Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
14-102973213-C-T c.*60G>A splice_region ANKRD9 3 75924 3.95132E-5 37962 0 NA
14-102973214-G-A c.*59C>T splice_region ANKRD9 2 75968 2.63269E-5 37984 0 NA
14-102973279-T-C p.Lys316Lys synonymous ANKRD9 3 79572 3.77017E-5 39786 0 9.55657E-5
14-102973280-T-C p.Lys316Arg missense ANKRD9 1 79590 1.25644E-5 39795 0 6.25E-4
14-102973282-G-A p.Gly315Gly synonymous ANKRD9 2 79686 2.50985E-5 39843 0 NA
14-102973290-G-C p.Leu313Val missense ANKRD9 3 80018 3.74916E-5 40009 0 6.25E-4
14-102973298-G-A p.Pro310Leu missense ANKRD9 1 79806 1.25304E-5 39903 0 NA
14-102973301-T-C p.Gln309Arg missense ANKRD9 1 79806 1.25304E-5 39903 0 NA
14-102973302-GC-G p.Gln309fs frameshift ANKRD9 23 79780 2.88293E-4 39890 0 5.04032E-4
14-102973309-T-C p.Pro306Pro synonymous ANKRD9 3 79626 3.76761E-5 39813 0 9.52444E-6
14-102973334-G-T p.Ala298Asp missense ANKRD9 1 77696 1.28707E-5 38848 0 NA
14-102973339-G-A p.Pro296Pro synonymous ANKRD9 1 77022 1.29833E-5 38511 0 1.14254E-5
14-102973340-G-C p.Pro296Arg missense ANKRD9 1 76926 1.29995E-5 38463 0 NA
14-102973347-G-T p.Arg294Ser missense ANKRD9 3 75356 3.9811E-5 37678 0 3.19428E-5
14-102973363-G-T p.Thr288Thr synonymous ANKRD9 4 71608 5.58597E-5 35804 0 1.27877E-4
14-102973371-G-C p.Leu286Val missense ANKRD9 1 69312 1.44275E-5 34656 0 5.0318E-6
14-102973390-G-A p.Phe279Phe synonymous ANKRD9 2 60590 3.30087E-5 30295 0 3.24338E-5
14-102973392-AGAG-A p.Leu278del conservative_inframe_deletion ANKRD9 30 60138 4.98853E-4 30069 0 6.81349E-4
14-102973396-C-T p.Ser277Ser synonymous ANKRD9 3 58114 5.16227E-5 29057 0 6.51008E-6
14-102973412-C-A p.Gly272Val missense ANKRD9 1 55100 1.81488E-5 27550 0 6.54339E-6
14-102973415-G-C p.Ala271Gly missense ANKRD9 40 52852 7.5683E-4 26426 0 0.180251
14-102973448-C-G p.Arg260Pro missense ANKRD9 1 50016 1.99936E-5 25008 0 9.1083E-6
14-102973457-C-T p.Arg257His missense ANKRD9 20 48308 4.1401E-4 24154 0 6.45953E-4
14-102973457-C-A p.Arg257Leu missense ANKRD9 1 48308 2.07005E-5 24154 0 NA
14-102973462-C-T p.Arg255Arg synonymous ANKRD9 1 47416 2.10899E-5 23708 0 NA
14-102973469-C-T p.Gly253Asp missense ANKRD9 1 45698 2.18828E-5 22849 0 NA
14-102973479-C-G p.Glu250Gln missense ANKRD9 1 44854 2.22946E-5 22427 0 NA
14-102973490-G-A p.Ser246Leu missense ANKRD9 1 43360 2.30627E-5 21680 0 NA
14-102973507-G-A p.Pro240Pro synonymous ANKRD9 1 41330 2.41955E-5 20665 0 3.25669E-5
14-102973508-G-T p.Pro240His missense ANKRD9 1 41338 2.41908E-5 20669 0 3.25775E-5
14-102973510-G-A p.Thr239Thr synonymous ANKRD9 1 41118 2.43202E-5 20559 0 NA
14-102973511-G-A p.Thr239Ile missense ANKRD9 1 41042 2.43653E-5 20521 0 NA
