Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
6-34857085-T-G c.-95T>G 5_prime_UTR_premature_start_codon_gain ANKS1A 1 32160 3.10945E-5 16080 0 NA
6-34857086-G-T c.-94G>T 5_prime_UTR_premature_start_codon_gain ANKS1A 1 32258 3.10001E-5 16129 0 3.19468E-5
6-34857091-G-C c.-89G>C 5_prime_UTR_premature_start_codon_gain ANKS1A 30 32394 9.26097E-4 16197 0 0.00162991
6-34857124-C-T c.-56C>T 5_prime_UTR_premature_start_codon_gain ANKS1A 1 33488 2.98614E-5 16744 0 NA
6-34857137-C-T c.-43C>T 5_prime_UTR_premature_start_codon_gain ANKS1A 3 34214 8.76834E-5 17107 0 3.20698E-5
6-34857230-G-C p.Pro17Pro synonymous ANKS1A 2 37952 5.26981E-5 18976 0 NA
6-34857233-G-T p.Ala18Ala synonymous ANKS1A 1 37780 2.6469E-5 18890 0 6.45078E-5
6-34857248-G-C p.Leu23Leu synonymous ANKS1A 1 37890 2.63922E-5 18945 0 NA
6-34857272-C-T p.Gly31Gly synonymous ANKS1A 1 36808 2.7168E-5 18404 0 NA
6-34857274-TTGGGGGCGGCGGCGGCGGTGGCTC-T p.Gly39_Gly46del disruptive_inframe_deletion ANKS1A 5 36492 1.37016E-4 18246 1 1.95848E-4
6-34857278-GGGC-G p.Gly38del disruptive_inframe_deletion ANKS1A 1 36458 2.74288E-5 18229 0 0.00113379
6-34857278-GGGCGGCGGCGGCGGTGGCTCTGGGGGCGGCGGCGGCGGCAGCGGCGGC-G p.Gly38_Gly53del conservative_inframe_deletion ANKS1A 1 36462 2.74258E-5 18231 0 NA
6-34857284-CGGCGGCGGTGGCTCTGGG-C p.Gly39_Gly44del disruptive_inframe_deletion ANKS1A 1 35986 2.77886E-5 17993 0 NA
6-34857302-GGGCGGC-G p.Gly45_Gly46del conservative_inframe_deletion ANKS1A 49 36054 0.00135907 18027 1 0.00362152
6-34857302-G-GGGCGGC p.Gly45_Gly46dup conservative_inframe_insertion ANKS1A 1836 35308 0.0519995 17654 100 0.0625535
6-34857302-GGGCGGCGGCGGCGGCAGCGGC-G p.Ser47_Gly53del conservative_inframe_deletion ANKS1A 2 36054 5.54723E-5 18027 0 0.00255102
6-34857302-GGGCGGCGGCGGCGGCAGCGGCGGC-G p.Gly46_Gly53del conservative_inframe_deletion ANKS1A 3 36056 8.32039E-5 18028 0 NA
6-34857302-G-GGGCGGCGGC p.Gly44_Gly46dup conservative_inframe_insertion ANKS1A 1 36056 2.77346E-5 18028 0 NA
6-34857303-GGCGGCGGCGGCGGCA-G p.Ser47_Gly51del conservative_inframe_deletion ANKS1A 1 36026 2.77577E-5 18013 0 NA
6-34857306-G-GGCGGCGGCGGCA p.Ser47_Gly50dup conservative_inframe_insertion ANKS1A 2 35946 5.5639E-5 17973 0 3.27375E-5
6-34857309-GGCGGCGGCA-G p.Ser47_Gly49del conservative_inframe_deletion ANKS1A 11 36048 3.05149E-4 18024 1 0.00342466
6-34857311-C-T p.Gly44Gly synonymous ANKS1A 1555 35790 0.0434479 17895 47 0.114695
6-34857311-C-CGGCGGTGGCTCTGGGGGCGGCGGT p.Gly46_Ser47insGlySerGlyGlyGlyGlyGlyGly disruptive_inframe_insertion ANKS1A 1 35890 2.78629E-5 17945 0 NA
6-34857312-G-GGCGGCA p.Ser47_Gly48dup conservative_inframe_insertion ANKS1A 14 35992 3.88975E-4 17996 0 1.30847E-4
6-34857312-GGCGGCA-G p.Ser47_Gly48del conservative_inframe_deletion ANKS1A 2 35992 5.55679E-5 17996 0 NA
6-34857317-C-T p.Gly46Gly synonymous ANKS1A 1 36014 2.7767E-5 18007 0 NA
6-34857318-AGCG-A p.Gly53del conservative_inframe_deletion ANKS1A 14 35876 3.90233E-4 17938 0 0.0183432
6-34857318-A-G p.Ser47Gly missense ANKS1A 10 36022 2.77608E-4 18011 0 0.0470975
6-34857318-A-AGCG p.Gly53dup conservative_inframe_insertion ANKS1A 107 36032 0.00296958 18016 0 0.00273133
6-34857318-A-AGCGGCG p.Gly52_Gly53dup conservative_inframe_insertion ANKS1A 19 36032 5.27309E-4 18016 0 9.84252E-4
6-34857318-AGCGGCGGCG-A p.Gly51_Gly53del conservative_inframe_deletion ANKS1A 1 36034 2.77516E-5 18017 0 NA
6-34857318-A-AGCGGCGGCG p.Gly51_Gly53dup conservative_inframe_insertion ANKS1A 1 36034 2.77516E-5 18017 0 NA
6-34857320-C-T p.Ser47Ser synonymous ANKS1A 2 35838 5.58067E-5 17919 0 9.4518E-4
6-34857323-C-CGGG p.Gly49dup disruptive_inframe_insertion ANKS1A 2 35990 5.5571E-5 17995 0 NA
6-34857324-G-GGCA p.Gly49_Gly50insSer conservative_inframe_insertion ANKS1A 2 36030 5.55093E-5 18015 0 1.33797E-4
6-34857335-C-G p.Gly52Gly synonymous ANKS1A 1 36010 2.77701E-5 18005 0 NA
6-34857346-C-T p.Ser56Phe missense ANKS1A 3 37324 8.03772E-5 18662 0 0.00105152
6-34857352-G-A p.Ser58Asn missense ANKS1A 1 37814 2.64452E-5 18907 0 NA
6-34857365-C-T p.Ser62Ser synonymous ANKS1A 1 39216 2.54998E-5 19608 0 NA
6-34857380-G-A c.197+4G>A splice_region ANKS1A 1 40532 2.46719E-5 20266 0 NA
6-34935025-A-G p.Arg69Arg synonymous ANKS1A 1 82998 1.20485E-5 41499 0 NA
6-34935067-C-G p.Pro83Pro synonymous ANKS1A 168 83184 0.00201962 41592 0 0.00153605
6-34935070-G-A p.Leu84Leu synonymous ANKS1A 3 83178 3.60672E-5 41589 0 5.76663E-5
6-34935083-T-C p.Leu89Leu synonymous ANKS1A 1 83174 1.2023E-5 41587 0 NA
6-34937780-C-T c.279-7C>T splice_region ANKS1A 1 83314 1.20028E-5 41657 0 8.38546E-6
6-34937785-A-G c.279-2A>G splice_acceptor ANKS1A 2 83320 2.40038E-5 41660 0 NA
6-34937796-C-T p.Val96Val synonymous ANKS1A 7 83322 8.40114E-5 41661 1 3.18471E-5
6-34937797-G-A p.Glu97Lys missense ANKS1A 1 83332 1.20002E-5 41666 0 3.18492E-5
6-34937815-G-A p.Asp103Asn missense ANKS1A 2 83284 2.40142E-5 41642 0 3.30022E-5
6-34937820-G-A p.Ala104Ala synonymous ANKS1A 1 83288 1.20065E-5 41644 0 3.18492E-5
6-34937829-C-T p.Asn107Asn synonymous ANKS1A 36 83258 4.32391E-4 41629 0 0.0020141
6-34937830-G-A p.Val108Met missense ANKS1A 1 83250 1.2012E-5 41625 0 8.24158E-6
6-34937851-T-C p.Tyr115His missense ANKS1A 3 83186 3.60638E-5 41593 0 3.97874E-6
6-34937896-C-A p.Arg130Arg synonymous ANKS1A 2 83042 2.40842E-5 41521 0 NA
