Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
16-4747009-GA-CT c.*11+8_*11+9delTCinsAG splice_region ANKS3 1 81482 1.22726E-5 40741 0 NA
16-4747018-C-T c.*11G>A splice_region ANKS3 4 81406 4.91364E-5 40703 0 1.22331E-5
16-4747019-G-A c.*10C>T splice_region ANKS3 3 81364 3.68713E-5 40682 0 9.30008E-6
16-4747030-T-C p.Ter657Trpext*? stop_lost ANKS3 1 81368 1.22898E-5 40684 0 1.84359E-5
16-4747032-G-C p.Thr656Thr synonymous ANKS3 1 81380 1.2288E-5 40690 0 NA
16-4747035-C-G p.Glu655Asp missense ANKS3 1 81390 1.22865E-5 40695 0 NA
16-4747037-C-T p.Glu655Lys missense ANKS3 2 82172 2.43392E-5 41086 0 1.27486E-4
16-4747039-C-T p.Arg654Gln missense ANKS3 105 82446 0.00127356 41223 0 0.00125078
16-4747040-G-A p.Arg654Trp missense ANKS3 1 82454 1.2128E-5 41227 0 3.18796E-5
16-4747045-T-C p.Lys652Arg missense ANKS3 6 82526 7.27044E-5 41263 0 9.18963E-5
16-4747050-C-T p.Gly650Gly synonymous ANKS3 5 82646 6.0499E-5 41323 0 3.18715E-5
16-4747051-C-G p.Gly650Ala missense ANKS3 1 82644 1.21001E-5 41322 0 1.99652E-5
16-4747052-C-T p.Gly650Arg missense ANKS3 1 82636 1.21013E-5 41318 0 3.18695E-5
16-4747053-G-A p.Asn649Asn synonymous ANKS3 4 82616 4.84168E-5 41308 0 0.00100705
16-4747065-C-G p.Leu645Leu synonymous ANKS3 1 82674 1.20957E-5 41337 0 NA
16-4747089-T-C p.Leu637Leu synonymous ANKS3 1 82610 1.21051E-5 41305 0 NA
16-4747096-A-G p.Leu635Pro missense ANKS3 1 82568 1.21112E-5 41284 0 NA
16-4747099-G-A p.Ala634Val missense ANKS3 3 82544 3.63443E-5 41272 0 8.7434E-6
16-4747101-T-C p.Gln633Gln synonymous ANKS3 2 82516 2.42377E-5 41258 0 3.18857E-5
16-4747105-C-T p.Gly632Glu missense+splice_region ANKS3 2 82464 2.4253E-5 41232 0 8.80297E-6
16-4747111-G-A c.1895-6C>T splice_region ANKS3 2 82402 2.42713E-5 41201 0 8.86273E-6
16-4747112-A-AATG c.1895-8_1895-7insCAT splice_region ANKS3 1 82376 1.21395E-5 41188 0 NA
16-4747327-G-T c.1894+7C>A splice_region ANKS3 4 82520 4.84731E-5 41260 0 1.02157E-4
16-4747334-C-T p.Gly632Arg missense+splice_region ANKS3 1 82516 1.21189E-5 41258 0 4.09843E-6
16-4747337-T-G p.Met631Leu missense ANKS3 5 82506 6.06017E-5 41253 0 1.69374E-5
16-4747337-T-C p.Met631Val missense ANKS3 6 82506 7.2722E-5 41253 0 9.56572E-5
16-4747339-T-C p.Glu630Gly missense ANKS3 1 82512 1.21194E-5 41256 0 0.00125
16-4747343-G-A p.Arg629Cys missense ANKS3 64 82502 7.75739E-4 41251 0 0.00188066
16-4747343-G-T p.Arg629Ser missense ANKS3 1 82504 1.21206E-5 41252 0 NA
16-4747348-C-T p.Arg627His missense ANKS3 2 82506 2.42407E-5 41253 0 9.5584E-5
16-4747349-G-A p.Arg627Cys missense ANKS3 2 82510 2.42395E-5 41255 0 6.25E-4
16-4747349-G-C p.Arg627Gly missense ANKS3 1 82510 1.21197E-5 41255 0 4.03871E-6
16-4747352-C-A p.Asp626Tyr missense ANKS3 1 82500 1.21212E-5 41250 0 NA
16-4747352-C-T p.Asp626Asn missense ANKS3 1 82500 1.21212E-5 41250 0 NA
16-4747359-G-A p.Ala623Ala synonymous ANKS3 3 82492 3.63672E-5 41246 0 5.03525E-4
16-4747365-C-T p.Ser621Ser synonymous ANKS3 2 82470 2.42512E-5 41235 0 9.56084E-5
16-4747366-G-A p.Ser621Leu missense ANKS3 1 82468 1.21259E-5 41234 0 3.35954E-5
16-4747368-G-A p.Leu620Leu synonymous ANKS3 1 82470 1.21256E-5 41235 0 4.02071E-6
16-4747373-CG-C p.Glu619fs frameshift ANKS3 13 82432 1.57706E-4 41216 0 4.02327E-6
16-4747373-C-T p.Glu619Lys missense ANKS3 6 82436 7.27837E-5 41218 0 5.03525E-4
16-4747373-C-G p.Glu619Gln missense ANKS3 1 82436 1.21306E-5 41218 0 8.40025E-6
16-4747374-G-A p.Pro618Pro synonymous ANKS3 5 82440 6.06502E-5 41220 0 8.04551E-6
16-4747374-G-C p.Pro618Pro synonymous ANKS3 1 82440 1.213E-5 41220 0 NA
16-4747375-G-C p.Pro618Arg missense ANKS3 2 82454 2.42559E-5 41227 0 1.76296E-4
16-4747380-G-A p.Ser616Ser synonymous ANKS3 2 82428 2.42636E-5 41214 0 8.39447E-6
16-4747387-G-A p.Ala614Val missense ANKS3 1 82404 1.21353E-5 41202 0 NA
16-4747392-C-G p.Leu612Leu synonymous ANKS3 3 82380 3.64166E-5 41190 0 NA
16-4747396-G-A p.Ser611Phe missense ANKS3 1 82350 1.21433E-5 41175 0 NA
16-4747398-C-T p.Ala610Ala synonymous ANKS3 2 82312 2.42978E-5 41156 0 2.83775E-5
16-4747399-G-A p.Ala610Val missense ANKS3 1 82304 1.21501E-5 41152 0 6.49187E-5
16-4747405-C-CA p.Trp608fs frameshift ANKS3 2 82298 2.43019E-5 41149 0 NA
16-4747406-A-T p.Trp608Arg missense ANKS3 1 82294 1.21516E-5 41147 0 NA
16-4747407-G-A p.Gly607Gly synonymous ANKS3 437 82254 0.00531281 41127 3 0.010625
16-4747414-G-C p.Ser605Cys missense ANKS3 1 82184 1.21678E-5 41092 0 4.09823E-6
16-4747420-G-C c.1811-3C>G splice_region ANKS3 1 82096 1.21809E-5 41048 0 NA
16-4747970-GC-AA c.1810+7_1810+8delGCinsTT splice_region ANKS3 31 80996 3.82735E-4 40498 0 NA
16-4747970-G-A c.1810+8C>T splice_region ANKS3 3 80996 3.70389E-5 40498 0 0.00124299
16-4747971-C-A c.1810+7G>T splice_region ANKS3 1 81018 1.23429E-5 40509 0 0.00124307
16-4747974-T-C c.1810+4A>G splice_region ANKS3 1 81064 1.23359E-5 40532 0 4.63156E-5
16-4747980-G-A p.Ala603Val missense+splice_region ANKS3 1 81172 1.23195E-5 40586 0 4.62043E-6
16-4747982-T-TG p.Ala603fs frameshift ANKS3 1 81182 1.2318E-5 40591 0 NA
16-4747982-T-G p.Pro602Pro synonymous ANKS3 2 81182 2.4636E-5 40591 0 4.00048E-5
16-4747983-G-A p.Pro602Leu missense ANKS3 4 81262 4.92235E-5 40631 0 2.35544E-4
16-4747984-G-A p.Pro602Ser missense ANKS3 1 81282 1.23028E-5 40641 0 NA
16-4747988-G-T p.Val600Val synonymous ANKS3 1 81276 1.23038E-5 40638 0 NA
16-4747990-C-T p.Val600Ile missense ANKS3 11 81244 1.35395E-4 40622 1 0.00253807
16-4747992-G-A p.Ala599Val missense ANKS3 2 81262 2.46117E-5 40631 0 3.18776E-5
16-4748002-G-A p.Leu596Leu synonymous ANKS3 2 81372 2.45785E-5 40686 0 1.71343E-5
16-4748002-G-C p.Leu596Val missense ANKS3 1 81372 1.22892E-5 40686 0 NA
16-4748005-T-C p.Thr595Ala missense ANKS3 1 81308 1.22989E-5 40654 0 NA
16-4748011-C-T p.Ala593Thr missense ANKS3 1766 81142 0.0217643 40571 98 0.0433508
16-4748015-AG-A p.Pro591fs frameshift ANKS3 1 81244 1.23086E-5 40622 0 2.7894E-5
16-4748016-G-C p.Pro591Arg missense ANKS3 1 81320 1.22971E-5 40660 0 NA
16-4748019-G-A p.Pro590Leu missense ANKS3 4 81308 4.91957E-5 40654 0 1.67935E-5
16-4748019-G-C p.Pro590Arg missense ANKS3 4 81308 4.91957E-5 40654 0 2.70944E-5
16-4748020-G-T p.Pro590Thr missense ANKS3 1 81274 1.23041E-5 40637 0 1.3519E-5