14-102973524-G-A p.Leu235Leu synonymous ANKRD9 1 39238 2.54855E-5 19619 0 NA
14-102973530-CCAG-C p.Leu232del conservative_inframe_deletion ANKRD9 2 37434 5.34274E-5 18717 0 0.00128783
14-102973543-G-A p.Arg228Arg synonymous ANKRD9 1 36150 2.76625E-5 18075 0 NA
14-102973546-G-C p.Arg227Arg synonymous ANKRD9 2 35830 5.58191E-5 17915 0 6.74855E-5
14-102973548-G-A p.Arg227Cys missense ANKRD9 1 35688 2.80206E-5 17844 0 1.0164E-4
14-102973552-G-A p.Arg225Arg synonymous ANKRD9 4 35124 1.13882E-4 17562 0 NA
14-102973555-C-T p.Pro224Pro synonymous ANKRD9 3 34588 8.67353E-5 17294 0 NA
14-102973565-G-A p.Pro221Leu missense ANKRD9 1 34126 2.93032E-5 17063 0 0.0119048
14-102973575-C-A p.Ala218Ser missense ANKRD9 1 33524 2.98294E-5 16762 0 NA
14-102973579-G-A p.Ala216Ala synonymous ANKRD9 1 33444 2.99007E-5 16722 0 NA
14-102973580-G-T p.Ala216Asp missense ANKRD9 1 33398 2.99419E-5 16699 0 NA
14-102973583-C-T p.Gly215Glu missense ANKRD9 2 33152 6.03282E-5 16576 0 NA
14-102973592-G-A p.Ser212Phe missense ANKRD9 1 33110 3.02024E-5 16555 0 NA
14-102973620-G-C p.Leu203Val missense ANKRD9 2 33608 5.95096E-5 16804 0 3.68351E-5
14-102973653-C-T p.Gly192Ser missense ANKRD9 2 36554 5.47136E-5 18277 0 5.19642E-5
14-102973659-C-T p.Gly190Ser missense ANKRD9 1 36898 2.71017E-5 18449 0 NA
14-102973692-G-A p.Leu179Leu synonymous ANKRD9 1 38086 2.62564E-5 19043 0 3.28947E-4
14-102973699-G-A p.Phe176Phe synonymous ANKRD9 123 38164 0.00322293 19082 1 0.0082879
14-102973713-G-C p.Pro172Ala missense ANKRD9 2 38358 5.21404E-5 19179 0 NA
14-102973719-C-T p.Ala170Thr missense ANKRD9 6 38320 1.56576E-4 19160 0 8.04635E-5
14-102973726-A-T p.Cys167* stop_gained ANKRD9 1 38214 2.61684E-5 19107 0 NA
14-102973755-C-A p.Gly158Cys missense ANKRD9 1 38544 2.59444E-5 19272 0 NA
14-102973755-C-T p.Gly158Ser missense ANKRD9 2 38546 5.18861E-5 19273 0 1.08186E-4
14-102973756-C-T p.Glu157Glu synonymous ANKRD9 3 38576 7.77686E-5 19288 0 8.73393E-5
14-102973763-C-A p.Arg155Leu missense ANKRD9 3 38534 7.78533E-5 19267 0 8.53242E-4
14-102973777-C-T p.Arg150Arg synonymous ANKRD9 1 38710 2.58331E-5 19355 0 NA
14-102973778-C-T p.Arg150Gln missense ANKRD9 1 38714 2.58304E-5 19357 0 3.58295E-5
14-102973797-G-T p.Arg144Arg synonymous ANKRD9 1 38886 2.57162E-5 19443 0 NA
14-102973830-G-A p.Leu133Leu synonymous ANKRD9 1 39378 2.53949E-5 19689 0 3.48748E-5
14-102973833-T-C p.Ile132Val missense ANKRD9 2 39116 5.113E-5 19558 0 NA
14-102973836-G-A p.Arg131Cys missense ANKRD9 3 39026 7.68718E-5 19513 0 3.83971E-4
14-102973836-G-GGCGCAGAATGCC p.Arg130_Arg131insGlyIleLeuArg conservative_inframe_insertion ANKRD9 1 39026 2.56239E-5 19513 0 NA
