Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
12-56631593-G-A c.*5333C>T splice_region ANKRD52 1 79390 1.2596E-5 39695 0 6.37633E-5
12-56636942-C-G p.Gly1072Ala missense ANKRD52 2 78346 2.55278E-5 39173 0 1.82276E-5
12-56636947-T-C p.Leu1070Leu synonymous ANKRD52 1 78868 1.26794E-5 39434 0 NA
12-56636950-C-A p.Gly1069Gly synonymous ANKRD52 1 78978 1.26618E-5 39489 0 NA
12-56636958-C-T p.Ala1067Thr missense ANKRD52 2 78914 2.5344E-5 39457 0 4.69998E-5
12-56636959-G-A p.Gly1066Gly synonymous ANKRD52 1 78980 1.26614E-5 39490 0 3.18735E-5
12-56636961-C-T p.Gly1066Ser missense ANKRD52 5 79230 6.31074E-5 39615 0 4.36859E-5
12-56636963-G-C p.Pro1065Arg missense ANKRD52 10 79322 1.26068E-4 39661 0 0.00125156
12-56636967-G-C p.Arg1064Gly missense ANKRD52 2 79564 2.5137E-5 39782 0 NA
12-56636972-T-C p.Gln1062Arg missense ANKRD52 1 80248 1.24614E-5 40124 0 NA
12-56636975-C-G p.Ser1061Thr missense ANKRD52 3750 80106 0.046813 40053 97 0.0620325
12-56636983-G-A p.Cys1058Cys synonymous ANKRD52 1 80672 1.23959E-5 40336 0 2.87952E-5
12-56637006-C-T p.Ala1051Thr missense ANKRD52 11 81082 1.35665E-4 40541 0 0.00151362
12-56637010-G-A p.Cys1049Cys synonymous ANKRD52 2 81278 2.46069E-5 40639 0 3.24852E-5
12-56637013-G-T p.Gly1048Gly synonymous ANKRD52 8 81442 9.82294E-5 40721 0 6.3743E-5
12-56637022-C-T n.489G>A splice_region ANKRD52 1 81692 1.22411E-5 40846 0 3.2313E-5
12-56637030-C-T p.Ala1043Thr missense ANKRD52 2 81794 2.44517E-5 40897 0 3.18756E-5
12-56637035-G-A p.Ala1041Val missense ANKRD52 1 81788 1.22267E-5 40894 0 3.18552E-5
12-56637060-T-C p.Ser1033Gly missense ANKRD52 1 82036 1.21898E-5 41018 0 NA
12-56637078-C-T p.Val1027Ile missense ANKRD52 5 81920 6.10352E-5 40960 0 8.43821E-5
12-56637079-G-A p.Ala1026Ala synonymous ANKRD52 2 81884 2.44248E-5 40942 0 3.18715E-5
12-56637082-G-A p.Asp1025Asp synonymous ANKRD52 1 81810 1.22234E-5 40905 0 2.81344E-5
12-56637083-T-C p.Asp1025Gly missense ANKRD52 1 81808 1.22237E-5 40904 0 NA
12-56637088-G-C p.Pro1023Pro synonymous ANKRD52 3 81800 3.66748E-5 40900 0 6.37227E-5
12-56637117-T-C p.Ile1014Val missense ANKRD52 2 81544 2.45266E-5 40772 0 8.4168E-6
12-56637121-G-C p.Ala1012Ala synonymous ANKRD52 54 81524 6.62382E-4 40762 2 0.0025
12-56637130-G-A p.Asp1009Asp synonymous ANKRD52 1 81396 1.22856E-5 40698 0 8.45337E-6
12-56637146-T-C p.Asn1004Ser missense ANKRD52 2 81252 2.46148E-5 40626 0 3.63936E-5
12-56637176-C-A p.Gly994Val missense+splice_region ANKRD52 2 80728 2.47746E-5 40364 0 8.95255E-6