16-4748024-G-C p.Asp588Glu missense ANKS3 3 81206 3.69431E-5 40603 0 NA
16-4748033-C-G p.Val585Val synonymous ANKS3 534 81280 0.00656988 40640 11 0.0150395
16-4748033-CAC-GAG p.Val585Leu missense ANKS3 1 81304 1.22995E-5 40652 0 NA
16-4748035-C-G p.Val585Leu missense ANKS3 1 81256 1.23068E-5 40628 0 NA
16-4748037-C-T p.Arg584Gln missense ANKS3 3 81210 3.69413E-5 40605 0 5.18162E-5
16-4748038-G-T p.Arg584Arg synonymous ANKS3 1 81180 1.23183E-5 40590 0 4.66128E-4
16-4748038-G-A p.Arg584* stop_gained ANKS3 2 81180 2.46366E-5 40590 0 2.5896E-5
16-4748043-G-A p.Ser582Leu missense ANKS3 65 81192 8.00571E-4 40596 0 0.00102108
16-4748047-G-A p.Leu581Leu synonymous ANKS3 4 81090 4.93279E-5 40545 0 1.27486E-4
16-4748050-C-T p.Glu580Lys missense ANKS3 1 81082 1.23332E-5 40541 0 2.72769E-5
16-4748054-T-A p.Gln578His missense ANKS3 1 80976 1.23493E-5 40488 0 4.1965E-6
16-4748058-C-T p.Cys577Tyr missense ANKS3 1 80852 1.23683E-5 40426 0 8.72524E-5
16-4748059-A-T p.Cys577Ser missense ANKS3 1 80816 1.23738E-5 40408 0 NA
16-4748063-T-TCGCAG c.1725-1_1725insCTGCG splice_acceptor ANKS3 5 80704 6.19548E-5 40352 0 NA
16-4748070-G-A c.1725-7C>T splice_region ANKS3 1 80456 1.24292E-5 40228 0 4.42005E-6
16-4748144-G-A n.853C>T splice_region ANKS3 13 75658 1.71826E-4 37829 0 6.25782E-4
16-4748424-TCAC-T c.1724+1_1724+3delGTG splice_donor ANKS3 1 51648 1.93618E-5 25824 0 NA
16-4748444-C-T p.Val570Ile missense ANKS3 2 53356 3.74841E-5 26678 0 2.6617E-4
16-4748445-G-A p.Leu569Leu synonymous ANKS3 5 53736 9.30475E-5 26868 0 0.00206186
16-4748452-G-C p.Ala567Gly missense ANKS3 1 54584 1.83204E-5 27292 0 1.1655E-4
16-4748457-C-G p.Arg565Arg synonymous ANKS3 7 55078 1.27092E-4 27539 0 0.00160668
16-4748458-C-T p.Arg565Gln missense ANKS3 45 55010 8.18033E-4 27505 0 0.00565635
16-4748459-G-C p.Arg565Gly missense ANKS3 2 55024 3.63478E-5 27512 0 1.39895E-5
16-4748468-C-T p.Ala562Thr missense ANKS3 1 56260 1.77746E-5 28130 0 NA
16-4748472-C-G p.Thr560Thr synonymous ANKS3 1 57178 1.74892E-5 28589 0 NA
16-4748472-C-A p.Thr560Thr synonymous ANKS3 4 57178 6.9957E-5 28589 0 3.18735E-5
16-4748473-G-A p.Thr560Met missense ANKS3 7 57360 1.22036E-4 28680 0 7.89391E-5
16-4748480-G-A p.Arg558Trp missense ANKS3 1 58482 1.70993E-5 29241 0 7.18288E-5
16-4748483-G-A p.Leu557Leu synonymous ANKS3 4 59398 6.73423E-5 29699 0 1.97634E-5
16-4748485-C-T p.Arg556Gln missense ANKS3 6 59770 1.00385E-4 29885 0 1.2747E-4
16-4748486-G-A p.Arg556Trp missense ANKS3 1 59730 1.6742E-5 29865 0 0.00154799
16-4748492-G-A p.Gln554* stop_gained ANKS3 1 61242 1.63287E-5 30621 0 NA
16-4748493-G-A p.Leu553Leu synonymous ANKS3 1 61330 1.63052E-5 30665 0 NA
16-4748496-G-T p.Asp552Glu missense ANKS3 1 61610 1.62311E-5 30805 0 1.27296E-5
16-4748501-C-T p.Glu551Lys missense ANKS3 8 62418 1.28168E-4 31209 0 1.27543E-4
16-4748502-G-T p.Arg550Arg synonymous ANKS3 1 62584 1.59785E-5 31292 0 NA
16-4748504-G-A p.Arg550Cys missense ANKS3 22 63422 3.46883E-4 31711 0 4.0449E-4
16-4748504-G-C p.Arg550Gly missense ANKS3 2 63422 3.15348E-5 31711 0 NA
16-4748507-C-T p.Ala549Thr missense ANKS3 4 63840 6.26566E-5 31920 0 2.92683E-4
16-4748507-C-G p.Ala549Pro missense ANKS3 1 63840 1.56642E-5 31920 0 NA
16-4748509-C-T p.Arg548His missense ANKS3 3 64866 4.62492E-5 32433 0 9.56633E-5
16-4748510-G-A p.Arg548Cys missense ANKS3 3 65458 4.58309E-5 32729 0 0.00205128
16-4748516-G-C p.Gln546Glu missense ANKS3 2 67452 2.96507E-5 33726 0 NA
16-4748519-C-G p.Glu545Gln missense ANKS3 1 68104 1.46834E-5 34052 0 NA
16-4748522-GCAGGCAGCTCTCCACCA-G p.Val538fs frameshift ANKS3 1 68432 1.4613E-5 34216 0 NA
16-4748527-C-A p.Cys542Phe missense ANKS3 1 69002 1.44923E-5 34501 0 NA
16-4748535-C-T p.Val539Val synonymous ANKS3 2 70786 2.82542E-5 35393 0 NA
16-4748537-C-A p.Val539Leu missense ANKS3 1 71076 1.40694E-5 35538 0 NA
16-4748540-C-T p.Val538Met missense ANKS3 1 71482 1.39895E-5 35741 0 3.06354E-5
16-4748540-C-A p.Val538Leu missense ANKS3 1 71482 1.39895E-5 35741 0 NA
16-4748541-G-A p.Ala537Ala synonymous ANKS3 1 71424 1.40009E-5 35712 0 1.914E-4
16-4748541-G-C p.Ala537Ala synonymous ANKS3 1 71422 1.40013E-5 35711 0 3.00409E-5
16-4748543-C-T p.Ala537Thr missense ANKS3 1 71768 1.39338E-5 35884 0 1.17151E-4
16-4748544-G-A p.Arg536Arg synonymous ANKS3 5 71974 6.94695E-5 35987 0 2.85274E-4
16-4748545-C-A p.Arg536Leu missense ANKS3 2 72292 2.76656E-5 36146 0 NA
16-4748545-C-T p.Arg536His missense ANKS3 1 72292 1.38328E-5 36146 0 5.04449E-6
16-4748547-C-A p.Leu535Leu synonymous ANKS3 2 72866 2.74476E-5 36433 0 9.98004E-6
16-4748561-G-C p.Gln531Glu missense ANKS3 2 74742 2.67587E-5 37371 0 3.18878E-5
16-4748569-T-C p.Gln528Arg missense ANKS3 5 75216 6.64752E-5 37608 0 3.19591E-5
16-4748573-C-A p.Gly527Cys missense ANKS3 2 75376 2.65336E-5 37688 0 3.18878E-5
16-4748574-C-T p.Arg526Arg synonymous ANKS3 1 75450 1.32538E-5 37725 0 NA
16-4748574-C-A p.Arg526Arg synonymous ANKS3 2 75450 2.65076E-5 37725 0 NA
16-4748575-C-T p.Arg526Gln missense ANKS3 23 75358 3.0521E-4 37679 0 8.93256E-4
16-4748577-C-T p.Thr525Thr synonymous ANKS3 1 75468 1.32506E-5 37734 0 NA
16-4748578-G-A p.Thr525Met missense ANKS3 16 75582 2.11691E-4 37791 0 0.00314465
16-4748580-G-A p.Ala524Ala synonymous ANKS3 2 75832 2.63741E-5 37916 0 1.00674E-5
16-4748589-C-T p.Glu521Glu synonymous ANKS3 6 75966 7.89827E-5 37983 0 7.35835E-5
16-4748594-C-G p.Glu520Gln missense ANKS3 1 75776 1.31968E-5 37888 0 3.19061E-5
16-4748594-C-T p.Glu520Lys missense ANKS3 2 75776 2.63936E-5 37888 0 7.19011E-5
16-4748596-C-A p.Cys519Phe missense ANKS3 1 75754 1.32006E-5 37877 0 NA
16-4748599-C-T p.Arg518His missense+splice_region ANKS3 6 75656 7.93063E-5 37828 0 1.02013E-4
16-4748600-G-A p.Arg518Cys missense+splice_region ANKS3 6 75634 7.93294E-5 37817 0 1.27584E-4
16-4748602-T-G c.1552-2A>C splice_acceptor ANKS3 1 75862 1.31818E-5 37931 0 NA
16-4748605-A-AG c.1552-6_1552-5insC splice_region ANKS3 1 75738 1.32034E-5 37869 0 1.6298E-5
16-4748605-AG-A c.1552-6delC splice_region ANKS3 2 75738 2.64068E-5 37869 0 6.38651E-5
16-4748606-G-C c.1552-6C>G splice_region ANKS3 1 75766 1.31985E-5 37883 0 4.69689E-5
16-4748606-G-T c.1552-6C>A splice_region ANKS3 1 75766 1.31985E-5 37883 0 3.18715E-5