6-34937897-G-A p.Arg130Gln missense ANKS1A 1 83028 1.20441E-5 41514 0 3.18593E-5
6-34937902-CTCATCCA-C p.Ile133fs frameshift ANKS1A 1 83012 1.20465E-5 41506 0 NA
6-34937912-A-G p.Gln135Arg missense ANKS1A 1 82976 1.20517E-5 41488 0 NA
6-34937943-G-GAACAATGACAACGAGACAGCCCTGCATT c.435_435+1insAACAATGACAACGAGACAGCCCTGCATT splice_donor ANKS1A 2 82558 2.42254E-5 41279 0 NA
6-34937946-C-T c.435+3C>T splice_region ANKS1A 1 82440 1.213E-5 41220 0 6.05444E-5
6-34937947-G-C c.435+4G>C splice_region ANKS1A 1 82372 1.214E-5 41186 0 NA
6-34949477-A-G p.Asn149Ser missense ANKS1A 1 82834 1.20723E-5 41417 0 4.01155E-6
6-34949479-G-A p.Glu150Lys missense ANKS1A 1 82822 1.20741E-5 41411 0 NA
6-34949495-G-C p.Cys155Ser missense ANKS1A 1 82888 1.20645E-5 41444 0 5.03525E-4
6-34949498-C-T p.Ala156Val missense ANKS1A 2 82868 2.41348E-5 41434 0 NA
6-34949501-C-T p.Ala157Val missense ANKS1A 2 82850 2.414E-5 41425 0 NA
6-34949502-G-T p.Ala157Ala synonymous ANKS1A 1 82874 1.20665E-5 41437 0 NA
6-34949530-G-T p.Val167Leu missense ANKS1A 1 83090 1.20351E-5 41545 0 NA
6-34949549-C-T p.Thr173Met missense ANKS1A 1 83150 1.20265E-5 41575 0 8.23805E-6
6-34949550-G-A p.Thr173Thr synonymous ANKS1A 3 83138 3.60846E-5 41569 0 2.1093E-4
6-34949577-C-T p.Phe182Phe synonymous ANKS1A 4 83122 4.8122E-5 41561 0 4.37706E-5
6-34949578-G-A p.Glu183Lys missense ANKS1A 1 83114 1.20317E-5 41557 0 2.47113E-5
6-34949581-A-AC p.Leu186fs frameshift ANKS1A 2 83100 2.40674E-5 41550 1 NA
6-34949593-C-T p.Leu188Leu synonymous ANKS1A 1 83062 1.20392E-5 41531 0 NA
6-34949607-C-T p.Tyr192Tyr synonymous ANKS1A 57957 82734 0.700522 41367 20901 0.716118
6-34949614-C-T p.Leu195Leu synonymous ANKS1A 4 83062 4.81568E-5 41531 0 6.25E-4
6-34949614-C-G p.Leu195Val missense ANKS1A 1 83062 1.20392E-5 41531 0 NA
6-34949638-A-G p.Asn203Asp missense ANKS1A 1 83108 1.20325E-5 41554 0 NA
6-34949644-C-T p.His205Tyr missense ANKS1A 8 83116 9.6251E-5 41558 0 5.03525E-4
6-34949646-C-A p.His205Gln missense ANKS1A 1 83114 1.20317E-5 41557 0 NA
6-34949651-A-G p.Asn207Ser missense ANKS1A 2 83122 2.4061E-5 41561 0 5.03525E-4
6-34949662-T-C p.Cys211Arg missense ANKS1A 2 83146 2.40541E-5 41573 0 8.2371E-6
6-34949667-C-T p.Asn212Asn synonymous ANKS1A 31 83124 3.72937E-4 41562 0 1.79043E-4
6-34949705-A-C p.Asn225Thr missense ANKS1A 1 82868 1.20674E-5 41434 0 NA
6-34949722-G-A p.Val231Ile missense ANKS1A 1 82592 1.21077E-5 41296 0 1.19914E-5
6-34949724-C-A p.Val231Val synonymous ANKS1A 1 82550 1.21139E-5 41275 0 3.99862E-6
6-34949731-C-A p.Leu234Ile missense ANKS1A 2 82460 2.42542E-5 41230 0 6.37186E-5
6-34949736-C-T p.Leu235Leu synonymous ANKS1A 24 82408 2.91234E-4 41204 0 7.61401E-5
6-34949737-G-A p.Asp236Asn missense ANKS1A 3 82354 3.64281E-5 41177 0 8.25246E-6
6-34949756-A-G p.Asn242Ser missense ANKS1A 1 82012 1.21933E-5 41006 0 8.28665E-6
6-34949763-G-GACGGAGATGGGCAGTGCTTTGCATGAGGCTGCTTTGTTTGGCAAGACCGAT c.732_732+1insACGGAGATGGGCAGTGCTTTGCATGAGGCTGCTTTGTTTGGCAAGACCGAT splice_donor ANKS1A 1 81900 1.221E-5 40950 0 NA
6-34949763-G-GACGGAGATGGGCAGTGCTTTGCATGAGGCTGCTTT c.732_732+1insACGGAGATGGGCAGTGCTTTGCATGAGGCTGCTTT splice_donor ANKS1A 1 81900 1.221E-5 40950 0 NA
6-34949768-C-A c.732+5C>A splice_region ANKS1A 1 81590 1.22564E-5 40795 0 1.66834E-5
6-34949771-G-A c.732+8G>A splice_region ANKS1A 2 81378 2.45767E-5 40689 0 6.37064E-5
6-34950524-TCCAGACGGAGA-T p.Thr245fs frameshift ANKS1A 2 83230 2.40298E-5 41615 0 1.59114E-5
6-34950531-G-A p.Thr245Thr splice_region+synonymous ANKS1A 1 83244 1.20129E-5 41622 0 6.25E-4
6-34950576-C-T p.Thr260Thr synonymous ANKS1A 2 83200 2.40385E-5 41600 0 3.29538E-5
6-34950605-G-GAACTGACGTCAACATAAAAGATAACCATGGAC c.808+1_808+2insAACTGACGTCAACATAAAAGATAACCATGGAC splice_donor ANKS1A 2 83074 2.40749E-5 41537 1 NA
6-34950887-T-C c.809-3T>C splice_region ANKS1A 9 83212 1.08157E-4 41606 0 4.37926E-5
6-34950897-C-G p.Asp272Glu missense ANKS1A 4 83234 4.80573E-5 41617 0 NA
6-34950897-C-T p.Asp272Asp synonymous ANKS1A 4 83234 4.80573E-5 41617 0 6.25E-4
6-34950917-A-G p.His279Arg missense ANKS1A 1 83236 1.2014E-5 41618 0 7.95653E-6
6-34950920-G-A p.Gly280Glu missense ANKS1A 1 83214 1.20172E-5 41607 0 NA
6-34950938-C-T p.Thr286Ile missense ANKS1A 3 83072 3.61133E-5 41536 0 1.19414E-5
6-34950946-G-A p.Glu289Lys missense ANKS1A 1 83010 1.20467E-5 41505 0 3.1841E-5
6-34950960-A-G p.Gln293Gln synonymous ANKS1A 1 82890 1.20642E-5 41445 0 NA
6-34950970-C-A p.Gln297Lys missense ANKS1A 1 82768 1.2082E-5 41384 0 2.48024E-5
6-34950972-A-C p.Gln297His missense ANKS1A 18 82744 2.17538E-4 41372 0 1.91071E-4
6-34950989-AAGGTATCATCCTTTCTCCCTGTCTGGGTGACCAGGGGACACACGAATTGAACCAAGGCATTTGTATTTGGTGCAGCACTTTTTATTTTTATTTTTTGATCTTTCCATGT-A p.Asp304fs frameshift ANKS1A 11 82304 1.33651E-4 41152 4 NA
6-34950997-A-G c.910+6A>G splice_region ANKS1A 2 82334 2.42913E-5 41167 0 NA
6-34951096-T-C c.911-5T>C splice_region ANKS1A 3 83312 3.60092E-5 41656 0 NA
6-34951111-T-C p.Thr307Thr synonymous ANKS1A 2 83346 2.39964E-5 41673 0 NA
6-34951130-G-C p.Glu314Gln missense ANKS1A 1 83352 1.19973E-5 41676 0 NA
6-34951135-A-G p.Val315Val synonymous ANKS1A 1 83352 1.19973E-5 41676 0 2.4768E-5
6-34951138-T-C p.Asp316Asp synonymous ANKS1A 1 83356 1.19967E-5 41678 0 1.6509E-5