12-56637178-T-TTCTTCATCCACAGCCAGCACTGTGGCCCCATGACTCA c.2981-3_2981-2insTGAGTCATGGGGCCACAGTGCTGGCTGTGGATGAAGA splice_region ANKRD52 2 80706 2.47813E-5 40353 0 NA
12-56637595-G-A p.Ala985Val missense ANKRD52 1 81520 1.22669E-5 40760 0 NA
12-56637618-T-A p.Val977Val synonymous ANKRD52 1 81666 1.2245E-5 40833 0 NA
12-56637627-A-G p.Ala974Ala synonymous ANKRD52 1 81672 1.22441E-5 40836 0 NA
12-56637640-C-T p.Arg970Gln missense ANKRD52 4 81598 4.90208E-5 40799 0 3.18654E-5
12-56637657-T-C p.Pro964Pro synonymous ANKRD52 61 81446 7.48963E-4 40723 2 0.00607903
12-56637660-C-CATCTGCAGCGCACTGTTGGTAGCATTGATAAGGCCAAGGT c.2889-1_2889insACCTTGGCCTTATCAATGCTACCAACAGTGCGCTGCAGAT splice_acceptor ANKRD52 2 81340 2.45881E-5 40670 1 NA
12-56637665-G-A c.2889-5C>T splice_region ANKRD52 2 81214 2.46263E-5 40607 0 7.89622E-5
12-56637665-G-GAA c.2889-6_2889-5insTT splice_region ANKRD52 1 81216 1.23128E-5 40608 0 NA
12-56637665-G-GA c.2889-6_2889-5insT splice_region ANKRD52 1 81216 1.23128E-5 40608 0 NA
12-56637843-C-T p.Ala960Ala synonymous ANKRD52 3 82304 3.64502E-5 41152 0 0.001875
12-56637844-G-A p.Ala960Val missense ANKRD52 3 82312 3.64467E-5 41156 0 3.18634E-5
12-56637859-T-C p.Asn955Ser missense ANKRD52 2 82424 2.42648E-5 41212 0 8.2813E-6
12-56637873-G-A p.Asp950Asp synonymous ANKRD52 1 82472 1.21253E-5 41236 0 4.01223E-6
12-56637881-T-C p.Thr948Ala missense ANKRD52 7 82486 8.48629E-5 41243 0 3.20953E-5
12-56637895-A-T p.Met943Lys missense ANKRD52 1 82478 1.21244E-5 41239 0 5.03525E-4
12-56637899-G-A p.Leu942Phe missense ANKRD52 3 82484 3.63707E-5 41242 0 3.18552E-5
12-56637899-G-T p.Leu942Ile missense ANKRD52 1 82484 1.21236E-5 41242 0 NA
12-56637920-G-A c.2806-3C>T splice_region ANKRD52 3 82382 3.64157E-5 41191 0 8.02542E-6
12-56638129-G-A c.2805+8C>T splice_region ANKRD52 1 82390 1.21374E-5 41195 0 4.01352E-6
12-56638129-G-T c.2805+8C>A splice_region ANKRD52 2 82390 2.42748E-5 41195 0 NA
12-56638133-G-A c.2805+4C>T splice_region ANKRD52 1 82414 1.21339E-5 41207 0 8.34766E-6
12-56638161-C-T p.Thr927Thr synonymous ANKRD52 5 82494 6.06105E-5 41247 0 8.31062E-5
12-56638162-G-A p.Thr927Met missense ANKRD52 1 82496 1.21218E-5 41248 0 8.3102E-6
12-56638180-A-G p.Leu921Ser missense ANKRD52 4 82504 4.84825E-5 41252 0 4.98604E-5
12-56638190-G-A p.Leu918Phe missense ANKRD52 1 82492 1.21224E-5 41246 0 3.18492E-5
12-56638201-C-T p.Gly914Glu missense ANKRD52 1 82474 1.2125E-5 41237 0 NA
12-56638204-C-T p.Arg913Gln missense ANKRD52 1 82456 1.21277E-5 41228 0 0.0020141
12-56638204-C-A p.Arg913Leu missense ANKRD52 1 82456 1.21277E-5 41228 0 NA
12-56638221-T-C c.2723-2A>G splice_acceptor ANKRD52 1 82414 1.21339E-5 41207 0 NA