16-4748607-G-T c.1552-7C>A splice_region ANKS3 8 75768 1.05585E-4 37884 0 1.23499E-4
16-4748607-G-C c.1552-7C>G splice_region ANKS3 2 75770 2.63957E-5 37885 0 NA
16-4748795-A-T c.1551+6T>A splice_region ANKS3 1 81130 1.23259E-5 40565 0 4.20203E-6
16-4748798-C-T c.1551+3G>A splice_region ANKS3 22 81208 2.70909E-4 40604 0 5.09846E-4
16-4748802-T-C p.Lys517Arg missense+splice_region ANKS3 45 81332 5.53288E-4 40666 0 2.90893E-4
16-4748803-T-G p.Lys517Gln missense+splice_region ANKS3 1 81334 1.2295E-5 40667 0 8.9463E-6
16-4748807-C-T p.Leu515Leu synonymous ANKS3 3 81364 3.68713E-5 40682 0 1.78696E-5
16-4748816-G-A p.Ala512Ala synonymous ANKS3 9 81550 1.10362E-4 40775 0 1.59347E-4
16-4748817-G-A p.Ala512Val missense ANKS3 2 81484 2.45447E-5 40742 0 8.89237E-6
16-4748819-G-A p.Leu511Leu synonymous ANKS3 10 81594 1.22558E-4 40797 0 5.35619E-5
16-4748823-TCC-CCT p.GlnGlu509GlnGly missense ANKS3 1 81724 1.22363E-5 40862 0 NA
16-4748825-C-T p.Gln509Gln synonymous ANKS3 34307 80798 0.424602 40399 7488 0.530625
16-4748831-C-T p.Glu507Glu synonymous ANKS3 4 81942 4.8815E-5 40971 0 2.17318E-4
16-4748834-A-G p.Ala506Ala synonymous ANKS3 4 81996 4.87829E-5 40998 0 6.37755E-5
16-4748845-G-A p.Arg503Trp missense ANKS3 7 82242 8.51147E-5 41121 0 1.59266E-4
16-4748846-G-A p.Asp502Asp synonymous ANKS3 2 82284 2.43061E-5 41142 0 8.72159E-6
16-4748848-C-A p.Asp502Tyr missense ANKS3 4 82310 4.85968E-5 41155 0 1.74541E-5
16-4748848-C-T p.Asp502Asn missense ANKS3 4 82310 4.85968E-5 41155 0 9.55597E-5
16-4748849-G-A p.Ala501Ala synonymous ANKS3 14 82314 1.7008E-4 41157 0 7.6477E-4
16-4748849-G-T p.Ala501Ala synonymous ANKS3 5 82314 6.0743E-5 41157 0 9.55962E-5
16-4748851-C-T p.Ala501Thr missense ANKS3 17 82348 2.06441E-4 41174 0 9.34906E-4
16-4748851-C-A p.Ala501Ser missense ANKS3 4 82348 4.85743E-5 41174 0 3.6988E-5
16-4748852-G-A p.Tyr500Tyr synonymous ANKS3 1 82356 1.21424E-5 41178 0 1.74654E-5
16-4748860-G-A p.Leu498Leu synonymous ANKS3 10 82418 1.21333E-4 41209 0 1.7503E-4
16-4748865-A-G p.Leu496Pro missense ANKS3 3 82492 3.63672E-5 41246 0 NA
16-4748868-G-A p.Ala495Val missense ANKS3 1 82476 1.21247E-5 41238 0 NA
16-4748875-C-T p.Gly493Arg missense ANKS3 5 82530 6.0584E-5 41265 0 4.39638E-5
16-4748876-G-A p.Pro492Pro synonymous ANKS3 4 82520 4.84731E-5 41260 0 6.37064E-5
16-4748880-G-A p.Pro491Leu missense ANKS3 1 82530 1.21168E-5 41265 0 NA
16-4748883-C-A p.Arg490Leu missense ANKS3 1 82548 1.21142E-5 41274 0 NA
16-4748884-G-A p.Arg490Cys missense ANKS3 3 82576 3.63302E-5 41288 0 8.78287E-6
16-4748887-CACTGCTGTGCCAGCGGGCAATGGCGGACGTCATCTTCCTCTTGGGCCCAA-C p.Phe472fs frameshift ANKS3 1 82584 1.21089E-5 41292 0 NA
16-4748891-G-A p.Ser487Ser synonymous ANKS3 3 82632 3.63055E-5 41316 0 NA
16-4748894-G-T p.His486Gln missense ANKS3 1 82680 1.20948E-5 41340 0 NA
16-4748896-G-A p.His486Tyr missense ANKS3 1 82676 1.20954E-5 41338 0 3.18593E-5
16-4748898-C-G p.Trp485Ser missense ANKS3 1 82674 1.20957E-5 41337 0 NA
16-4748900-G-A p.Arg484Arg synonymous ANKS3 1 82688 1.20937E-5 41344 0 3.18512E-5
16-4748911-C-T p.Ala481Thr missense ANKS3 1 82654 1.20986E-5 41327 0 NA
16-4748912-G-A p.Ser480Ser synonymous ANKS3 3 82680 3.62845E-5 41340 0 9.55536E-5
16-4748914-A-T p.Ser480Thr missense ANKS3 1 82580 1.21095E-5 41290 0 NA
16-4748916-G-A p.Thr479Met missense ANKS3 1 82624 1.2103E-5 41312 0 4.15842E-5
16-4748917-T-A p.Thr479Ser missense ANKS3 1 82616 1.21042E-5 41308 0 NA
16-4748941-GCCTGCGGGGGGAATGTGACCAGGATATGCCTCAGCGTCCCAAGAGCGCTTACATGAGTGGGAGTTTGCCCCAACCCCGGGCTGAGGGCCAGAGCGGCCCTTCTGGACGCA-G p.Leu471fs frameshift ANKS3 5 82710 6.04522E-5 41355 0 NA
16-4748941-G-A p.Leu471Leu splice_region+synonymous ANKS3 1 82714 1.20899E-5 41357 0 NA
16-4748946-C-T c.1410-4G>A splice_region ANKS3 4 82652 4.83957E-5 41326 0 6.37105E-5
16-4748947-G-A c.1410-5C>T splice_region ANKS3 2 82684 2.41885E-5 41342 0 2.59202E-5
16-4748948-G-T c.1410-6C>A splice_region ANKS3 1 82712 1.20901E-5 41356 0 3.18431E-5
16-4748948-G-A c.1410-6C>T splice_region ANKS3 1 82712 1.20901E-5 41356 0 3.18431E-5
16-4749048-C-T c.1409+5G>A splice_region ANKS3 1 83120 1.20308E-5 41560 0 3.54721E-4
16-4749052-C-T c.1409+1G>A splice_donor ANKS3 1 83150 1.20265E-5 41575 0 1.65003E-5
16-4749053-G-A p.Thr470Met missense+splice_region ANKS3 2 83172 2.40466E-5 41586 0 3.18471E-5
16-4749076-G-A p.Ser462Ser synonymous ANKS3 98 83170 0.00117831 41585 0 0.00245207
16-4749076-G-C p.Ser462Arg missense ANKS3 1 83172 1.20233E-5 41586 0 8.25341E-6
16-4749076-G-T p.Ser462Arg missense ANKS3 1 83172 1.20233E-5 41586 0 3.9782E-6
16-4749097-G-C p.Ile455Met missense ANKS3 1 83086 1.20357E-5 41543 0 8.26214E-6
16-4749101-C-G p.Arg454Pro missense ANKS3 1 83034 1.20433E-5 41517 0 8.26692E-6
16-4749106-G-A p.Asp452Asp synonymous ANKS3 1 83002 1.20479E-5 41501 0 8.26925E-6
16-4749111-C-T p.Val451Met missense ANKS3 1 82982 1.20508E-5 41491 0 3.18512E-5
16-4749112-G-A p.Asp450Asp synonymous ANKS3 3 82978 3.61542E-5 41489 0 3.1836E-5
16-4749112-G-C p.Asp450Glu missense ANKS3 2 82978 2.41028E-5 41489 0 5.04032E-4
16-4749124-A-G p.Phe446Phe synonymous ANKS3 56 82914 6.75399E-4 41457 1 0.00191205
16-4749127-C-T p.Val445Val synonymous ANKS3 2 82922 2.41191E-5 41461 0 1.19447E-5
16-4749129-C-G p.Val445Leu missense ANKS3 1 82906 1.20619E-5 41453 0 NA
16-4749130-C-G p.Gln444His missense ANKS3 1 82908 1.20616E-5 41454 0 8.31891E-6
16-4749131-T-G p.Gln444Pro missense ANKS3 8 82884 9.65204E-5 41442 0 0.00151057
16-4749132-G-C p.Gln444Glu missense ANKS3 2 82894 2.41272E-5 41447 0 NA
16-4749135-G-A p.Leu443Leu synonymous ANKS3 3 82880 3.61969E-5 41440 0 3.33356E-5
16-4749136-G-A p.Tyr442Tyr synonymous ANKS3 1 82872 1.20668E-5 41436 0 9.55292E-5
16-4749150-C-T p.Gly438Arg missense ANKS3 1 82638 1.2101E-5 41319 0 NA
16-4749151-G-A p.Ile437Ile synonymous ANKS3 3 82634 3.63047E-5 41317 0 2.52542E-5
16-4749165-G-T p.Leu433Met missense ANKS3 2 82306 2.42996E-5 41153 0 NA
16-4749168-C-T p.Ala432Thr missense ANKS3 4 82200 4.86618E-5 41100 0 3.18492E-5
16-4749169-G-A p.Ala431Ala synonymous ANKS3 1 82184 1.21678E-5 41092 0 4.79337E-5
16-4749172-A-T p.Leu430Leu synonymous ANKS3 2 82104 2.43593E-5 41052 0 NA
16-4749183-A-T c.1285-6T>A splice_region ANKS3 1 81712 1.22381E-5 40856 0 NA