6-34951142-A-AC p.Pro321fs frameshift ANKS1A 2 83326 2.40021E-5 41663 0 3.22497E-5
6-34951142-A-C p.Thr318Pro missense ANKS1A 3 83346 3.59945E-5 41673 0 0.00251762
6-34951144-C-G p.Thr318Thr synonymous ANKS1A 2 83338 2.39987E-5 41669 0 2.78483E-5
6-34951145-C-T p.Pro319Ser missense ANKS1A 2 83342 2.39975E-5 41671 0 NA
6-34951147-C-T p.Pro319Pro synonymous ANKS1A 1 83350 1.19976E-5 41675 0 1.19317E-5
6-34951149-C-A p.Pro320Gln missense ANKS1A 1 83346 1.19982E-5 41673 0 8.25042E-6
6-34951149-C-T p.Pro320Leu missense ANKS1A 1 83346 1.19982E-5 41673 0 3.97709E-6
6-34951151-C-A p.Pro321Thr missense ANKS1A 6 83348 7.19873E-5 41674 0 4.89182E-4
6-34951153-C-G p.Pro321Pro synonymous ANKS1A 3 83346 3.59945E-5 41673 0 8.24946E-6
6-34951161-C-A p.Pro324His missense ANKS1A 6 83338 7.1996E-5 41669 0 4.89175E-4
6-34951166-A-T p.Ile326Phe missense ANKS1A 5 83318 6.0011E-5 41659 0 NA
6-34951204-T-TGACGTGGAGA c.1012+2_1012+3insGACGTGGAGA splice_region ANKS1A 3 83274 3.60256E-5 41637 1 NA
6-34951210-A-G c.1012+8A>G splice_region ANKS1A 1 83252 1.20117E-5 41626 0 NA
6-34952863-C-T p.Asp339Asp synonymous ANKS1A 8 83264 9.60799E-5 41632 0 0.00100705
6-34952864-G-A p.Val340Met missense ANKS1A 2 83258 2.40217E-5 41629 0 3.99604E-6
6-34952873-G-A p.Ala343Thr missense ANKS1A 121 83288 0.00145279 41644 0 0.00251673
6-34952874-C-G p.Ala343Gly missense ANKS1A 1 83292 1.2006E-5 41646 0 5.03525E-4
6-34952888-A-C p.Ile348Leu missense ANKS1A 1 83336 1.19996E-5 41668 0 NA
6-34952905-A-T p.Ala353Ala synonymous ANKS1A 9 83352 1.07976E-4 41676 0 3.18573E-4
6-34952907-A-G p.Asn354Ser missense ANKS1A 1 83358 1.19964E-5 41679 0 1.59156E-5
6-34952910-C-A p.Ala355Asp missense ANKS1A 317 83334 0.00380397 41667 2 0.00933478
6-34952915-G-A p.Glu357Lys missense ANKS1A 1 83346 1.19982E-5 41673 0 NA
6-34952922-G-T p.Gly359Val missense ANKS1A 1 83354 1.1997E-5 41677 0 9.06275E-5
6-34952929-C-T p.Tyr361Tyr synonymous ANKS1A 1 83358 1.19964E-5 41679 0 6.25E-4
6-34952938-G-A p.Leu364Leu synonymous ANKS1A 8 83352 9.59785E-5 41676 0 1.19314E-5
6-34952940-A-T p.Tyr365Phe missense ANKS1A 37 83348 4.43922E-4 41674 0 0.0020141
6-34952948-A-G p.Ile368Val missense ANKS1A 1 83346 1.19982E-5 41673 0 8.2375E-6
6-34952962-G-A p.Ser372Ser synonymous ANKS1A 2 83336 2.39992E-5 41668 0 1.98851E-5
6-34952966-G-A p.Asp374Asn missense ANKS1A 1 83334 1.19999E-5 41667 0 4.11868E-5
6-34952980-C-T p.Ser378Ser synonymous ANKS1A 3 83302 3.60135E-5 41651 0 1.64769E-5
6-34952980-C-A p.Ser378Arg missense ANKS1A 2 83302 2.4009E-5 41651 0 5.76692E-5
6-34952981-G-A p.Gly379Arg missense ANKS1A 3 83296 3.60161E-5 41648 0 1.19326E-5
6-34952983-G-T p.Gly379Gly synonymous ANKS1A 25 83288 3.00163E-4 41644 0 0.00151057
6-34952984-C-T p.Arg380* stop_gained ANKS1A 4 83278 4.80319E-5 41639 0 NA
6-34953001-C-G p.Asp385Glu missense ANKS1A 2 83246 2.40252E-5 41623 0 1.64818E-5
6-34953007-G-A p.Thr387Thr synonymous ANKS1A 20 83216 2.40338E-4 41608 0 6.36943E-5
6-34953038-C-A p.Pro398Thr missense ANKS1A 2 82942 2.41132E-5 41471 0 5.80682E-5
6-34953055-T-TAGGGAACGTCCACCACCTCCAGCAAA c.1209_1209+1insAGGGAACGTCCACCACCTCCAGCAAA splice_donor ANKS1A 1 82600 1.21065E-5 41300 0 NA
6-34953055-T-TAGGGAACGTCCACCACCTCCAGCAAAGCCACCGCCCGATGAAGAGGAAGAA c.1209_1209+1insAGGGAACGTCCACCACCTCCAGCAAAGCCACCGCCCGATGAAGAGGAAGAA splice_donor ANKS1A 2 82600 2.42131E-5 41300 1 NA
6-34957008-G-A p.Arg406His missense ANKS1A 2 83294 2.40113E-5 41647 0 4.11855E-5
6-34957010-C-T p.Pro407Ser missense ANKS1A 1 83306 1.20039E-5 41653 0 3.18378E-5
6-34957020-C-T p.Pro410Leu missense ANKS1A 1 83332 1.20002E-5 41666 0 5.03525E-4
6-34957032-C-T p.Pro414Leu missense ANKS1A 1 83344 1.19985E-5 41672 0 3.97728E-6
6-34957033-G-A p.Pro414Pro synonymous ANKS1A 1 83334 1.19999E-5 41667 0 2.47093E-5
6-34957036-C-T p.Pro415Pro synonymous ANKS1A 2 83344 2.39969E-5 41672 0 3.29457E-5
6-34957037-G-A p.Asp416Asn missense ANKS1A 51 83344 6.11922E-4 41672 1 0.009375
6-34957045-G-A p.Glu418Glu synonymous ANKS1A 1 83360 1.19962E-5 41680 0 NA
6-34957053-A-G p.Asp421Gly missense ANKS1A 1 83352 1.19973E-5 41676 0 3.9769E-6
6-34957082-A-C p.Thr431Pro missense ANKS1A 1 83312 1.20031E-5 41656 0 2.47117E-5
6-34957095-T-TTCTGTCCATGAGACCTAGGATTCATGGGAGTGCAGCCCGGGA c.1302+2_1302+3insTCTGTCCATGAGACCTAGGATTCATGGGAGTGCAGCCCGGGA splice_region ANKS1A 4 83212 4.807E-5 41606 2 NA
6-34957095-T-TTCTGTCCATGAGACCTAGGATTCATGGG c.1302+2_1302+3insTCTGTCCATGAGACCTAGGATTCATGGG splice_region ANKS1A 1 83212 1.20175E-5 41606 0 NA
6-34962079-G-A p.Val435Ile missense+splice_region ANKS1A 1 83160 1.2025E-5 41580 0 3.18431E-5
6-34962083-T-A p.Leu436Gln missense ANKS1A 1 83176 1.20227E-5 41588 0 NA
6-34962088-A-G p.Met438Val missense ANKS1A 3 83184 3.60646E-5 41592 0 3.1841E-5
6-34962089-T-C p.Met438Thr missense ANKS1A 1 83188 1.2021E-5 41594 0 6.36902E-5
6-34962099-G-A p.Arg441Arg synonymous ANKS1A 2 83192 2.40408E-5 41596 0 NA
6-34962100-A-G p.Ile442Val missense ANKS1A 1 83190 1.20207E-5 41595 0 NA
6-34962104-A-G p.His443Arg missense ANKS1A 2 83198 2.4039E-5 41599 0 5.03525E-4
6-34962117-C-T p.Ala447Ala synonymous ANKS1A 10 83198 1.20195E-4 41599 0 3.78913E-4
6-34962118-C-T p.Arg448Trp missense ANKS1A 2 83196 2.40396E-5 41598 0 3.18492E-5
6-34962119-G-A p.Arg448Gln missense ANKS1A 4 83202 4.80758E-5 41601 0 5.03525E-4