12-56638223-C-T c.2723-4G>A splice_region ANKRD52 1 82390 1.21374E-5 41195 0 7.56862E-5
12-56638224-G-A c.2723-5C>T splice_region ANKRD52 1 82370 1.21403E-5 41185 0 NA
12-56638432-A-G c.2722+4T>C splice_region ANKRD52 1 80682 1.23943E-5 40341 0 NA
12-56638455-G-A p.Asn901Asn synonymous ANKRD52 275 81126 0.00338979 40563 4 0.00806041
12-56638467-C-G p.Thr897Thr synonymous ANKRD52 1 81374 1.22889E-5 40687 0 NA
12-56638468-G-A p.Thr897Met missense ANKRD52 3 81406 3.68523E-5 40703 0 6.64209E-5
12-56638476-C-T p.Ala894Ala synonymous ANKRD52 1 81514 1.22678E-5 40757 0 3.18431E-5
12-56638479-A-G p.Thr893Thr synonymous ANKRD52 1 81546 1.2263E-5 40773 0 2.81061E-5
12-56638483-C-T p.Arg892His missense ANKRD52 9 81542 1.10373E-4 40771 0 1.59195E-4
12-56638493-G-A p.His889Tyr missense ANKRD52 2 81696 2.4481E-5 40848 0 NA
12-56638502-C-A p.Ala886Ser missense ANKRD52 2 81722 2.44732E-5 40861 0 NA
12-56638516-T-C p.Gln881Arg missense ANKRD52 1 81854 1.22169E-5 40927 0 3.18552E-5
12-56638556-C-T p.Ala868Thr missense ANKRD52 1 81894 1.22109E-5 40947 0 8.03116E-6
12-56638557-G-A p.Phe867Phe synonymous ANKRD52 73 81908 8.91244E-4 40954 0 0.00213376
12-56638566-G-A p.Ala864Ala synonymous ANKRD52 1 81846 1.22181E-5 40923 0 6.25E-4
12-56638566-G-C p.Ala864Ala synonymous ANKRD52 1 81846 1.22181E-5 40923 0 8.2894E-6
12-56638574-G-A p.Leu862Phe missense ANKRD52 1 81894 1.22109E-5 40947 0 9.11879E-5
12-56638574-G-C p.Leu862Val missense ANKRD52 1 81894 1.22109E-5 40947 0 3.18613E-5
12-56638575-G-C p.Pro861Pro synonymous ANKRD52 1 81888 1.22118E-5 40944 0 9.55657E-5
12-56638580-TCCTGTAAGGCAGGGATCAGGGTAGATTAAAATAGGGAAGAGTATACTGCCCAAGCAGAAAGGGGAAGCCAGAGGCAACTGGGATTCTTCCCAAGTCTTCCATCACTCA-T p.Thr860fs frameshift ANKRD52 7 81826 8.55474E-5 40913 3 NA
12-56638584-G-A c.2577-3C>T splice_region ANKRD52 3 81882 3.66381E-5 40941 0 3.18492E-5
12-56638694-C-T p.Gly858Arg missense ANKRD52 1 82644 1.21001E-5 41322 0 8.28679E-6
12-56638735-C-T p.Gly844Glu missense ANKRD52 1 82628 1.21024E-5 41314 0 4.01278E-6
12-56638740-T-C p.Leu842Leu synonymous ANKRD52 2 82584 2.42178E-5 41292 0 NA
12-56638744-A-T p.Met841Lys missense ANKRD52 1 82598 1.21068E-5 41299 0 NA
12-56638755-G-A p.Ser837Ser synonymous ANKRD52 46 82562 5.57157E-4 41281 0 0.00375
12-56638755-G-C p.Ser837Arg missense ANKRD52 1 82564 1.21118E-5 41282 0 1.65928E-5
12-56638756-C-T p.Ser837Asn missense ANKRD52 2 82572 2.42213E-5 41286 0 NA
12-56638759-T-C p.Asp836Gly missense ANKRD52 1 82582 1.21092E-5 41291 0 8.29449E-6
12-56638760-C-T p.Asp836Asn missense ANKRD52 1 82578 1.21098E-5 41289 0 NA