16-4750723-G-A p.Pro305Leu missense ANKS3 1 61490 1.62628E-5 30745 0 6.36943E-5
16-4750723-G-C p.Pro305Arg missense ANKS3 1 61490 1.62628E-5 30745 0 NA
16-4750726-CA-C p.Trp304fs frameshift ANKS3 1 61906 1.61535E-5 30953 0 1.00361E-4
16-4750731-C-G p.Trp302Cys missense ANKS3 1 62386 1.60292E-5 31193 0 3.18451E-5
16-4750734-G-A p.Tyr301Tyr synonymous ANKS3 12 62718 1.91333E-4 31359 0 0.00164843
16-4750739-G-T p.Pro300Thr missense ANKS3 4 63364 6.31273E-5 31682 0 3.1837E-5
16-4750755-G-C p.Asp294Glu missense ANKS3 2 65776 3.04062E-5 32888 0 NA
16-4750759-T-C p.Lys293Arg missense ANKS3 6 66438 9.03098E-5 33219 0 2.82853E-4
16-4750761-T-C p.Gly292Gly synonymous ANKS3 1 66558 1.50245E-5 33279 0 9.95015E-6
16-4750761-TC-T p.Gly292fs frameshift ANKS3 2 66558 3.0049E-5 33279 0 NA
16-4750764-G-T p.His291Gln missense ANKS3 1 67068 1.49102E-5 33534 0 NA
16-4750764-G-A p.His291His synonymous ANKS3 1 67068 1.49102E-5 33534 0 9.20133E-5
16-4750765-T-A p.His291Leu missense ANKS3 1 67466 1.48223E-5 33733 0 NA
16-4750769-G-A p.Leu290Phe missense ANKS3 1 68400 1.46199E-5 34200 0 1.88829E-5
16-4750784-A-G p.Phe285Leu missense ANKS3 1 70760 1.41323E-5 35380 0 4.49402E-6
16-4750786-C-T p.Arg284His missense ANKS3 1 70876 1.41091E-5 35438 0 1.01675E-4
16-4750787-G-A p.Arg284Cys missense ANKS3 16 71044 2.25213E-4 35522 0 3.18451E-4
16-4750792-A-G p.Leu282Pro missense ANKS3 1 71966 1.38955E-5 35983 0 NA
16-4750795-G-A p.Pro281Leu missense ANKS3 2 72428 2.76136E-5 36214 0 3.0854E-5
16-4750798-G-A p.Ala280Val missense ANKS3 18 72790 2.47287E-4 36395 0 1.19942E-4
16-4750803-C-T p.Leu278Leu synonymous ANKS3 2 73398 2.72487E-5 36699 0 NA
16-4750807-C-T p.Trp277* stop_gained ANKS3 3 73798 4.06515E-5 36899 0 4.34832E-6
16-4750811-G-C p.Pro276Ala missense ANKS3 1 74090 1.34971E-5 37045 0 NA
16-4750815-C-T p.Pro274Pro synonymous ANKS3 5 74372 6.72296E-5 37186 0 5.19274E-5
16-4750816-G-A p.Pro274Leu missense ANKS3 7 74532 9.39194E-5 37266 0 3.18573E-5
16-4750819-T-A p.Gln273Leu missense ANKS3 1 74988 1.33355E-5 37494 0 9.10647E-6
16-4750824-G-C p.Gly271Gly synonymous ANKS3 6 75482 7.94892E-5 37741 0 1.59226E-4
16-4750824-G-A p.Gly271Gly synonymous ANKS3 1 75482 1.32482E-5 37741 0 NA
16-4750831-G-A p.Ser269Phe missense ANKS3 1 76124 1.31365E-5 38062 0 NA
16-4750841-G-A p.Leu266Leu synonymous ANKS3 1621 77074 0.0210317 38537 19 0.043125
16-4750841-G-C p.Leu266Val missense ANKS3 2 77146 2.59249E-5 38573 0 8.76363E-6
16-4750849-G-C p.Pro263Arg missense ANKS3 1225 77808 0.0157439 38904 10 0.0174304
16-4750849-G-A p.Pro263Leu missense ANKS3 2 77868 2.56845E-5 38934 0 NA
16-4750854-C-T p.Trp261* stop_gained ANKS3 1 78144 1.27969E-5 39072 0 1.27137E-5
16-4750858-C-T p.Arg260Gln missense ANKS3 1 78734 1.2701E-5 39367 0 2.11354E-5
16-4750860-C-T p.Trp259* stop_gained ANKS3 1 78984 1.26608E-5 39492 0 NA
16-4750860-C-G p.Trp259Cys missense ANKS3 1 78984 1.26608E-5 39492 0 1.05485E-4
16-4750861-C-T p.Trp259* stop_gained ANKS3 1 79264 1.26161E-5 39632 0 NA
16-4750868-T-C p.Thr257Ala missense ANKS3 1 79840 1.2525E-5 39920 0 NA
16-4750869-TCTC-T p.Arg256del disruptive_inframe_deletion ANKS3 62 79862 7.76339E-4 39931 0 0.00229797
16-4750880-C-T p.Ala253Thr missense ANKS3 1 80622 1.24036E-5 40311 0 3.18634E-5
16-4750889-C-T p.Val250Met missense ANKS3 2 81246 2.46166E-5 40623 0 1.27421E-4
16-4750890-G-A p.Asp249Asp synonymous ANKS3 5 81372 6.14462E-5 40686 0 5.90897E-5
16-4750890-G-C p.Asp249Glu missense ANKS3 1 81374 1.22889E-5 40687 0 NA
16-4750893-A-G p.Tyr248Tyr synonymous ANKS3 1 81684 1.22423E-5 40842 0 8.42815E-6
16-4750897-A-G p.Val247Ala missense ANKS3 2 81828 2.44415E-5 40914 0 3.18756E-5
16-4750904-A-G p.Cys245Arg missense ANKS3 3 82092 3.65444E-5 41046 0 4.07465E-6
16-4750906-A-G p.Met244Thr missense ANKS3 1 82160 1.21714E-5 41080 0 6.25E-4
16-4750914-T-TAAGTCACAAAAAGTGCC p.Gly242fs frameshift ANKS3 2 82334 2.42913E-5 41167 0 NA
16-4750921-C-A p.Cys239Phe missense ANKS3 2 82380 2.42777E-5 41190 0 5.64963E-5
16-4750923-A-G p.Phe238Phe synonymous ANKS3 2 82426 2.42642E-5 41213 0 NA
16-4750928-T-G p.Thr237Pro missense ANKS3 1 82438 1.21303E-5 41219 0 8.33333E-6
16-4750931-C-T p.Gly236Ser missense ANKS3 1 82524 1.21177E-5 41262 0 6.25E-4
16-4750932-G-A p.Asp235Asp synonymous ANKS3 1 82596 1.21071E-5 41298 0 6.25E-4
16-4750943-T-C p.Thr232Ala missense ANKS3 1 82646 1.20998E-5 41323 0 NA
16-4750946-C-A p.Val231Phe missense ANKS3 2 82614 2.4209E-5 41307 0 1.19993E-5
16-4750947-C-G p.Glu230Asp missense ANKS3 2 82634 2.42031E-5 41317 0 NA
16-4750949-C-G p.Glu230Gln missense ANKS3 11 82626 1.3313E-4 41313 0 0.00125
16-4750963-G-A p.Pro225Leu missense ANKS3 1 82600 1.21065E-5 41300 0 1.31718E-4
16-4750965-T-G p.Arg224Ser missense ANKS3 1 82620 1.21036E-5 41310 0 3.31055E-5
16-4750979-C-T p.Gly426Arg missense ANKS3 1 82582 1.21092E-5 41291 0 NA
16-4750986-G-A p.Pro423Pro synonymous ANKS3 53 82514 6.42315E-4 41257 0 4.14013E-4
16-4751000-T-C p.Thr419Ala missense ANKS3 1 82456 1.21277E-5 41228 0 NA
16-4751004-G-A p.Pro417Pro synonymous ANKS3 1339 82396 0.0162508 41198 21 0.0174852
16-4751010-G-A p.Ser415Ser synonymous ANKS3 13 82470 1.57633E-4 41235 0 2.86624E-4
16-4751011-G-A p.Ser415Phe missense ANKS3 2 82474 2.42501E-5 41237 0 2.47451E-5
16-4751011-G-T p.Ser415Tyr missense ANKS3 1 82474 1.2125E-5 41237 0 3.18431E-5
16-4751013-C-T p.Glu414Glu synonymous ANKS3 139 82472 0.00168542 41236 1 0.00391695
16-4751017-G-T p.Ala413Asp missense ANKS3 1 82454 1.2128E-5 41227 0 NA
16-4751018-C-T p.Ala413Thr missense ANKS3 1 82444 1.21294E-5 41222 0 NA
16-4751019-G-A p.Leu412Leu synonymous ANKS3 2 82484 2.42471E-5 41242 0 5.03525E-4
16-4751021-G-A p.Leu412Phe missense ANKS3 2 82498 2.4243E-5 41249 0 NA
16-4751023-A-G p.Phe411Ser missense ANKS3 17 82500 2.06061E-4 41250 0 1.73179E-4
16-4751025-G-A p.Gly410Gly synonymous ANKS3 313 82472 0.00379523 41236 1 0.006875
16-4751026-C-G p.Gly410Ala missense ANKS3 2 82508 2.42401E-5 41254 0 NA
16-4751035-T-C p.Asp407Gly missense ANKS3 150 82544 0.00181721 41272 1 0.00391845
16-4751038-G-A p.Thr406Ile missense ANKS3 12 82582 1.4531E-4 41291 0 2.4739E-5
16-4751044-GC-CT p.Ala404Ser missense ANKS3 3 82564 3.63354E-5 41282 0 NA