6-34962133-C-T p.His453Tyr missense ANKS1A 1 83204 1.20187E-5 41602 0 NA
6-34962155-C-G p.Thr460Arg missense ANKS1A 1 83218 1.20166E-5 41609 0 2.47129E-5
6-34962161-A-C p.Glu462Ala missense ANKS1A 1 83220 1.20163E-5 41610 0 NA
6-34962163-A-G p.Thr463Ala missense ANKS1A 7 83218 8.41164E-5 41609 0 1.15327E-4
6-34962172-G-C p.Val466Leu missense ANKS1A 1 83230 1.20149E-5 41615 0 8.23791E-6
6-34962173-T-C p.Val466Ala missense ANKS1A 1 83222 1.20161E-5 41611 0 NA
6-34962192-A-G p.Lys472Lys synonymous ANKS1A 3 83228 3.60456E-5 41614 0 7.95843E-6
6-34962193-A-G p.Thr473Ala missense ANKS1A 295 83216 0.00354499 41608 1 0.0043963
6-34962203-C-G c.1423+4C>G splice_region ANKS1A 123 83180 0.00147872 41590 0 0.0025
6-34985242-A-G c.1424-8A>G splice_region ANKS1A 42 80470 5.21934E-4 40235 0 2.7569E-4
6-34985245-C-G c.1424-5C>G splice_region ANKS1A 1 80556 1.24137E-5 40278 0 8.99038E-6
6-34985252-C-T p.His476Tyr missense+splice_region ANKS1A 3 80714 3.71683E-5 40357 0 5.26085E-4
6-34985258-C-T p.Arg478Trp missense ANKS1A 9 80682 1.11549E-4 40341 0 4.77768E-4
6-34985262-G-A p.Ser479Asn missense ANKS1A 1 80718 1.23888E-5 40359 0 8.76701E-6
6-34985271-G-A p.Ser482Asn missense ANKS1A 1 80848 1.23689E-5 40424 0 4.10556E-6
6-34985274-G-A p.Arg483Gln missense ANKS1A 1 80818 1.23735E-5 40409 0 1.27413E-4
6-34985277-G-A p.Ser484Asn missense ANKS1A 1 80896 1.23616E-5 40448 0 NA
6-34985289-C-T p.Ala488Val missense ANKS1A 1 80948 1.23536E-5 40474 0 6.37064E-5
6-34985290-G-A p.Ala488Ala synonymous ANKS1A 7 80986 8.64347E-5 40493 0 5.11989E-5
6-34985302-C-T p.Asp492Asp synonymous ANKS1A 8 81000 9.87654E-5 40500 0 4.43896E-5
6-34985303-G-A p.Gly493Arg missense ANKS1A 4 81034 4.9362E-5 40517 0 6.04858E-5
6-34985311-C-A p.Val495Val synonymous ANKS1A 4 81260 4.92247E-5 40630 0 1.91144E-4
6-34985335-C-T p.Leu503Leu synonymous ANKS1A 1 81856 1.22166E-5 40928 0 8.41637E-6
6-34985338-C-T p.His504His synonymous ANKS1A 1 81944 1.22035E-5 40972 0 8.41595E-6
6-34985340-G-A p.Gly505Asp missense ANKS1A 4 81958 4.88055E-5 40979 0 3.18573E-5
6-34985350-G-A p.Pro508Pro synonymous ANKS1A 15 82018 1.82887E-4 41009 0 5.41608E-4
6-34985352-T-C p.Val509Ala missense ANKS1A 1 82100 1.21803E-5 41050 0 6.37186E-5
6-34985355-G-A p.Cys510Tyr missense ANKS1A 1 82254 1.21575E-5 41127 0 2.00439E-5
6-34985356-C-T p.Cys510Cys synonymous ANKS1A 2 82228 2.43226E-5 41114 0 3.60834E-5
6-34985370-AC-A p.Pro516fs frameshift ANKS1A 1 82492 1.21224E-5 41246 0 NA
6-34985374-TTTCCA-T p.Phe517fs frameshift ANKS1A 1 82592 1.21077E-5 41296 0 NA
6-34985383-G-A p.Leu519Leu synonymous ANKS1A 1 82524 1.21177E-5 41262 0 NA
6-34985388-G-C p.Cys521Ser missense ANKS1A 1 82550 1.21139E-5 41275 0 NA
6-34985388-G-A p.Cys521Tyr missense ANKS1A 1 82550 1.21139E-5 41275 0 NA
6-34985392-C-T p.Thr522Thr synonymous ANKS1A 3 82506 3.6361E-5 41253 0 4.20819E-5
6-34985393-G-C p.Ala523Pro missense ANKS1A 13 82452 1.57667E-4 41226 0 6.25E-4
6-34985393-G-A p.Ala523Thr missense ANKS1A 5 82452 6.06413E-5 41226 0 3.36683E-5
6-34985407-T-C p.His527His synonymous ANKS1A 4 82446 4.85166E-5 41223 0 8.43526E-6
6-34985413-C-T p.Asp529Asp synonymous ANKS1A 5 82278 6.07696E-5 41139 0 3.82677E-4
6-34985414-G-A p.Gly530Arg missense ANKS1A 5 82320 6.07386E-5 41160 0 8.04363E-6
6-34985418-C-T p.Ser531Phe missense ANKS1A 2 82546 2.42289E-5 41273 1 6.25E-4
6-34985421-C-G p.Pro532Arg missense ANKS1A 1 82580 1.21095E-5 41290 0 NA
6-34985431-C-T p.Gly535Gly synonymous ANKS1A 2 82504 2.42412E-5 41252 0 NA
6-34985439-A-C p.His538Pro missense ANKS1A 2 82884 2.41301E-5 41442 0 5.03525E-4
6-34985446-C-T p.Ala540Ala synonymous ANKS1A 9 82912 1.08549E-4 41456 0 9.56023E-5
6-34985458-G-C p.Leu544Leu synonymous ANKS1A 2 82974 2.41039E-5 41487 0 3.99588E-6
6-34985459-G-C p.Glu545Gln missense ANKS1A 3 82972 3.61568E-5 41486 0 8.32515E-6
6-34985463-A-T p.Glu546Val missense ANKS1A 1 82962 1.20537E-5 41481 0 NA
6-34985466-C-T p.Thr547Met missense ANKS1A 7 82958 8.438E-5 41479 1 2.23086E-4
6-34985469-G-A p.Gly548Asp missense ANKS1A 1 82964 1.20534E-5 41482 0 NA
6-34985474-C-T p.His550Tyr missense ANKS1A 54 82950 6.50995E-4 41475 2 0.0010195
6-34985475-A-G p.His550Arg missense ANKS1A 4 82970 4.82102E-5 41485 0 NA
6-34985496-C-T p.Pro557Leu missense ANKS1A 1 82922 1.20595E-5 41461 0 NA
6-34985521-A-C p.Arg565Ser missense ANKS1A 4 82834 4.82893E-5 41417 0 8.2765E-6
6-34985558-C-G p.Arg578Gly missense ANKS1A 680 82524 0.00824003 41262 5 0.01375
6-34985558-C-T p.Arg578Cys missense ANKS1A 4 82534 4.84649E-5 41267 0 9.5584E-5
6-34985559-G-A p.Arg578His missense ANKS1A 12 82466 1.45515E-4 41233 0 3.82434E-4
6-34985563-G-A p.Ser579Ser synonymous ANKS1A 1225 82390 0.0148683 41195 36 0.031875
6-34985567-C-G p.Pro581Ala missense ANKS1A 1 82464 1.21265E-5 41232 0 3.18613E-5
6-34985585-A-G p.Thr587Ala missense ANKS1A 1 82420 1.2133E-5 41210 0 3.97858E-6
6-34985594-C-G p.Pro590Ala missense ANKS1A 2 82380 2.42777E-5 41190 0 NA
6-34985595-C-T p.Pro590Leu missense ANKS1A 5 82372 6.07002E-5 41186 0 9.09181E-5
6-34985599-C-T p.His591His synonymous ANKS1A 2 82376 2.42789E-5 41188 0 1.65265E-5
6-34985624-C-T p.Arg600Trp missense ANKS1A 1 82464 1.21265E-5 41232 0 4.13012E-5
6-34985625-G-T p.Arg600Leu missense ANKS1A 1 82494 1.21221E-5 41247 0 3.18613E-5