12-56638895-G-A p.His828His synonymous ANKRD52 2 82554 2.42266E-5 41277 0 4.01194E-6
12-56638912-G-A p.Pro823Ser missense ANKRD52 1 82564 1.21118E-5 41282 0 NA
12-56638919-T-C p.Glu820Glu synonymous ANKRD52 2 82566 2.4223E-5 41283 0 NA
12-56638928-C-T p.Ser817Ser synonymous ANKRD52 26 82554 3.14945E-4 41277 0 2.96879E-4
12-56638929-G-A p.Ser817Leu missense ANKRD52 1 82552 1.21136E-5 41276 0 8.28295E-6
12-56638934-C-T p.Pro815Pro synonymous ANKRD52 2 82542 2.42301E-5 41271 0 3.18451E-5
12-56638935-G-A p.Pro815Leu missense ANKRD52 2 82550 2.42277E-5 41275 0 8.28295E-6
12-56638942-G-A p.His813Tyr missense ANKRD52 2 82538 2.42313E-5 41269 0 1.27364E-4
12-56638967-T-C p.Glu804Glu synonymous ANKRD52 4 82494 4.84884E-5 41247 0 0.00100705
12-56638971-T-C p.His803Arg missense ANKRD52 1 82480 1.21242E-5 41240 0 9.55962E-5
12-56638975-C-CAG c.2405-2_2405-1insCT splice_acceptor ANKRD52 1 82448 1.21289E-5 41224 0 NA
12-56638979-GC-AA c.2405-6_2405-5delGCinsTT splice_region ANKRD52 1 82412 1.21342E-5 41206 0 NA
12-56638980-C-T c.2405-6G>A splice_region ANKRD52 1 82408 1.21347E-5 41204 0 9.55962E-5
12-56638982-C-T c.2405-8G>A splice_region ANKRD52 3 82388 3.64131E-5 41194 0 3.18695E-5
12-56639156-A-T c.2404+5T>A splice_region ANKRD52 4 80692 4.95712E-5 40346 0 7.29486E-5
12-56639175-C-A p.Trp797Leu missense ANKRD52 1 81236 1.23098E-5 40618 0 NA
12-56639182-T-C p.Met795Val missense ANKRD52 1 81422 1.22817E-5 40711 0 4.07282E-6
12-56639195-G-A p.Ser790Ser synonymous ANKRD52 2 81770 2.44588E-5 40885 0 0.00100806
12-56639198-G-A p.Tyr789Tyr synonymous ANKRD52 1 81862 1.22157E-5 40931 0 NA
12-56639210-G-A p.Ala785Ala synonymous ANKRD52 1 82036 1.21898E-5 41018 0 5.04032E-4
12-56639231-A-T p.Leu778Leu synonymous ANKRD52 100 82204 0.00121649 41102 0 0.003125
12-56639234-G-C p.Ala777Ala synonymous ANKRD52 1 82214 1.21634E-5 41107 0 NA
12-56639234-G-A p.Ala777Ala synonymous ANKRD52 1 82214 1.21634E-5 41107 0 4.04076E-6
12-56639246-C-T p.Leu773Leu synonymous ANKRD52 1 82296 1.21513E-5 41148 0 4.04678E-6
12-56639252-C-G p.Arg771Arg synonymous ANKRD52 4 82276 4.86169E-5 41138 0 8.37086E-6
12-56639253-C-T p.Arg771Gln missense ANKRD52 2 82282 2.43067E-5 41141 0 8.37016E-6
12-56639254-G-C p.Arg771Gly missense ANKRD52 2 82286 2.43055E-5 41143 0 1.67403E-5
12-56639267-G-A p.His766His synonymous ANKRD52 2 82340 2.42895E-5 41170 0 8.34279E-6
12-56639288-G-A p.His759His synonymous ANKRD52 1 82322 1.21474E-5 41161 0 3.18756E-5
12-56639291-A-T p.Ile758Ile synonymous ANKRD52 2 82304 2.43002E-5 41152 0 NA