14-102973838-C-A p.Arg130Leu missense ANKRD9 2 39072 5.11876E-5 19536 0 1.04581E-4
14-102973839-G-C p.Arg130Gly missense ANKRD9 1 39050 2.56082E-5 19525 0 1.71424E-4
14-102973851-C-T p.Val126Met missense ANKRD9 3 38978 7.69665E-5 19489 0 NA
14-102973854-G-A p.Arg125Cys missense ANKRD9 1 39064 2.5599E-5 19532 0 6.94252E-5
14-102973859-T-C p.Tyr123Cys missense ANKRD9 1 39084 2.55859E-5 19542 0 NA
14-102973868-G-C p.Ala120Gly missense ANKRD9 1 38848 2.57414E-5 19424 0 NA
14-102973876-C-A p.Val117Val synonymous ANKRD9 2 38784 5.15677E-5 19392 0 NA
14-102973883-G-A p.Pro115Leu missense ANKRD9 19 38706 4.9088E-4 19353 0 0.00273523
14-102973884-G-A p.Pro115Ser missense ANKRD9 1 38890 2.57136E-5 19445 0 NA
14-102973894-C-A p.Ala111Ala synonymous ANKRD9 1 38880 2.57202E-5 19440 0 NA
14-102973894-C-G p.Ala111Ala synonymous ANKRD9 1 38880 2.57202E-5 19440 0 3.49186E-5
14-102973899-A-G p.Cys110Arg missense ANKRD9 2 39038 5.12321E-5 19519 0 3.49724E-5
14-102973900-G-A p.Cys109Cys synonymous ANKRD9 655 39068 0.0167656 19534 5 0.0572612
14-102973911-C-T p.Gly106Ser missense ANKRD9 3 39202 7.65267E-5 19601 0 6.0024E-4
14-102973914-C-T p.Ala105Thr missense ANKRD9 1 39498 2.53177E-5 19749 0 NA
14-102973918-G-A p.Pro103Pro synonymous ANKRD9 1 39640 2.5227E-5 19820 0 NA
14-102973923-G-T p.Pro102Thr missense ANKRD9 1 39810 2.51193E-5 19905 0 NA
14-102973929-G-A p.Leu100Phe missense ANKRD9 3 39942 7.51089E-5 19971 0 3.53557E-5
14-102973938-G-T p.Arg97Arg synonymous ANKRD9 1 40060 2.49626E-5 20030 0 5.14933E-4
14-102973941-G-A p.Pro96Ser missense ANKRD9 1 40098 2.49389E-5 20049 0 5.46926E-5
14-102973954-C-T p.Leu91Leu synonymous ANKRD9 1 40242 2.48497E-5 20121 0 3.34717E-5
14-102973957-G-A p.Tyr90Tyr synonymous ANKRD9 1 40362 2.47758E-5 20181 0 3.54032E-5
14-102973978-G-A p.Asp83Asp synonymous ANKRD9 25 40544 6.16614E-4 20272 0 6.81344E-4
14-102973992-C-T p.Ala79Thr missense ANKRD9 1 40702 2.45688E-5 20351 0 NA
14-102973999-C-T p.Leu76Leu synonymous ANKRD9 2 40804 4.90148E-5 20402 0 1.05545E-4
14-102974003-GC-AA p.Ala75Leu missense ANKRD9 1 40822 2.44966E-5 20411 0 NA
14-102974008-A-G p.Ser73Ser synonymous ANKRD9 16 40860 3.91581E-4 20430 0 0.00203252
14-102974011-G-T p.Pro72Pro synonymous ANKRD9 1 40926 2.44343E-5 20463 0 NA
14-102974026-G-A p.Ala67Ala synonymous ANKRD9 1 40926 2.44343E-5 20463 0 2.51092E-5
14-102974029-G-A p.Arg66Arg synonymous ANKRD9 1 40854 2.44774E-5 20427 0 1.14095E-5
14-102974035-G-A p.Arg64Arg synonymous ANKRD9 52 40948 0.0012699 20474 0 0.00346081
14-102974036-C-T p.Arg64His missense ANKRD9 3 41028 7.31208E-5 20514 0 1.19775E-4