16-4751044-G-C p.Ala404Gly missense ANKS3 2 82562 2.42242E-5 41281 0 1.19315E-5
16-4751045-C-T p.Ala404Thr missense ANKS3 42259 80794 0.523046 40397 11151 0.5775
16-4751045-CGC-TGT p.ArgAla403HisThr missense ANKS3 2 82548 2.42283E-5 41274 0 NA
16-4751046-G-A p.Arg403Arg synonymous ANKS3 1 82528 1.21171E-5 41264 0 3.30109E-5
16-4751047-C-T p.Arg403His missense ANKS3 29 82468 3.51652E-4 41234 0 0.00100705
16-4751050-G-A p.Pro402Leu missense ANKS3 1 82502 1.21209E-5 41251 0 NA
16-4751052-A-G c.*232T>C splice_region ANKS3 1 82458 1.21274E-5 41229 0 NA
16-4751058-C-G p.Gln399His missense ANKS3 1 82422 1.21327E-5 41211 0 3.18776E-5
16-4751060-G-A p.Gln399* stop_gained ANKS3 1 82388 1.21377E-5 41194 0 NA
16-4751061-G-A p.Ser398Ser synonymous ANKS3 1 82380 1.21389E-5 41190 0 2.47688E-5
16-4751066-C-G p.Asp397His missense ANKS3 1 82348 1.21436E-5 41174 0 6.37105E-5
16-4751083-A-G p.Met391Thr missense ANKS3 1 82058 1.21865E-5 41029 0 NA
16-4751084-T-C p.Met391Val missense ANKS3 1 82036 1.21898E-5 41018 0 NA
16-4751090-T-C p.Ser389Gly missense ANKS3 1 81874 1.22139E-5 40937 0 NA
16-4751103-G-A p.Arg384Arg synonymous ANKS3 3 81182 3.6954E-5 40591 0 9.5584E-5
16-4751104-C-T p.Arg384His missense ANKS3 1 81066 1.23356E-5 40533 0 NA
16-4751105-G-A p.Arg384Cys missense ANKS3 5 80994 6.1733E-5 40497 0 3.18674E-5
16-4751124-A-G p.His377His synonymous ANKS3 607 78876 0.00769562 39438 21 0.0180324
16-4751125-T-C p.His377Arg missense ANKS3 1 78786 1.26926E-5 39393 0 8.30606E-6
16-4751130-C-T p.Ser375Ser synonymous ANKS3 1 77688 1.2872E-5 38844 0 NA
16-4751131-G-A p.Ser375Leu missense ANKS3 3 77510 3.87047E-5 38755 0 0.00100705
16-4751135-C-A p.Asp374Tyr missense+splice_region ANKS3 1 76858 1.3011E-5 38429 0 NA
16-4751137-T-TCGTTGCTCTCCACAGAAGCTTCGCTGCTGAGCCCCTGG c.1120-3_1120-2insCCAGGGGCTCAGCAGCGAAGCTTCTGTGGAGAGCAACG splice_region ANKS3 2 76560 2.61233E-5 38280 1 NA
16-4751137-T-TCGTTGCTCTCCACAGAAGCTTCGCTGCTGAGCCCCTGGGCTCTG c.1120-3_1120-2insCAGAGCCCAGGGGCTCAGCAGCGAAGCTTCTGTGGAGAGCAACG splice_region ANKS3 3 76560 3.9185E-5 38280 1 NA
16-4751140-A-G c.1120-5T>C splice_region ANKS3 1 75910 1.31735E-5 37955 0 4.00048E-6
16-4751430-C-T c.1119+5G>A splice_region ANKS3 1 81654 1.22468E-5 40827 0 1.03603E-5
16-4751437-C-T p.Glu373Lys missense+splice_region ANKS3 2 81850 2.44349E-5 40925 0 6.28141E-4
16-4751438-G-A p.Asn372Asn synonymous ANKS3 5 81878 6.10665E-5 40939 0 9.55414E-5
16-4751439-T-C p.Asn372Ser missense ANKS3 7 81938 8.54304E-5 40969 0 9.55475E-5
16-4751442-C-T p.Ser371Asn missense ANKS3 1 81982 1.21978E-5 40991 0 NA
16-4751459-G-A p.Ser365Ser synonymous ANKS3 1 82160 1.21714E-5 41080 0 0.00125
16-4751465-G-A p.Leu363Leu synonymous ANKS3 1 82254 1.21575E-5 41127 0 3.18613E-5
16-4751471-C-T p.Gln361Gln synonymous ANKS3 1 82306 1.21498E-5 41153 0 4.81614E-5
16-4751474-G-A p.Ala360Ala synonymous ANKS3 2 82316 2.42966E-5 41158 0 1.14742E-4
16-4751476-C-T p.Ala360Thr missense ANKS3 1 82344 1.21442E-5 41172 0 NA
16-4751477-T-C p.Arg359Arg synonymous ANKS3 1 82336 1.21454E-5 41168 0 NA
16-4751479-TG-T p.Arg359fs frameshift ANKS3 1 82364 1.21412E-5 41182 0 NA
16-4751491-CGCT-C p.Ser354del conservative_inframe_deletion ANKS3 3 82274 3.64635E-5 41137 0 7.96742E-5
16-4751491-C-CGCT p.Ser354dup conservative_inframe_insertion ANKS3 8 82308 9.71959E-5 41154 0 1.91095E-4
16-4751491-C-G p.Glu355Gln missense ANKS3 1 82308 1.21495E-5 41154 0 NA
16-4751491-C-T p.Glu355Lys missense ANKS3 1 82308 1.21495E-5 41154 0 8.85269E-6
16-4751492-G-A p.Ser354Ser synonymous ANKS3 82 82288 9.965E-4 41144 1 0.0021674
16-4751501-G-A p.Ser351Ser synonymous ANKS3 1 82316 1.21483E-5 41158 0 NA
16-4751507-C-T p.Gln349Gln synonymous ANKS3 1 82234 1.21604E-5 41117 0 NA
16-4751512-C-T p.Val348Ile missense ANKS3 11 82146 1.33908E-4 41073 0 0.003125
16-4751512-C-G p.Val348Leu missense ANKS3 1 82146 1.21734E-5 41073 0 9.05961E-6
16-4751513-G-A p.Pro347Pro synonymous ANKS3 2 82122 2.4354E-5 41061 0 1.81577E-5
16-4751514-G-A p.Pro347Leu missense ANKS3 28 82106 3.41023E-4 41053 0 4.45236E-4
16-4751515-G-A p.Pro347Ser missense ANKS3 5 82118 6.0888E-5 41059 0 6.25E-4
16-4751516-C-G p.Gly346Gly synonymous ANKS3 1 82112 1.21785E-5 41056 0 NA
16-4751522-G-C p.Asn344Lys missense ANKS3 2 82056 2.43736E-5 41028 0 4.04263E-6
16-4751523-T-G p.Asn344Thr missense ANKS3 15 81976 1.8298E-4 40988 0 9.22748E-5
16-4751529-C-T p.Cys342Tyr missense ANKS3 1 81870 1.22145E-5 40935 0 NA
16-4751535-G-C p.Ala340Gly missense ANKS3 1 81686 1.2242E-5 40843 0 NA
16-4751536-C-T p.Ala340Thr missense ANKS3 3 81650 3.67422E-5 40825 0 3.18573E-5
16-4751539-G-A p.His339Tyr missense ANKS3 2 81516 2.45351E-5 40758 0 9.55718E-5
16-4751542-C-T p.Glu338Lys missense+splice_region ANKS3 2 81378 2.45767E-5 40689 0 1.9994E-5
16-4751545-C-CCCGACTGCTGCTGCTGCTGCTGCTCTCCACGTCCCGCTCAT c.1010-2_1010-1insATGAGCGGGACGTGGAGAGCAGCAGCAGCAGCAGCAGTCGG splice_acceptor ANKS3 1 81266 1.23053E-5 40633 0 NA
16-4751550-G-A c.1010-6C>T splice_region ANKS3 260 80986 0.00321043 40493 2 0.005625
16-4751551-G-A c.1010-7C>T splice_region ANKS3 1 80884 1.23634E-5 40442 0 4.16181E-5
16-4752099-G-A c.1009+4C>T splice_region ANKS3 5 78390 6.37836E-5 39195 0 6.37674E-5
16-4752107-ACTG-A p.Ser335del disruptive_inframe_deletion ANKS3 1326 77770 0.0170503 38885 23 0.051217
16-4752107-ACTGCTG-A p.Ser334_Ser335del disruptive_inframe_deletion ANKS3 7 78798 8.88347E-5 39399 0 3.20513E-4
16-4752107-A-ACTG p.Ser335dup disruptive_inframe_insertion ANKS3 4 78800 5.07614E-5 39400 0 1.12632E-4
16-4752111-C-T p.Ser334Asn missense ANKS3 1 79050 1.26502E-5 39525 0 3.30404E-5
16-4752128-C-T p.Arg84Lys missense ANKS3 276 79362 0.00347773 39681 2 0.00793246
16-4752128-C-G p.Glu328Asp missense ANKS3 4 79374 5.03943E-5 39687 0 1.24564E-4
16-4752134-A-G p.Met82Thr missense ANKS3 41516 77660 0.534587 38830 11188 0.568125
16-4752138-C-T p.Arg325Gln missense ANKS3 9 79522 1.13176E-4 39761 0 6.22998E-5
16-4752139-G-A p.Arg325Trp missense ANKS3 2 79494 2.51591E-5 39747 0 5.34864E-5
16-4752141-T-C p.Ter215Trpext*? stop_lost ANKS3 2 79676 2.51017E-5 39838 0 NA
16-4752144-T-A p.Asn323Ile missense ANKS3 1 79732 1.2542E-5 39866 0 4.30211E-6