12-56639297-C-T p.Thr756Thr synonymous ANKRD52 1 82250 1.21581E-5 41125 0 2.16739E-4
12-56639309-A-T p.Phe752Leu missense ANKRD52 1 82230 1.2161E-5 41115 0 NA
12-56639324-C-G p.Val747Val synonymous ANKRD52 2 82132 2.4351E-5 41066 0 6.37918E-5
12-56639330-T-C p.Ala745Ala synonymous ANKRD52 3 82114 3.65346E-5 41057 0 2.85349E-5
12-56639335-C-T p.Asp744Asn missense ANKRD52 1 82032 1.21904E-5 41016 0 8.36092E-6
12-56639336-G-A p.His743His synonymous ANKRD52 4 82036 4.87591E-5 41018 0 3.19E-5
12-56639351-A-G p.Ala738Ala synonymous ANKRD52 3 81808 3.66712E-5 40904 0 1.67639E-5
12-56639352-G-A p.Ala738Val missense ANKRD52 2 81784 2.44547E-5 40892 0 6.3743E-5
12-56639362-C-T p.Asp735Asn missense ANKRD52 1 81556 1.22615E-5 40778 0 NA
12-56639368-A-G p.Cys733Arg missense ANKRD52 3 81418 3.68469E-5 40709 0 NA
12-56639381-C-CCCGCGG c.2185-2_2185-1insCCGCGG splice_acceptor ANKRD52 1 81086 1.23326E-5 40543 0 NA
12-56641272-C-T c.2184+5G>A splice_region ANKRD52 2 81158 2.46433E-5 40579 0 NA
12-56641280-G-A p.Arg727Arg synonymous ANKRD52 13 81302 1.59898E-4 40651 0 0.0010101
12-56641282-G-A p.Arg727Cys missense ANKRD52 1 81376 1.22886E-5 40688 0 3.08211E-5
12-56641286-G-C p.Leu725Leu synonymous ANKRD52 1 81470 1.22745E-5 40735 0 NA
12-56641298-G-A p.Gly721Gly synonymous ANKRD52 1 81618 1.22522E-5 40809 0 0.00151362
12-56641302-C-T p.Arg720Gln missense ANKRD52 2 81718 2.44744E-5 40859 0 2.76855E-5
12-56641303-G-A p.Arg720Trp missense ANKRD52 4 81734 4.89392E-5 40867 0 0.00151057
12-56641315-C-T p.Ala716Thr missense ANKRD52 1 81836 1.22196E-5 40918 0 4.56913E-6
12-56641325-G-A p.Ser712Ser synonymous ANKRD52 2 81916 2.44153E-5 40958 0 9.5816E-5
12-56641345-G-A p.Leu706Leu synonymous ANKRD52 1 81878 1.22133E-5 40939 0 4.51044E-6
12-56641348-G-A p.His705Tyr missense ANKRD52 1 81864 1.22154E-5 40932 0 6.42316E-5
12-56641371-A-G p.Met697Thr missense ANKRD52 1 81566 1.226E-5 40783 0 NA
12-56641375-T-G p.Ile696Leu missense ANKRD52 2 81472 2.45483E-5 40736 0 4.64818E-6
12-56641376-G-T p.Ala695Ala synonymous ANKRD52 2 81444 2.45567E-5 40722 0 2.05905E-5
12-56641391-G-A p.Thr690Thr synonymous ANKRD52 2 81064 2.46719E-5 40532 0 2.03062E-5
12-56641393-TCCTACAGAAGGGCAGGAGGAGGAGTGAGGATCCCGCAAGGACTGGAAAACCTGCACCCCACCCTGGCCCACACTCA-T p.Thr690fs frameshift ANKRD52 7 80992 8.64283E-5 40496 0 NA
12-56641394-C-T p.Gln689Gln splice_region+synonymous ANKRD52 1 80990 1.23472E-5 40495 0 NA
12-56641400-G-A c.2067-6C>T splice_region ANKRD52 1 80888 1.23628E-5 40444 0 NA
12-56641476-A-G p.Tyr687Tyr synonymous ANKRD52 2 79716 2.50891E-5 39858 0 6.25E-4
12-56641486-A-G p.Met684Thr missense ANKRD52 1 79608 1.25616E-5 39804 0 NA