6-34985628-G-A p.Ser601Asn missense ANKS1A 1 82476 1.21247E-5 41238 0 NA
6-34985630-G-A p.Gly602Arg missense ANKS1A 1 82486 1.21233E-5 41243 0 NA
6-34985632-G-T p.Gly602Gly synonymous ANKS1A 12 82484 1.45483E-4 41242 0 7.32811E-4
6-34985632-G-A p.Gly602Gly synonymous ANKS1A 3 82484 3.63707E-5 41242 0 3.18613E-5
6-34985640-G-A p.Ser605Asn missense ANKS1A 6 82516 7.27132E-5 41258 0 7.55948E-5
6-34985641-C-T p.Ser605Ser synonymous ANKS1A 1 82504 1.21206E-5 41252 0 3.9789E-6
6-34985643-G-A p.Arg606Gln missense ANKS1A 2 82522 2.4236E-5 41261 0 4.37654E-5
6-34985646-C-T p.Ala607Val missense ANKS1A 1 82528 1.21171E-5 41264 0 0.00100705
6-34985654-A-G p.Thr610Ala missense ANKS1A 16 82666 1.9355E-4 41333 0 1.48544E-4
6-34985680-A-C p.Lys618Asn missense ANKS1A 4 82726 4.83524E-5 41363 0 3.18898E-5
6-34985687-C-T p.Arg621Cys missense ANKS1A 1 82752 1.20843E-5 41376 0 6.37024E-5
6-34985688-G-A p.Arg621His missense ANKS1A 1 82752 1.20843E-5 41376 0 7.95577E-6
6-34985716-C-T p.Leu630Leu synonymous ANKS1A 220 82816 0.00265649 41408 1 0.0056051
6-34985738-G-T p.Asp638Tyr missense ANKS1A 1 82756 1.20837E-5 41378 0 1.98888E-5
6-34985750-G-T p.Gly642Trp missense ANKS1A 1 82674 1.20957E-5 41337 0 2.48633E-5
6-34985756-C-T p.Arg644Trp missense ANKS1A 4 82564 4.84473E-5 41282 0 2.48773E-5
6-34985757-G-A p.Arg644Gln missense ANKS1A 1 82550 1.21139E-5 41275 0 6.25E-4
6-34985773-C-T p.Ser649Ser synonymous ANKS1A 5 82282 6.07666E-5 41141 0 6.77231E-5
6-34985788-G-A p.Gly654Gly synonymous ANKS1A 1 81946 1.22032E-5 40973 0 NA
6-34985800-A-G p.Leu658Leu synonymous ANKS1A 1929 81562 0.0236507 40781 35 0.034375
6-34985818-C-T p.Phe664Phe synonymous ANKS1A 2 80952 2.4706E-5 40476 0 3.18674E-5
6-34985819-G-A p.Ala665Thr missense ANKS1A 1 80830 1.23716E-5 40415 0 1.70657E-5
6-34985821-C-T p.Ala665Ala synonymous ANKS1A 1 80830 1.23716E-5 40415 0 8.5365E-6
6-34985823-C-T p.Ser666Leu missense ANKS1A 4 80728 4.95491E-5 40364 0 3.18654E-5
6-34985836-G-GATTGAGAAAATCATGA c.2010_2010+1insATTGAGAAAATCATGA splice_donor ANKS1A 3 80380 3.73227E-5 40190 0 NA
6-35021868-C-T c.2011-8C>T splice_region ANKS1A 1 83142 1.20276E-5 41571 0 1.19318E-5
6-35021926-A-T p.Glu687Asp missense ANKS1A 1 83340 1.1999E-5 41670 0 8.23683E-6
6-35021927-C-T p.Arg688Trp missense ANKS1A 4 83324 4.80054E-5 41662 0 0.00151057
6-35021928-G-A p.Arg688Gln missense ANKS1A 12 83326 1.44013E-4 41663 0 1.59215E-4
6-35021947-C-T c.2077+5C>T splice_region ANKS1A 1 83246 1.20126E-5 41623 0 3.1841E-5
6-35021948-G-A c.2077+6G>A splice_region ANKS1A 3 83242 3.60395E-5 41621 0 3.1839E-5
6-35027927-T-C p.Leu694Ser missense ANKS1A 80836 81270 0.99466 40635 40217 0.997028
6-35027929-C-T p.Arg695Trp missense ANKS1A 2 82740 2.41721E-5 41370 0 2.55842E-5
6-35027931-G-A p.Arg695Arg synonymous ANKS1A 1 82774 1.20811E-5 41387 0 NA
6-35027936-T-C p.Leu697Pro missense ANKS1A 1 82828 1.20732E-5 41414 0 4.00035E-6
6-35027943-G-T p.Gln699His missense ANKS1A 2 82846 2.41412E-5 41423 0 3.5987E-5
6-35027949-C-T p.Val701Val synonymous ANKS1A 2 82836 2.41441E-5 41418 1 1.19938E-5
6-35027955-G-A p.Glu703Glu synonymous ANKS1A 1 82784 1.20796E-5 41392 0 6.25E-4
6-35027966-C-T p.Ser707Leu missense ANKS1A 1 82428 1.21318E-5 41214 0 3.18634E-5
6-35027967-G-A p.Ser707Ser synonymous ANKS1A 15 82444 1.81942E-4 41222 0 2.13981E-4
6-35027970-T-A p.Ile708Ile synonymous ANKS1A 1 82488 1.2123E-5 41244 0 NA
6-35027981-A-T p.Gln712Leu missense ANKS1A 1 82556 1.2113E-5 41278 0 NA
6-35027982-G-A p.Gln712Gln synonymous ANKS1A 2 82562 2.42242E-5 41281 0 1.82202E-5
6-35027985-T-C p.Tyr713Tyr synonymous ANKS1A 1 82574 1.21103E-5 41287 0 NA
6-35028003-G-A p.Leu719Leu synonymous ANKS1A 3 82626 3.63082E-5 41313 0 9.55597E-5
6-35028015-C-T p.Asp723Asp synonymous ANKS1A 2 82496 2.42436E-5 41248 0 6.37349E-5
6-35028020-T-G p.Val725Gly missense ANKS1A 2 82466 2.42524E-5 41233 0 NA
6-35028031-G-GGGTC c.2184+1_2184+2insGGTC splice_donor ANKS1A 2 82348 2.42872E-5 41174 0 NA
6-35028035-G-T c.2184+5G>T splice_region ANKS1A 1 82262 1.21563E-5 41131 0 1.12418E-5
6-35028035-G-GTGGC c.2184+5_2184+6insTGGC splice_region ANKS1A 1 82262 1.21563E-5 41131 0 4.16816E-6
6-35046328-C-T c.2185-7C>T splice_region ANKS1A 4 82530 4.84672E-5 41265 0 NA
6-35046330-C-T c.2185-5C>T splice_region ANKS1A 3 82570 3.63328E-5 41285 0 8.28418E-6
6-35046337-G-C p.Gly729Gly splice_region+synonymous ANKS1A 1 82686 1.20939E-5 41343 0 4.01852E-6
6-35046365-C-T p.Arg739Trp missense ANKS1A 1 82900 1.20627E-5 41450 0 4.14044E-5
6-35046366-G-A p.Arg739Gln missense ANKS1A 3 82920 3.61795E-5 41460 0 1.21181E-5
6-35046373-C-A p.Ile741Ile synonymous ANKS1A 1 82934 1.20578E-5 41467 0 4.05075E-6
6-35046374-G-A p.Gly742Ser missense ANKS1A 2 82932 2.41161E-5 41466 0 NA
6-35046382-C-T p.Ser744Ser synonymous ANKS1A 3 82928 3.6176E-5 41464 0 6.37755E-5
6-35046391-G-A p.Gln747Gln synonymous ANKS1A 4 82928 4.82346E-5 41464 0 NA
6-35046396-G-A p.Arg749Gln missense ANKS1A 33 82894 3.98099E-4 41447 0 0.0025
6-35046396-G-T p.Arg749Leu missense ANKS1A 1 82896 1.20633E-5 41448 0 NA
6-35046398-C-T p.Arg750Trp missense ANKS1A 1 82890 1.20642E-5 41445 0 6.25E-4
6-35046399-G-A p.Arg750Gln missense ANKS1A 5 82880 6.03282E-5 41440 0 9.56694E-5
6-35046414-C-T p.Ala755Val missense ANKS1A 1 82638 1.2101E-5 41319 0 3.18817E-5
