0 3.18492E-5
2-220100809-C-G p.Val683Val synonymous ANKZF1 2 82828 2.41464E-5 41414 0 NA
2-220100811-A-G p.Asn684Ser missense ANKZF1 1 82802 1.2077E-5 41401 0 NA
2-220100816-C-T p.Arg686* stop_gained ANKZF1 1 82704 1.20913E-5 41352 0 5.21427E-5
2-220100817-G-A p.Arg686Gln missense+splice_region ANKZF1 2 82720 2.41779E-5 41360 0 6.37064E-5
2-220100818-G-T c.2057+1G>T splice_donor ANKZF1 1 82702 1.20916E-5 41351 0 NA
2-220100822-G-A c.2057+5G>A splice_region ANKZF1 72 82686 8.70764E-4 41343 0 0.00117834
2-220101045-C-T p.Arg687Cys missense+splice_region ANKZF1 13 83258 1.56141E-4 41629 0 2.07132E-4
2-220101046-G-A p.Arg687His missense+splice_region ANKZF1 4 83268 4.80377E-5 41634 0 9.9425E-5
2-220101058-G-T p.Cys691Phe missense ANKZF1 1 83310 1.20034E-5 41655 0 NA
2-220101062-G-C p.Gly692Gly synonymous ANKZF1 19 83312 2.28058E-4 41656 0 2.54858E-4
2-220101067-C-T p.Ser694Phe missense ANKZF1 1 83304 1.20042E-5 41652 0 1.65761E-5
2-220101068-C-T p.Ser694Ser synonymous ANKZF1 2 83306 2.40079E-5 41653 0 3.18634E-5
2-220101077-C-T p.Gly697Gly synonymous ANKZF1 1 83316 1.20025E-5 41658 0 NA
2-220101092-C-A p.His702Gln missense ANKZF1 8 83278 9.60638E-5 41639 1 8.30358E-6
2-220101096-C-T p.Leu704Phe missense ANKZF1 1 83276 1.20083E-5 41638 0 NA
2-220101099-G-A p.Asp705Asn missense ANKZF1 1 83260 1.20106E-5 41630 0 3.18573E-5
2-220101120-C-T p.Arg712Cys missense ANKZF1 1 83210 1.20178E-5 41605 0 2.00876E-5
2-220101121-G-A p.Arg712His missense ANKZF1 1 83200 1.20192E-5 41600 0 4.01913E-6
2-220101127-T-C p.Leu714Pro missense ANKZF1 1 83220 1.20163E-5 41610 0 NA
2-220101129-C-T p.Gln715* stop_gained ANKZF1 2 83212 2.4035E-5 41606 0 4.02395E-6
2-220101138-C-T p.Arg718Cys missense ANKZF1 6 83162 7.21483E-5 41581 0 1.27956E-4
2-220101141-C-T p.Arg719Cys missense ANKZF1 1 83152 1.20262E-5 41576 0 2.56524E-5
2-220101144-C-G p.Gln720Glu missense ANKZF1 5 83146 6.01352E-5 41573 0 1.71674E-5
2-220101160-C-G p.Ser725Cys missense ANKZF1 1 83026 1.20444E-5 41513 0 3.18431E-5
2-220101160-C-T p.Ser725Phe missense ANKZF1 1 83026 1.20444E-5 41513 0 NA
2-220101164-C-T p.Ser726Ser synonymous ANKZF1 1 83018 1.20456E-5 41509 0 4.22719E-6
2-220101167-A-T p.Ter727Cysext*? stop_lost ANKZF1 1 82976 1.20517E-5 41488 0 NA
2-220101388-T-TA c.*222dupA splice_region ANKZF1 1 65724 1.52151E-5 32862 0 3.18735E-5