16-4752145-T-TGGGGG p.Asn323fs frameshift ANKS3 1 79762 1.25373E-5 39881 0 NA
16-4752149-G-GA p.Ile322fs frameshift ANKS3 1 79820 1.25282E-5 39910 0 NA
16-4752151-G-A p.Pro321Ser missense ANKS3 3 79840 3.75752E-5 39920 0 4.33118E-6
16-4752158-G-A p.Ser74Leu missense ANKS3 19 79850 2.37946E-4 39925 0 9.27256E-4
16-4752164-C-T p.Gly72Glu missense ANKS3 1 79942 1.25091E-5 39971 0 NA
16-4752170-G-A p.Ala70Val missense ANKS3 5 79978 6.25172E-5 39989 0 3.18431E-5
16-4752173-G-A p.Ser69Phe missense ANKS3 2 80074 2.49769E-5 40037 0 2.81398E-4
16-4752174-A-G p.Leu313Pro missense ANKS3 2 80054 2.49831E-5 40027 0 8.81679E-6
16-4752174-A-C p.Leu313Arg missense ANKS3 1 80056 1.24913E-5 40028 0 4.40839E-6
16-4752175-G-A p.Leu313Phe missense ANKS3 1 80072 1.24888E-5 40036 0 3.18552E-5
16-4752177-C-T p.Gly312Asp missense ANKS3 3 79978 3.75103E-5 39989 0 1.27413E-4
16-4752195-T-C p.Asn306Ser missense ANKS3 1 79884 1.25182E-5 39942 0 NA
16-4752200-G-A p.Arg196* stop_gained ANKS3 3 79856 3.75676E-5 39928 0 6.37105E-5
16-4752204-C-A p.Ser303Ile missense ANKS3 1 79986 1.25022E-5 39993 0 NA
16-4752221-A-G p.Met53Thr missense ANKS3 2 79832 2.50526E-5 39916 0 4.55253E-6
16-4752222-T-C p.Tyr297Cys missense ANKS3 1 79790 1.25329E-5 39895 0 NA
16-4752228-C-T p.Arg295His missense ANKS3 13 79612 1.63292E-4 39806 0 1.3253E-4
16-4752231-G-C p.Pro294Arg missense ANKS3 1 79566 1.25682E-5 39783 0 NA
16-4752232-G-C p.Pro294Ala missense ANKS3 1 79566 1.25682E-5 39783 0 6.25E-4
16-4752232-G-A p.Pro294Ser missense ANKS3 1 79566 1.25682E-5 39783 0 1.25034E-5
16-4752238-C-G p.Gly183Ala missense+splice_region ANKS3 1 79460 1.25849E-5 39730 0 NA
16-4752238-C-T p.Gly183Asp missense+splice_region ANKS3 1 79460 1.25849E-5 39730 0 4.79327E-6
16-4752248-G-A c.869-5C>T splice_region ANKS3 1 79252 1.2618E-5 39626 0 5.55001E-6
16-4752250-A-G c.869-7T>C splice_region ANKS3 1 79236 1.26205E-5 39618 0 NA
16-4755088-C-G c.868+8G>C splice_region ANKS3 1 81428 1.22808E-5 40714 0 3.18532E-5
16-4755101-C-T p.Arg288His missense ANKS3 4 82054 4.87484E-5 41027 0 4.2155E-5
16-4755104-G-C p.Pro287Arg missense ANKS3 1 82224 1.21619E-5 41112 0 NA
16-4755107-C-T p.Arg286Gln missense ANKS3 1 82278 1.21539E-5 41139 0 5.03525E-4
16-4755108-G-A p.Arg286Trp missense ANKS3 1351 82308 0.016414 41154 22 0.0175489
16-4755112-G-A p.Pro40Leu missense ANKS3 2 82424 2.42648E-5 41212 0 3.34902E-5
16-4755120-C-T p.Gly282Ser missense ANKS3 3 82518 3.63557E-5 41259 1 1.67149E-5
16-4755121-G-A p.Ala37Val missense ANKS3 2 82502 2.42418E-5 41251 0 8.35185E-6
16-4755126-G-A p.Leu280Leu synonymous ANKS3 4 82604 4.84238E-5 41302 0 1.95256E-4
16-4755131-A-G p.Ile278Thr missense ANKS3 1 82700 1.20919E-5 41350 0 5.1785E-5
16-4755136-T-C p.Gln32Arg missense ANKS3 5 82748 6.04244E-5 41374 0 3.50318E-4
16-4755151-G-A p.Pro27Leu missense ANKS3 3 82812 3.62266E-5 41406 0 2.38857E-5
16-4755152-G-A p.Ala271Val missense ANKS3 1 82772 1.20814E-5 41386 0 3.18492E-5
16-4755155-C-T p.Arg270Gln missense ANKS3 1 82774 1.20811E-5 41387 0 3.32298E-5
16-4755157-C-T p.Arg25His missense ANKS3 1 82784 1.20796E-5 41392 0 9.55597E-5
16-4755166-G-C p.His266Gln missense ANKS3 1 82860 1.20685E-5 41430 0 3.98019E-6
16-4755168-G-T p.His266Asn missense ANKS3 1 82880 1.20656E-5 41440 0 NA
16-4755169-G-A p.Ser21Phe missense ANKS3 1 82866 1.20677E-5 41433 0 NA
16-4755172-G-A p.Ala20Val missense ANKS3 1 82878 1.20659E-5 41439 0 3.97978E-6
16-4755179-C-T p.Gly262Asp missense ANKS3 2 82884 2.41301E-5 41442 0 NA
16-4755179-C-A p.Gly262Val missense ANKS3 2 82884 2.41301E-5 41442 0 1.59172E-5
16-4755180-C-T p.Gly262Ser missense ANKS3 2 82882 2.41307E-5 41441 0 NA
16-4755184-C-T p.Arg16Lys missense ANKS3 1 82912 1.2061E-5 41456 0 NA
16-4755187-C-T p.Gly15Glu missense ANKS3 1 82920 1.20598E-5 41460 0 NA
16-4755189-G-A p.Arg259Trp missense ANKS3 1 82922 1.20595E-5 41461 0 6.37227E-5
16-4755196-C-G p.Arg256Ser missense ANKS3 2 82960 2.4108E-5 41480 0 NA
16-4755205-C-CTA p.Gln253fs frameshift ANKS3 1 82986 1.20502E-5 41493 0 NA
16-4755206-T-C p.Gln253Arg missense ANKS3 24 82990 2.89191E-4 41495 0 1.91168E-4
16-4755209-G-C p.Pro252Arg missense ANKS3 1 82994 1.20491E-5 41497 0 1.65453E-5
16-4755209-G-A p.Pro252Leu missense ANKS3 1 82994 1.20491E-5 41497 0 3.97874E-6
16-4755210-G-A p.Pro252Ser missense ANKS3 3 82988 3.61498E-5 41494 0 0.00100705
16-4755212-G-C p.Ala251Gly missense ANKS3 1 82994 1.20491E-5 41497 0 1.65462E-5
16-4755217-G-A p.Ala5Val missense ANKS3 1 82988 1.20499E-5 41494 0 3.97924E-6
16-4755226-G-A p.Thr2Met missense ANKS3 6 82996 7.22926E-5 41498 0 4.96648E-5
16-4755226-G-C p.Asp246Glu missense ANKS3 4 82996 4.81951E-5 41498 0 NA
16-4755247-G-A p.Tyr239Tyr synonymous ANKS3 4 82864 4.82719E-5 41432 0 0.00151057
16-4755250-C-G p.Lys238Asn missense ANKS3 1 82842 1.20712E-5 41421 0 NA
16-4755257-G-GGGC c.710-4_710-3insGCC splice_region ANKS3 1 82782 1.20799E-5 41391 0 NA
16-4755258-T-G c.710-4A>C splice_region ANKS3 1 82766 1.20823E-5 41383 0 NA
16-4764061-G-A p.Arg234Trp missense ANKS3 1 83242 1.20132E-5 41621 0 4.13627E-5
16-4764065-G-T p.Leu232Leu synonymous ANKS3 1 83270 1.20091E-5 41635 0 8.26337E-6
16-4764078-A-G p.Leu228Pro missense ANKS3 53 83316 6.36132E-4 41658 0 3.6294E-4
16-4764082-A-C p.Ser227Ala missense ANKS3 7 83326 8.40074E-5 41663 0 3.9789E-5
16-4764082-A-T p.Ser227Thr missense ANKS3 1 83326 1.20011E-5 41663 0 NA
16-4764086-C-G p.Ser225Ser synonymous ANKS3 10 83318 1.20022E-4 41659 0 3.97874E-5
16-4764086-C-T p.Ser225Ser synonymous ANKS3 1 83318 1.20022E-5 41659 0 1.5915E-4
16-4764087-G-A p.Ser225Leu missense ANKS3 1 83328 1.20008E-5 41664 0 NA
16-4764089-G-A p.Tyr224Tyr synonymous ANKS3 4 83338 4.79973E-5 41669 0 1.19348E-5
16-4764097-C-T p.Asp222Asn missense ANKS3 1 83356 1.19967E-5 41678 0 8.24063E-6
16-4764104-G-C p.Ala219Ala synonymous ANKS3 2 83364 2.39912E-5 41682 0 3.97731E-6
16-4764110-G-A p.Ile217Ile synonymous ANKS3 10 83370 1.19947E-4 41685 0 1.59317E-4
16-4764111-A-G p.Ile217Thr missense ANKS3 1 83368 1.1995E-5 41684 0 8.23873E-6
16-4764116-C-A p.Ter81Leuext*? stop_lost ANKS3 1 83370 1.19947E-5 41685 0 8.23859E-6
16-4764117-A-C p.Ter81Glyext*? stop_lost ANKS3 2259 83340 0.0271058 41670 48 0.0339427