6-35046414-C-A p.Ala755Glu missense ANKS1A 2 82638 2.42019E-5 41319 0 8.3453E-6
6-35046415-G-A p.Ala755Ala synonymous ANKS1A 5 82608 6.05268E-5 41304 0 2.50384E-5
6-35046416-G-T p.Ala756Ser missense ANKS1A 1 82598 1.21068E-5 41299 0 1.50263E-4
6-35046419-C-T p.Arg757Cys missense ANKS1A 1 82520 1.21183E-5 41260 0 1.65419E-5
6-35046420-G-A p.Arg757His missense ANKS1A 1 82458 1.21274E-5 41229 0 8.35799E-6
6-35046427-A-C p.Leu759Leu synonymous ANKS1A 3 82282 3.646E-5 41141 0 NA
6-35046430-C-T p.Pro760Pro synonymous ANKS1A 1 82260 1.21566E-5 41130 0 3.18715E-5
6-35046437-A-AAGGCTCTGGGTTATGACGGGAACAG c.2283+4_2283+5insAGGCTCTGGGTTATGACGGGAACAG splice_region ANKS1A 2 81988 2.43938E-5 40994 1 NA
6-35046437-A-AAGGCTCTGGGTTATGACGGGAACAGCCC c.2283+4_2283+5insAGGCTCTGGGTTATGACGGGAACAGCCC splice_region ANKS1A 1 81986 1.21972E-5 40993 0 NA
6-35046438-C-G c.2283+5C>G splice_region ANKS1A 10 81956 1.22017E-4 40978 0 1.27518E-4
6-35047312-A-G p.Asp768Gly missense ANKS1A 1 83194 1.20201E-5 41597 0 3.18939E-5
6-35047313-C-T p.Asp768Asp synonymous ANKS1A 21 83198 2.5241E-4 41599 0 3.18898E-4
6-35047319-C-T p.Asn770Asn synonymous ANKS1A 2 83220 2.40327E-5 41610 0 3.29919E-5
6-35047326-C-A p.Pro773Thr missense ANKS1A 1 83224 1.20158E-5 41612 0 3.18939E-5
6-35047331-C-T p.Ser774Ser synonymous ANKS1A 2 83224 2.40315E-5 41612 0 3.18837E-5
6-35047337-C-T p.Pro776Pro synonymous ANKS1A 11 83258 1.32119E-4 41629 0 7.55912E-5
6-35047344-C-T p.Leu779Leu synonymous ANKS1A 5 83256 6.00557E-5 41628 0 NA
6-35047370-C-T p.Tyr787Tyr synonymous ANKS1A 1 83294 1.20057E-5 41647 0 3.18776E-5
6-35047371-G-A p.Val788Ile missense ANKS1A 34 83280 4.08261E-4 41640 1 5.03525E-4
6-35047372-T-A p.Val788Asp missense ANKS1A 25 83306 3.00098E-4 41653 0 3.29592E-5
6-35047394-T-A p.Gly795Gly synonymous ANKS1A 1 83292 1.2006E-5 41646 0 NA
6-35047397-C-T p.Tyr796Tyr synonymous ANKS1A 1 83292 1.2006E-5 41646 0 2.47158E-5
6-35047403-C-T p.Ser798Ser synonymous ANKS1A 1 83296 1.20054E-5 41648 0 8.239E-6
6-35047405-T-C p.Ile799Thr missense ANKS1A 3 83286 3.60205E-5 41643 0 6.25E-4
6-35047406-T-G p.Ile799Met missense ANKS1A 2 83292 2.40119E-5 41646 0 8.23873E-6
6-35047412-C-T p.Thr801Thr synonymous ANKS1A 353 83270 0.00423922 41635 5 0.00968708
6-35047413-G-A p.Val802Met missense ANKS1A 2 83276 2.40165E-5 41638 0 6.3743E-5
6-35047425-T-G p.Trp806Gly missense ANKS1A 1 83256 1.20111E-5 41628 0 NA
6-35047431-C-T p.Leu808Leu synonymous ANKS1A 1 83236 1.2014E-5 41618 0 8.24117E-6
6-35047446-G-GTCC c.2436+1_2436+2insTCC splice_donor ANKS1A 2 83202 2.40379E-5 41601 1 NA
6-35047601-C-T p.Leu814Leu synonymous ANKS1A 1 82372 1.214E-5 41186 0 NA
6-35047618-C-A p.Leu819Leu synonymous ANKS1A 1 82320 1.21477E-5 41160 0 1.15413E-4
6-35047619-G-A p.Gly820Ser missense ANKS1A 1 82318 1.2148E-5 41159 0 1.06943E-5
6-35047632-G-A p.Arg824His missense ANKS1A 1 82256 1.21572E-5 41128 0 3.18552E-5
6-35047639-C-T p.Ile826Ile synonymous ANKS1A 2 82194 2.43327E-5 41097 0 6.37064E-5
6-35047648-C-T p.Leu829Leu synonymous ANKS1A 2 82170 2.43398E-5 41085 0 NA
6-35047653-A-G p.Asp831Gly missense ANKS1A 1 82158 1.21717E-5 41079 0 5.69353E-6
6-35047656-G-A p.Arg832Lys missense ANKS1A 13 82154 1.58239E-4 41077 0 5.08647E-4
6-35047658-C-A p.Pro833Thr missense ANKS1A 1 82136 1.21749E-5 41068 0 NA
6-35047659-C-T p.Pro833Leu missense ANKS1A 2 82094 2.43623E-5 41047 0 1.7375E-5
6-35047660-G-A p.Pro833Pro synonymous ANKS1A 3 82106 3.65381E-5 41053 0 7.89827E-5
6-35047662-A-G p.Tyr834Cys missense ANKS1A 1 82064 1.21856E-5 41032 0 NA
6-35047663-C-T p.Tyr834Tyr synonymous ANKS1A 6 82034 7.31404E-5 41017 0 9.55231E-5
6-35047665-A-C p.Glu835Ala missense ANKS1A 1 82020 1.21921E-5 41010 0 NA
6-35047666-G-A p.Glu835Glu synonymous ANKS1A 2 82060 2.43724E-5 41030 0 2.3525E-5
6-35047672-G-A p.Pro837Pro synonymous ANKS1A 1 82016 1.21927E-5 41008 0 8.44096E-5
6-35047684-C-T p.Pro841Pro synonymous ANKS1A 9 81988 1.09772E-4 40994 0 0.00102145
6-35047688-A-C p.Arg843Arg synonymous ANKS1A 1 81928 1.22058E-5 40964 0 1.21666E-5
6-35047689-G-C p.Arg843Thr missense ANKS1A 1 81938 1.22043E-5 40969 0 NA
6-35047704-G-A p.Arg848Lys missense+splice_region ANKS1A 3 81760 3.66928E-5 40880 0 1.00095E-4
6-35047705-G-GT c.2544_2544+1insT splice_donor ANKS1A 1 81752 1.22321E-5 40876 0 NA
6-35047712-C-T c.2544+7C>T splice_region ANKS1A 1 81580 1.22579E-5 40790 0 9.46163E-5
6-35048766-C-T c.2545-5C>T splice_region ANKS1A 2 83148 2.40535E-5 41574 0 3.99862E-6
6-35048767-A-T c.2545-4A>T splice_region ANKS1A 2 83160 2.405E-5 41580 0 NA
6-35048767-A-G c.2545-4A>G splice_region ANKS1A 1 83160 1.2025E-5 41580 0 NA
6-35048768-C-T c.2545-3C>T splice_region ANKS1A 5 83176 6.01135E-5 41588 0 1.91327E-4
6-35048793-C-T p.Thr856Met missense ANKS1A 3 83280 3.60231E-5 41640 0 9.56023E-5
6-35048794-G-A p.Thr856Thr synonymous ANKS1A 6 83280 7.20461E-5 41640 0 2.14692E-4
6-35048803-A-G p.Pro859Pro synonymous ANKS1A 2 83282 2.40148E-5 41641 0 NA
6-35048809-T-C p.Ser861Ser synonymous ANKS1A 3 83278 3.60239E-5 41639 0 3.29859E-5
6-35048815-T-C p.Asn863Asn synonymous ANKS1A 1 83268 1.20094E-5 41634 0 8.24443E-6
6-35048822-T-G p.Cys866Gly missense ANKS1A 1 83264 1.201E-5 41632 0 NA
6-35048826-C-T p.Thr867Ile missense ANKS1A 9 83262 1.08093E-4 41631 0 NA