14-102974040-C-A p.Glu63* stop_gained ANKRD9 1 41122 2.43179E-5 20561 0 NA
14-102974048-T-C p.His60Arg missense ANKRD9 1 41238 2.42495E-5 20619 0 NA
14-102974057-T-G p.Glu57Ala missense ANKRD9 1 41318 2.42025E-5 20659 0 NA
14-102974062-G-A p.Ala55Ala synonymous ANKRD9 1 41380 2.41663E-5 20690 0 4.60575E-5
14-102974069-A-G p.Met53Thr missense ANKRD9 1 41336 2.4192E-5 20668 0 5.1398E-5
14-102974074-C-T p.Glu51Glu synonymous ANKRD9 2 41368 4.83465E-5 20684 0 2.16704E-5
14-102974085-A-C p.Trp48Gly missense ANKRD9 2 41370 4.83442E-5 20685 0 NA
14-102974088-C-T p.Val47Met missense ANKRD9 2 41340 4.83793E-5 20670 0 7.54728E-6
14-102974091-G-A p.Pro46Ser missense ANKRD9 1 41396 2.41569E-5 20698 0 NA
14-102974096-A-C p.Leu44Arg missense ANKRD9 1 41250 2.42424E-5 20625 0 NA
14-102974111-T-C p.Gln39Arg missense ANKRD9 1 40990 2.43962E-5 20495 0 NA
14-102974119-G-A p.Ala36Ala synonymous ANKRD9 3 40810 7.35114E-5 20405 0 8.99006E-6
14-102974128-C-G p.Ser33Ser synonymous ANKRD9 68 40558 0.00167661 20279 0 0.00446268
14-102974153-C-T p.Arg25Gln missense ANKRD9 2 39760 5.03018E-5 19880 0 1.12242E-4
14-102974158-G-A p.Arg23Arg synonymous ANKRD9 1 39514 2.53075E-5 19757 0 NA
14-102974160-G-T p.Arg23Ser missense ANKRD9 5 39378 1.26974E-4 19689 0 2.62094E-4
14-102974160-G-A p.Arg23Cys missense ANKRD9 1 39380 2.53936E-5 19690 0 3.7442E-5
14-102974166-C-T p.Ala21Thr missense ANKRD9 1 38880 2.57202E-5 19440 0 NA
14-102974175-C-A p.Ala18Ser missense ANKRD9 8 37072 2.15796E-4 18536 0 NA
14-102974192-G-A p.Ala12Val missense ANKRD9 1 33672 2.96983E-5 16836 0 1.68256E-4
14-102974198-C-T p.Gly10Asp missense ANKRD9 1 32876 3.04173E-5 16438 0 0.00123762
14-102974208-G-C p.Arg7Gly missense ANKRD9 1 31776 3.14703E-5 15888 0 NA
14-102974212-C-T p.Ala5Ala synonymous ANKRD9 1 31738 3.1508E-5 15869 0 NA
14-102974214-C-T p.Ala5Thr missense ANKRD9 1 31652 3.15936E-5 15826 0 NA
14-102974221-C-T p.Pro2Pro synonymous ANKRD9 26 31538 8.24402E-4 15769 0 2.73336E-4
14-102974223-G-T p.Pro2Thr missense ANKRD9 2 31462 6.35687E-5 15731 0 NA
14-102974233-G-A c.-7C>T 5_prime_UTR_premature_start_codon_gain ANKRD9 2 31142 6.4222E-5 15571 0 NA
14-102974282-G-GGTTCCTGCACCGCGATCACCTAGTTC c.-53-4_-53-3insGAACTAGGTGATCGCGGTGCAGGAAC splice_region ANKRD9 4 30052 1.33103E-4 15026 2 NA
14-102974886-TCTGTAAGAAAGGGGAGGGGTGGACGACGGCTGTGCGGGCGGGGTGAGCCTGGGGCGTGGCACCAGCCCTCTATCCAAACATGTTTGCTTAC-T c.-129+1_-128-1delGTAAGCAAACATGTTTGGATAGAGGGCTGGTGCCACGCCCCAGGCTCACCCCGCCCGCACAGCCGTCGTCCACCCCTCCCCTTTCTTACAG splice_acceptor ANKRD9 6 26 0.230769 13 1 NA
14-102974999-T-C c.-150A>G 5_prime_UTR_premature_start_codon_gain ANKRD9 18 30 0.6 15 5 0.690429