16-4764118-T-A p.Met215Leu missense ANKS3 6 83368 7.19701E-5 41684 0 6.37064E-5
16-4764124-C-T p.Gly213Arg missense ANKS3 1 83354 1.1997E-5 41677 0 1.19315E-5
16-4764125-G-A p.Thr78Met missense ANKS3 1 83352 1.19973E-5 41676 0 6.37186E-5
16-4764134-G-A p.Pro75Leu missense ANKS3 2 83350 2.39952E-5 41675 0 0.0025
16-4764144-C-T p.Arg206Gln missense ANKS3 5 83358 5.99822E-5 41679 0 3.18251E-5
16-4764145-G-A p.Arg206Trp missense ANKS3 1 83358 1.19964E-5 41679 0 3.18593E-5
16-4764154-C-T p.Ala203Thr missense ANKS3 1 83340 1.1999E-5 41670 0 8.23954E-6
16-4764159-C-T p.Ser201Asn missense ANKS3 1 83338 1.19993E-5 41669 0 3.97893E-6
16-4764160-T-C p.Ser201Gly missense ANKS3 1 83336 1.19996E-5 41668 0 NA
16-4764162-T-A p.His200Leu missense ANKS3 2 83328 2.40015E-5 41664 0 5.03525E-4
16-4764162-T-C p.His200Arg missense ANKS3 2 83330 2.4001E-5 41665 0 7.9595E-6
16-4764163-G-C p.His200Asp missense ANKS3 13 83324 1.56017E-4 41662 0 2.22563E-4
16-4764163-G-T p.His200Asn missense ANKS3 1 83324 1.20013E-5 41662 0 4.94584E-5
16-4764163-G-A p.His200Tyr missense ANKS3 1 83324 1.20013E-5 41662 0 NA
16-4764168-C-A p.Glu64* stop_gained ANKS3 1 83324 1.20013E-5 41662 0 8.24525E-6
16-4764171-G-A p.Arg63* stop_gained ANKS3 1 83308 1.20036E-5 41654 0 1.64932E-5
16-4764173-G-A p.Thr62Met missense ANKS3 2 83304 2.40085E-5 41652 0 3.98191E-6
16-4764175-C-G p.Asp196His missense ANKS3 3 83310 3.60101E-5 41655 0 8.25191E-6
16-4764179-C-G p.Lys194Asn missense ANKS3 1 83288 1.20065E-5 41644 0 NA
16-4764181-T-G p.Lys194Gln missense ANKS3 1 83282 1.20074E-5 41641 0 NA
16-4764187-C-CGTGATTCAGAAAATACTGCACGATTATCTCATGGCCAG c.574-1_574insCTGGCCATGAGATAATCGTGCAGTATTTTCTGAATCAC splice_acceptor ANKS3 1 83270 1.20091E-5 41635 0 NA
16-4764190-G-A c.574-3C>T splice_region ANKS3 2 83234 2.40286E-5 41617 0 9.5584E-5
16-4764191-T-TAATCCCAGCTACTCGGGAGGCTGAGGCAG c.574-5_574-4insCTGCCTCAGCCTCCCGAGTAGCTGGGATT splice_region ANKS3 1 83240 1.20135E-5 41620 0 NA
16-4764297-CCT-C n.292-2_292-1delAG splice_acceptor ANKS3 2 78120 2.56016E-5 39060 0 3.1837E-5
16-4767461-C-T p.Glu114Lys missense ANKS3 1 932 0.00107296 466 0 NA
16-4767494-G-A p.Arg103Cys missense ANKS3 2 982 0.00203666 491 0 NA
16-4767511-G-A p.Thr97Ile missense ANKS3 4 1006 0.00397614 503 0 0.00834399
16-4767513-A-G p.Leu96Leu synonymous ANKS3 2 1004 0.00199203 502 0 3.19183E-5
16-4767554-T-A c.*189A>T splice_region ANKS3 18 1016 0.0177165 508 1 0.0210686
16-4767560-G-GA c.*189-7_*189-6insT splice_region ANKS3 11 826 0.0133172 413 0 0.00451341
16-4767560-GA-G c.*189-7delT splice_region ANKS3 2 1010 0.0019802 505 0 0.25
16-4774746-C-CTTA c.573+4_573+5insTAA splice_region ANKS3 22 83106 2.64722E-4 41553 0 8.40376E-5
16-4774751-G-A c.-46C>T 5_prime_UTR_premature_start_codon_gain ANKS3 1 83124 1.20302E-5 41562 0 1.65027E-5
16-4774763-A-G p.Tyr187Tyr synonymous ANKS3 1 83234 1.20143E-5 41617 0 2.79381E-5
16-4774771-C-T p.Val185Met missense ANKS3 1 83254 1.20114E-5 41627 0 3.98327E-6
16-4774772-G-A c.-67C>T 5_prime_UTR_premature_start_codon_gain ANKS3 1 83254 1.20114E-5 41627 0 2.47443E-5
16-4774775-T-G p.Ile183Ile synonymous ANKS3 1676 83248 0.0201326 41624 29 0.0210788
16-4774807-A-G p.Leu132Pro missense ANKS3 2 83278 2.40159E-5 41639 0 NA
16-4774822-A-C p.Cys168Gly missense ANKS3 284 83230 0.00341223 41615 0 0.00875
16-4774822-A-G p.Cys168Arg missense ANKS3 1 83234 1.20143E-5 41617 0 3.9813E-6
16-4774826-C-T p.Asp126Asn missense ANKS3 2 83202 2.40379E-5 41601 0 7.96876E-6
16-4774827-G-A p.Pro166Leu missense+splice_region ANKS3 3 83182 3.60655E-5 41591 0 1.99251E-5
16-4774834-T-TCAC c.492-3_492-2insGTG splice_region ANKS3 1 83188 1.2021E-5 41594 0 NA
16-4776665-G-A c.-133C>T 5_prime_UTR_premature_start_codon_gain ANKS3 1 82976 1.20517E-5 41488 0 1.59205E-4
16-4776676-C-T p.Ala159Thr missense ANKS3 1 82990 1.20496E-5 41495 0 3.98016E-6
16-4776683-G-A p.Asp156Asp synonymous ANKS3 1 83028 1.20441E-5 41514 0 NA
16-4776692-G-C p.Phe153Leu missense ANKS3 1 83062 1.20392E-5 41531 0 NA
16-4776695-C-T p.Arg152Arg synonymous ANKS3 1 83064 1.20389E-5 41532 0 NA
16-4776702-A-G p.Met150Thr missense ANKS3 1 83122 1.20305E-5 41561 0 8.24443E-6
16-4776710-G-C p.His147Gln missense ANKS3 1 83156 1.20256E-5 41578 0 NA
16-4776712-G-A p.His147Tyr missense ANKS3 1 83158 1.20253E-5 41579 0 3.97798E-6
16-4776712-G-T p.His147Asn missense ANKS3 3 83158 3.60759E-5 41579 0 6.25E-4
16-4776715-C-T p.Gly146Arg missense ANKS3 1 83166 1.20241E-5 41583 0 8.24375E-6
16-4776716-G-A c.-184C>T 5_prime_UTR_premature_start_codon_gain ANKS3 1 83158 1.20253E-5 41579 0 NA
16-4776718-C-T p.Ala145Thr missense ANKS3 1 83166 1.20241E-5 41583 0 0.00100705
16-4776719-G-A p.Ser144Ser synonymous ANKS3 2 83180 2.40442E-5 41590 0 8.24362E-6
16-4776736-G-C p.Leu139Val missense ANKS3 2 83222 2.40321E-5 41611 0 3.97776E-6
16-4776737-G-C p.Ala138Ala synonymous ANKS3 1 83218 1.20166E-5 41609 0 NA
16-4776740-T-C p.Thr137Thr synonymous ANKS3 1 83206 1.20184E-5 41603 0 NA
16-4776743-C-T p.Trp136* stop_gained ANKS3 1 83202 1.20189E-5 41601 0 NA
16-4776770-C-T p.Ser61Asn missense ANKS3 1 83204 1.20187E-5 41602 0 1.19382E-5
16-4776773-T-C p.Gln60Arg missense ANKS3 4 83206 4.80735E-5 41603 1 1.11439E-4
16-4776783-T-C c.370-2A>G splice_acceptor ANKS3 1 83192 1.20204E-5 41596 0 NA
16-4776801-G-A c.-269C>T 5_prime_UTR_premature_start_codon_gain ANKS3 5 83142 6.01381E-5 41571 0 0.001875
16-4776805-G-A c.-273C>T 5_prime_UTR_premature_start_codon_gain ANKS3 602 83118 0.00724271 41559 3 0.0120662
16-4776827-G-A c.-295C>T 5_prime_UTR_premature_start_codon_gain ANKS3 2 82946 2.41121E-5 41473 0 3.1835E-5
16-4776834-G-A c.-302C>T 5_prime_UTR_premature_start_codon_gain ANKS3 2 82804 2.41534E-5 41402 0 NA
16-4776849-G-A c.-317C>T 5_prime_UTR_premature_start_codon_gain ANKS3 3 82586 3.63258E-5 41293 0 NA
16-4776853-A-G n.194T>C splice_region ANKS3 9 82560 1.09012E-4 41280 0 6.36699E-5
16-4776988-G-T p.Leu121Ile missense ANKS3 1 83196 1.20198E-5 41598 0 NA
16-4777017-C-A p.Ser111Ile missense ANKS3 1 83164 1.20244E-5 41582 0 2.02895E-4
16-4777018-T-C p.Ser111Gly missense ANKS3 4 83162 4.80989E-5 41581 0 9.55414E-5
16-4777048-C-T p.Glu101Lys missense ANKS3 1 83180 1.20221E-5 41590 0 NA