6-35048827-T-C p.Thr867Thr synonymous ANKS1A 2 83258 2.40217E-5 41629 0 1.64832E-5
6-35048827-T-G p.Thr867Thr synonymous ANKS1A 1 83258 1.20109E-5 41629 0 NA
6-35048828-G-A p.Gly868Arg missense ANKS1A 3 83254 3.60343E-5 41627 0 1.1937E-5
6-35048835-C-T p.Ser870Leu missense ANKS1A 1 83230 1.20149E-5 41615 0 6.37633E-5
6-35048836-G-A p.Ser870Ser synonymous ANKS1A 11 83232 1.32161E-4 41616 0 2.87026E-4
6-35048838-C-A p.Ala871Glu missense ANKS1A 1 83222 1.20161E-5 41611 0 NA
6-35048853-C-A p.Pro876His missense ANKS1A 2 83164 2.40489E-5 41582 0 NA
6-35048859-G-A p.Gly878Glu missense ANKS1A 1 83118 1.20311E-5 41559 0 NA
6-35048861-G-T p.Asp879Tyr missense ANKS1A 1 83094 1.20346E-5 41547 0 NA
6-35048874-G-A p.Arg883Lys missense ANKS1A 4 82948 4.8223E-5 41474 0 3.18817E-5
6-35048876-C-T p.Arg884Cys missense ANKS1A 4 82888 4.82579E-5 41444 0 5.03525E-4
6-35048877-G-A p.Arg884His missense ANKS1A 2 82898 2.4126E-5 41449 0 8.25219E-6
6-35048899-T-C p.Pro891Pro synonymous ANKS1A 2199 82418 0.0266811 41209 30 0.0427996
6-35048899-TGC-CGT p.ProAla891ProVal missense ANKS1A 1 82576 1.21101E-5 41288 0 NA
6-35048901-C-T p.Ala892Val missense ANKS1A 9 82434 1.09178E-4 41217 0 1.24958E-4
6-35048902-G-A p.Ala892Ala synonymous ANKS1A 6 82412 7.28049E-5 41206 0 1.27551E-4
6-35048907-C-T p.Pro894Leu missense ANKS1A 11 82274 1.337E-4 41137 0 0.0025
6-35048913-G-A p.Arg896Gln missense ANKS1A 4 81974 4.8796E-5 40987 0 4.14647E-4
6-35048916-C-T p.Ala897Val missense ANKS1A 8 81826 9.77684E-5 40913 0 4.33584E-5
6-35048917-G-A p.Ala897Ala synonymous ANKS1A 3 81692 3.67233E-5 40846 0 2.60331E-5
6-35048921-C-T p.Arg899Cys missense ANKS1A 4 81394 4.91437E-5 40697 0 3.18817E-5
6-35048922-G-A p.Arg899His missense ANKS1A 4 81152 4.92902E-5 40576 0 5.03525E-4
6-35048923-C-A p.Arg899Arg synonymous ANKS1A 1 81138 1.23247E-5 40569 0 NA
6-35048935-G-GGAGGAGCACC c.2709_2709+1insGAGGAGCACC splice_donor ANKS1A 3 80214 3.74E-5 40107 1 NA
6-35048942-CA-C c.2709+8delA splice_region ANKS1A 20 79352 2.52042E-4 39676 0 1.08436E-4
6-35050463-C-T c.2710-5C>T splice_region ANKS1A 9 81450 1.10497E-4 40725 0 9.56511E-5
6-35050464-G-A c.2710-4G>A splice_region ANKS1A 4 81474 4.90954E-5 40737 0 5.12269E-5
6-35050470-G-C p.Glu904Asp missense+splice_region ANKS1A 1 81936 1.22046E-5 40968 0 NA
6-35050478-G-A p.Arg907His missense ANKS1A 19 82214 2.31104E-4 41107 0 3.18796E-4
6-35050482-G-C p.Glu908Asp missense ANKS1A 1 82410 1.21345E-5 41205 0 3.18776E-5
6-35050482-G-A p.Glu908Glu synonymous ANKS1A 1 82410 1.21345E-5 41205 0 NA
6-35050497-G-A p.Leu913Leu synonymous ANKS1A 1 82660 1.20978E-5 41330 0 8.30372E-6
6-35050499-G-A p.Arg914Gln missense ANKS1A 8 82654 9.6789E-5 41327 0 4.14876E-5
6-35050502-C-G p.Pro915Arg missense ANKS1A 2 82758 2.41668E-5 41379 0 8.28871E-6
6-35050506-G-A p.Pro916Pro synonymous ANKS1A 67235 82160 0.818342 41080 27676 0.857089
6-35050513-G-A p.Ala919Thr missense ANKS1A 3 82916 3.61812E-5 41458 0 NA
6-35050524-C-T p.Tyr922Tyr synonymous ANKS1A 1 83020 1.20453E-5 41510 0 6.25E-4
6-35050525-G-A p.Ala923Thr missense ANKS1A 4 83012 4.81858E-5 41506 0 5.04032E-4
6-35050531-G-T p.Val925Leu missense ANKS1A 17 83076 2.04632E-4 41538 0 5.04032E-4
6-35050531-G-C p.Val925Leu missense ANKS1A 1 83076 1.20372E-5 41538 0 9.55597E-5
6-35050551-G-A p.Gln931Gln synonymous ANKS1A 1 83116 1.20314E-5 41558 0 1.65123E-5
6-35050557-G-A p.Glu933Glu synonymous ANKS1A 1 83128 1.20296E-5 41564 0 1.19459E-5
6-35050570-G-A p.Glu938Lys missense ANKS1A 1 83114 1.20317E-5 41557 0 9.11335E-5
6-35050589-C-T p.Ala944Val missense ANKS1A 2 83096 2.40685E-5 41548 0 3.18593E-5
6-35050593-T-C p.Asn945Asn splice_region+synonymous ANKS1A 499 83030 0.00600988 41515 7 0.00793803
6-35050593-T-TTATCTGGGCTCCATGCTGATCAAAGATCTGCGAGGGACAGAATCCAC c.2835_2835+1insTATCTGGGCTCCATGCTGATCAAAGATCTGCGAGGGACAGAATCCAC splice_donor ANKS1A 2 83086 2.40714E-5 41543 1 NA
6-35050925-C-T c.2836-7C>T splice_region ANKS1A 1 82006 1.21942E-5 41003 0 6.76973E-5
6-35050940-C-A p.Gly948Gly synonymous ANKS1A 8 82080 9.74659E-5 41040 0 2.22973E-4
6-35050952-C-G p.Ile952Met missense ANKS1A 6 82072 7.31065E-5 41036 0 1.59266E-4
6-35050963-G-A p.Arg956Gln missense ANKS1A 6 82022 7.31511E-5 41011 0 7.56243E-5
6-35050970-A-G p.Thr958Thr synonymous ANKS1A 1 82080 1.21832E-5 41040 0 NA
6-35050978-C-T p.Thr961Met missense ANKS1A 1 81916 1.22076E-5 40958 0 NA
6-35050985-C-T p.Asp963Asp synonymous ANKS1A 2 81856 2.44332E-5 40928 0 NA
6-35050992-G-T p.Ala966Ser missense ANKS1A 1 81880 1.2213E-5 40940 0 NA
6-35051001-C-A p.Arg969Arg splice_region+synonymous ANKS1A 1 81776 1.22285E-5 40888 0 NA
6-35051191-T-C c.2908-3T>C splice_region ANKS1A 3 82496 3.63654E-5 41248 0 3.18959E-5
6-35051201-C-T p.Thr972Met missense ANKS1A 2 82520 2.42365E-5 41260 0 NA
6-35051202-G-A p.Thr972Thr synonymous ANKS1A 7 82542 8.48053E-5 41271 0 3.97896E-5
6-35051210-TGAA-T p.Lys977del disruptive_inframe_deletion ANKS1A 1 82634 1.21016E-5 41317 0 3.19407E-5
6-35051216-A-G p.Lys977Arg missense ANKS1A 1 82706 1.2091E-5 41353 0 NA
6-35051226-C-T p.Thr980Thr synonymous ANKS1A 1 82792 1.20785E-5 41396 0 8.239E-6
6-35051232-C-G p.Ile982Met missense ANKS1A 2 82854 2.41388E-5 41427 0 NA
6-35051259-G-A p.Lys991Lys synonymous ANKS1A 4 82990 4.81986E-5 41495 0 5.03525E-4