16-4777054-T-A p.Thr99Ser missense ANKS3 1 83118 1.20311E-5 41559 0 NA
16-4777055-C-T p.Pro98Pro synonymous ANKS3 2 83122 2.4061E-5 41561 0 2.47198E-5
16-4777056-G-A p.Pro98Leu missense ANKS3 1 83148 1.20267E-5 41574 0 8.24022E-5
16-4777060-C-T p.Val97Met missense ANKS3 2 83152 2.40523E-5 41576 0 NA
16-4777084-G-T p.Leu89Ile missense ANKS3 16 83282 1.92118E-4 41641 0 0.00100705
16-4777085-C-T p.Leu88Leu synonymous ANKS3 2 83292 2.40119E-5 41646 0 NA
16-4777096-C-T p.Val85Met missense ANKS3 1 83268 1.20094E-5 41634 0 NA
16-4777097-G-A c.-441C>T 5_prime_UTR_premature_start_codon_gain ANKS3 1 83274 1.20085E-5 41637 0 3.18431E-5
16-4777102-T-C p.Thr83Ala missense ANKS3 1 83274 1.20085E-5 41637 0 NA
16-4777105-C-T p.Asp82Asn missense ANKS3 2 83278 2.40159E-5 41639 0 5.56757E-5
16-4777108-G-A p.His81Tyr missense ANKS3 1 83274 1.20085E-5 41637 0 8.24131E-6
16-4777109-GCC-G p.Gly80fs frameshift ANKS3 1 83276 1.20083E-5 41638 0 NA
16-4777113-A-G p.Ile79Thr missense ANKS3 4 83280 4.80307E-5 41640 0 5.7691E-5
16-4777119-G-C p.Ser77Cys missense ANKS3 2 83290 2.40125E-5 41645 0 3.97671E-6
16-4777130-C-T p.Leu73Leu synonymous ANKS3 1 83272 1.20088E-5 41636 0 NA
16-4777139-C-T p.Trp70* stop_gained ANKS3 1 83238 1.20137E-5 41619 0 NA
16-4777148-A-G p.Gly67Gly synonymous ANKS3 1 83198 1.20195E-5 41599 0 NA
16-4777152-T-C p.Asn66Ser missense ANKS3 1 83184 1.20215E-5 41592 0 NA
16-4777157-C-T p.Lys64Lys synonymous ANKS3 1 83154 1.20259E-5 41577 0 8.25928E-6
16-4777163-C-G p.Leu62Phe missense ANKS3 2 83060 2.4079E-5 41530 0 NA
16-4777169-T-C c.-40A>G 5_prime_UTR_premature_start_codon_gain ANKS3 1 82930 1.20584E-5 41465 0 8.27486E-6
16-4777169-T-G p.Leu60Phe missense ANKS3 1 82930 1.20584E-5 41465 0 1.19408E-5
16-4777172-C-T p.Glu59Glu synonymous ANKS3 3 82868 3.62022E-5 41434 0 2.48435E-5
16-4777175-T-A p.Arg58Ser missense ANKS3 1 82726 1.20881E-5 41363 0 NA
16-4777177-T-C p.Arg58Gly missense+splice_region ANKS3 2 82678 2.41902E-5 41339 0 NA
16-4777178-C-T p.Arg57Arg splice_region+synonymous ANKS3 1 82678 1.20951E-5 41339 0 3.18451E-5
16-4777179-C-CGCTGCACACACTCCT c.171-2_171-1insAGGAGTGTGTGCAGC splice_acceptor ANKS3 1 82620 1.21036E-5 41310 0 NA
16-4777179-C-CGCTGCACACACTCCTTCACCACT c.171-2_171-1insAGTGGTGAAGGAGTGTGTGCAGC splice_acceptor ANKS3 2 82620 2.42072E-5 41310 0 NA
16-4779974-C-G c.170+7G>C splice_region ANKS3 1 80796 1.23769E-5 40398 0 3.44064E-5
16-4779983-C-T p.Gln56Gln splice_region+synonymous ANKS3 3 81434 3.68397E-5 40717 0 1.03773E-5
16-4779994-C-G p.Glu53Gln missense ANKS3 3 82044 3.65657E-5 41022 0 NA
16-4779995-C-A p.Lys52Asn missense ANKS3 1 81984 1.21975E-5 40992 0 NA
16-4780003-C-A p.Val50Leu missense ANKS3 1 82378 1.21392E-5 41189 0 NA
16-4780010-C-T p.Gln47Gln synonymous ANKS3 6 82570 7.26656E-5 41285 0 8.91075E-6
16-4780056-T-C p.Glu32Gly missense ANKS3 1 82878 1.20659E-5 41439 0 NA
16-4780060-C-T p.Glu31Lys missense ANKS3 3 82886 3.61943E-5 41443 0 1.6767E-5
16-4780064-G-A p.Ser29Ser synonymous ANKS3 1 82888 1.20645E-5 41444 0 3.35121E-5
16-4780077-C-T p.Gly25Glu missense ANKS3 244 82972 0.00294075 41486 1 0.00767712
16-4780078-C-G p.Gly25Arg missense ANKS3 3 82956 3.61638E-5 41478 0 NA
16-4780085-G-C p.His22Gln missense ANKS3 2 82878 2.41319E-5 41439 0 4.21895E-6
16-4780093-T-C p.Met20Val missense ANKS3 21 82934 2.53213E-4 41467 0 4.45973E-4
16-4780095-G-C p.Ser19Cys missense ANKS3 1 82918 1.20601E-5 41459 0 NA
16-4780105-G-A p.Arg16Cys missense ANKS3 31 82890 3.7399E-4 41445 0 6.19463E-4
16-4780105-G-T p.Arg16Ser missense ANKS3 1 82890 1.20642E-5 41445 0 NA
16-4780109-C-G p.Leu14Leu synonymous ANKS3 223 82854 0.00269148 41427 1 0.00223188
16-4780112-G-A p.Leu13Leu synonymous ANKS3 1 82886 1.20648E-5 41443 0 2.51107E-5
16-4780118-C-T p.Pro11Pro synonymous ANKS3 2 82796 2.41558E-5 41398 0 3.4408E-5
16-4780119-G-A p.Pro11Leu missense ANKS3 6 82780 7.24813E-5 41390 0 3.83305E-5
16-4780124-G-A p.Ser9Ser synonymous ANKS3 1 82704 1.20913E-5 41352 0 4.2996E-6
16-4780129-C-T p.Ala8Thr missense ANKS3 1 82644 1.21001E-5 41322 0 NA
16-4780136-G-A p.Ser5Ser synonymous ANKS3 4 82442 4.8519E-5 41221 0 0.00100806
16-4780142-C-T p.Glu3Glu synonymous ANKS3 3 82370 3.6421E-5 41185 0 3.1837E-5
16-4780144-C-T p.Glu3Lys missense ANKS3 1 82232 1.21607E-5 41116 0 8.89854E-6
16-4780145-G-A c.-183C>T 5_prime_UTR_premature_start_codon_gain ANKS3 75 82208 9.1232E-4 41104 1 0.00125
16-4780145-G-C p.Ser2Ser synonymous ANKS3 15 82210 1.8246E-4 41105 0 5.04541E-4
16-4780155-G-A c.-2-3C>T splice_region ANKS3 2 81664 2.44906E-5 40832 0 6.36862E-5
16-4780155-G-GTGCTGGGCCTCAGGCCTTGCGCCGCCCTCGGGCTGCCGTCGCCAACCCCCCCAA c.-2-4_-2-3insTTGGGGGGGTTGGCGACGGCAGCCCGAGGGCGGCGCAAGGCCTGAGGCCCAGCA splice_region ANKS3 2 81664 2.44906E-5 40832 1 NA
16-4780155-G-C c.-2-3C>G splice_region ANKS3 1 81662 1.22456E-5 40831 0 NA
16-4780157-G-A c.-2-5C>T splice_region ANKS3 2 81630 2.45008E-5 40815 0 3.1841E-5
16-4781508-C-G c.-3+5G>C splice_region ANKS3 2 14250 1.40351E-4 7125 0 3.19142E-5
16-4781509-T-A c.-3+4A>T splice_region ANKS3 1 14318 6.98422E-5 7159 0 NA
16-4781515-C-T c.-5G>A splice_region ANKS3 1 14754 6.77782E-5 7377 0 NA
16-4781515-C-G c.-5G>C splice_region ANKS3 2 14754 1.35556E-4 7377 0 NA
16-4781562-G-A c.-52C>T 5_prime_UTR_premature_start_codon_gain ANKS3 1 19206 5.20671E-5 9603 0 3.18471E-5
16-4783936-C-T c.-71+3G>A splice_region ANKS3 2 24970 8.00961E-5 12485 0 NA
16-4783941-C-G c.-73G>C splice_region ANKS3 1 24976 4.00384E-5 12488 0 3.18735E-5
16-4783996-C-A c.-128G>T 5_prime_UTR_premature_start_codon_gain ANKS3 54 26104 0.00206865 13052 0 0.00675546
16-4784064-G-A c.-196C>T 5_prime_UTR_premature_start_codon_gain ANKS3 2 25640 7.80031E-5 12820 0 NA
16-4784091-G-A c.-223C>T 5_prime_UTR_premature_start_codon_gain ANKS3 3 24412 1.2289E-4 12206 0 9.55475E-5
16-4784098-G-A c.-230C>T 5_prime_UTR_premature_start_codon_gain ANKS3 9 24096 3.73506E-4 12048 0 5.41401E-4
16-4784122-G-A c.-254C>T 5_prime_UTR_premature_start_codon_gain ANKS3 5 22012 2.27149E-4 11006 0 1.59286E-4
16-4784241-G-A c.-302C>T 5_prime_UTR_premature_start_codon_gain ANKS3 5 9008 5.55062E-4 4504 0 2.55216E-4
16-4784319-C-G c.-165G>C 5_prime_UTR_premature_start_codon_gain ANKS3 1 3734 2.67809E-4 1867 0 NA