6-35051265-C-T p.Ile993Ile synonymous ANKS1A 40 82984 4.82021E-4 41492 1 0.00125
6-35051266-G-A p.Asp994Asn missense ANKS1A 5 82974 6.02598E-5 41487 0 1.6478E-5
6-35051280-G-GAAC c.2994_2994+1insAAC splice_donor ANKS1A 2 82930 2.41167E-5 41465 1 NA
6-35051895-C-T c.2995-3C>T splice_region ANKS1A 1 82546 1.21145E-5 41273 0 8.26761E-6
6-35051900-C-T p.Asn999Asn splice_region+synonymous ANKS1A 3 82680 3.62845E-5 41340 0 2.47766E-5
6-35051901-G-A p.Val1000Ile missense ANKS1A 1 82710 1.20904E-5 41355 0 3.18674E-5
6-35051915-C-T p.His1004His synonymous ANKS1A 5 82940 6.02845E-5 41470 0 6.37186E-5
6-35051923-G-A p.Arg1007Gln missense ANKS1A 6 83082 7.22178E-5 41541 0 1.27478E-4
6-35051939-G-A p.Ala1012Ala synonymous ANKS1A 10 83144 1.20273E-4 41572 0 1.5911E-5
6-35051948-C-T p.Asp1015Asp synonymous ANKS1A 2 83194 2.40402E-5 41597 0 1.64905E-5
6-35051949-C-A p.Pro1016Thr missense ANKS1A 1 83188 1.2021E-5 41594 0 3.97706E-6
6-35051951-G-A p.Pro1016Pro synonymous ANKS1A 1 83196 1.20198E-5 41598 0 5.03525E-4
6-35051969-T-C p.Phe1022Phe synonymous ANKS1A 7 83196 8.41387E-5 41598 0 8.35262E-5
6-35051972-C-G p.Ala1023Ala synonymous ANKS1A 1 83198 1.20195E-5 41599 0 NA
6-35051995-C-G p.Thr1031Ser missense ANKS1A 7 83124 8.42115E-5 41562 0 3.30306E-5
6-35052027-G-A p.Val1042Met missense ANKS1A 29 82808 3.50208E-4 41404 0 5.04541E-4
6-35052034-TGGTGG-T p.Asn1045fs frameshift ANKS1A 9 82616 1.08938E-4 41308 4 NA
6-35052034-T-C p.Val1044Ala missense+splice_region ANKS1A 3 82616 3.63126E-5 41308 0 NA
6-35053539-C-A c.3133-4C>A splice_region ANKS1A 3 83136 3.60855E-5 41568 0 NA
6-35053545-C-T p.Asn1045Asn splice_region+synonymous ANKS1A 3 83176 3.60681E-5 41588 0 NA
6-35053554-C-T p.Tyr1048Tyr synonymous ANKS1A 1 83212 1.20175E-5 41606 0 4.40025E-5
6-35053566-G-A p.Leu1052Leu synonymous ANKS1A 1 83244 1.20129E-5 41622 0 NA
6-35053569-G-A p.Thr1053Thr synonymous ANKS1A 11 83256 1.32123E-4 41628 0 1.27527E-4
6-35053600-T-C p.Leu1064Leu synonymous ANKS1A 1 83268 1.20094E-5 41634 0 NA
6-35053613-C-A p.Ala1068Asp missense ANKS1A 1 83246 1.20126E-5 41623 0 NA
6-35053614-C-T p.Ala1068Ala synonymous ANKS1A 2 83242 2.40263E-5 41621 0 8.32279E-6
6-35053626-G-A p.Arg1072Arg synonymous ANKS1A 1 83242 1.20132E-5 41621 0 3.98457E-6
6-35053631-C-T p.Thr1074Met missense ANKS1A 12 83228 1.44182E-4 41614 0 3.58671E-5
6-35053632-G-A p.Thr1074Thr synonymous ANKS1A 1 83240 1.20135E-5 41620 0 8.33167E-6
6-35053635-C-T p.Gly1075Gly synonymous ANKS1A 2 83242 2.40263E-5 41621 0 6.25E-4
6-35053656-T-G p.Ile1082Met missense ANKS1A 1 83204 1.20187E-5 41602 0 NA
6-35053674-AC-A p.Pro1089fs frameshift ANKS1A 1 83020 1.20453E-5 41510 0 NA
6-35053676-C-G p.Pro1089Arg missense ANKS1A 19 83004 2.28905E-4 41502 0 1.72096E-4
6-35053676-C-T p.Pro1089Leu missense ANKS1A 3 83004 3.61428E-5 41502 0 3.18695E-5
6-35053677-G-A p.Pro1089Pro synonymous ANKS1A 28 82984 3.37414E-4 41492 0 2.5479E-4
6-35053688-C-T p.Pro1093Leu missense ANKS1A 2 82816 2.41499E-5 41408 0 3.18817E-5
6-35053691-G-A p.Arg1094Gln missense ANKS1A 2 82692 2.41861E-5 41346 0 3.18715E-5
6-35053695-C-T p.Val1095Val synonymous ANKS1A 427 82570 0.00517137 41285 1 0.0207026
6-35053699-G-A p.Val1097Met missense ANKS1A 7 82400 8.49515E-5 41200 0 1.95247E-4
6-35053710-C-T p.Ser1100Ser synonymous ANKS1A 3 82106 3.65381E-5 41053 0 3.18939E-5
6-35053711-G-A p.Ala1101Thr missense+splice_region ANKS1A 3 82002 3.65845E-5 41001 0 2.10821E-5
6-35053717-C-T c.3303+4C>T splice_region ANKS1A 3 81678 3.67296E-5 40839 0 2.7767E-5
6-35053718-G-A c.3303+5G>A splice_region ANKS1A 3 81604 3.67629E-5 40802 0 1.28657E-5
6-35054738-C-A p.Pro1105Thr missense ANKS1A 2 83288 2.40131E-5 41644 0 3.18857E-5
6-35054745-T-C p.Met1107Thr missense ANKS1A 62 83304 7.44262E-4 41652 0 0.0020141
6-35054745-TG-AA p.Met1107Lys missense ANKS1A 1 83304 1.20042E-5 41652 0 NA
6-35054750-C-A p.Gln1109Lys missense ANKS1A 1 83318 1.20022E-5 41659 0 8.2371E-6
6-35054758-C-T p.Ala1111Ala synonymous ANKS1A 2 83322 2.40033E-5 41661 0 NA
6-35054761-A-G p.Gln1112Gln synonymous ANKS1A 3 83328 3.60023E-5 41664 0 5.16931E-5
6-35054764-C-T p.Ser1113Ser synonymous ANKS1A 5 83330 6.00024E-5 41665 0 3.18776E-5
6-35054785-T-C p.Val1120Val synonymous ANKS1A 1 83332 1.20002E-5 41666 0 NA
6-35054786-G-A p.Val1121Met missense ANKS1A 1 83326 1.20011E-5 41663 0 NA
6-35054810-C-T p.Arg1129Trp missense ANKS1A 1 83304 1.20042E-5 41652 0 8.23873E-6
6-35054811-G-A p.Arg1129Gln missense ANKS1A 1 83304 1.20042E-5 41652 0 6.25E-4
6-35054823-C-T p.Thr1133Ile missense ANKS1A 2 83276 2.40165E-5 41638 0 NA
6-35054826-A-C p.Asn1134Thr missense+splice_region ANKS1A 1 83266 1.20097E-5 41633 0 1.64829E-5
6-35057956-C-T c.911-5C>T splice_region ANKS1A 9 51120 1.76056E-4 25560 0 1.85529E-4
6-35057966-G-A p.Asp306Asn missense ANKS1A 1 55190 1.81192E-5 27595 0 2.77984E-4
6-35057970-C-T p.Thr307Ile missense ANKS1A 3 57890 5.18224E-5 28945 0 3.1839E-5
6-35057985-T-C p.Phe312Ser missense ANKS1A 1 64254 1.55632E-5 32127 0 NA
6-35057996-C-T p.Pro316Ser missense ANKS1A 6 68630 8.74253E-5 34315 0 8.20868E-4
6-35057996-C-A p.Pro316Thr missense ANKS1A 2 68630 2.91418E-5 34315 0 NA
6-35058011-T-G p.Ter321Glyext*? stop_lost ANKS1A 1 72542 1.37851E-5 36271 0 7.37376E-6
6-35058512-T-C c.*499T>C splice_region ANKS1A 1 37096 2.69571E-5 18548 0 NA