12-56641507-C-T p.Arg677Gln missense ANKRD52 4 78742 5.07988E-5 39371 0 3.98113E-5
12-56641520-C-T p.Asp673Asn missense ANKRD52 1 77902 1.28366E-5 38951 0 4.06002E-6
12-56641521-G-A p.Ile672Ile synonymous ANKRD52 1 77794 1.28545E-5 38897 0 9.75953E-6
12-56641535-G-A p.Leu668Leu synonymous ANKRD52 2 76774 2.60505E-5 38387 0 8.15076E-6
12-56641554-G-C p.Ala661Ala synonymous ANKRD52 4 74690 5.35547E-5 37345 0 NA
12-56641558-G-GCAGCAGCGTGCAGGGGTGTCCACTTGCGCTTGCGCTC c.1979-1_1979insGAGCGCAAGCGCAAGTGGACACCCCTGCACGCTGCTG splice_acceptor ANKRD52 1 73846 1.35417E-5 36923 0 NA
12-56641559-C-CAGCAGCGTGCAGGGGTGTCCACTTGCGCTTGCGCTCCTTGA c.1979-2_1979-1insTCAAGGAGCGCAAGCGCAAGTGGACACCCCTGCACGCTGCT splice_acceptor ANKRD52 1 73530 1.35999E-5 36765 0 NA
12-56641813-C-T p.Ala658Thr missense ANKRD52 1 81650 1.22474E-5 40825 0 1.51208E-5
12-56641819-G-A p.Leu656Leu synonymous ANKRD52 1 81756 1.22315E-5 40878 0 NA
12-56641833-C-T p.Arg651His missense ANKRD52 1 81854 1.22169E-5 40927 0 2.02622E-5
12-56641834-G-A p.Arg651Cys missense ANKRD52 1 81878 1.22133E-5 40939 0 9.84911E-6
12-56641840-G-A p.Arg649Cys missense ANKRD52 1 81920 1.2207E-5 40960 0 9.21421E-6
12-56641862-G-A p.Gly641Gly synonymous ANKRD52 7 81982 8.53846E-5 40991 0 6.37389E-5
12-56641865-G-A p.His640His synonymous ANKRD52 6 82052 7.31244E-5 41026 0 3.23204E-5
12-56641874-A-G p.Leu637Leu synonymous ANKRD52 1 82162 1.21711E-5 41081 0 NA
12-56641883-C-T p.Val634Val synonymous ANKRD52 2 82196 2.43321E-5 41098 0 4.02405E-6
12-56641894-T-C p.Thr631Ala missense ANKRD52 1 82216 1.21631E-5 41108 0 8.04311E-6
12-56641901-G-A p.Arg628Arg synonymous ANKRD52 39 82204 4.74429E-4 41102 0 2.86807E-4
12-56641901-G-T p.Arg628Arg synonymous ANKRD52 1 82208 1.21643E-5 41104 0 NA
12-56641907-C-T p.Thr626Thr synonymous ANKRD52 2 82234 2.43208E-5 41117 0 6.25E-4
12-56641908-G-A p.Thr626Met missense ANKRD52 1 82234 1.21604E-5 41117 0 NA
12-56641919-G-A p.Leu622Leu synonymous ANKRD52 1 82270 1.21551E-5 41135 0 NA
12-56641948-C-T p.Val613Ile missense ANKRD52 4 82218 4.86511E-5 41109 0 6.37186E-5
12-56641949-G-A p.Asp612Asp synonymous ANKRD52 2 82210 2.43279E-5 41105 0 2.81174E-5
12-56641954-G-A p.Leu611Leu synonymous ANKRD52 2 82196 2.43321E-5 41098 0 7.23002E-5
12-56641964-C-A p.Thr607Thr synonymous ANKRD52 3 82134 3.65257E-5 41067 0 1.20542E-5
12-56641967-C-T p.Glu606Glu synonymous ANKRD52 85 82116 0.00103512 41058 2 0.00264449
12-56641971-G-A p.Ala605Val missense ANKRD52 2 82038 2.43789E-5 41019 0 2.4936E-5
12-56641977-G-A p.Thr603Met missense ANKRD52 7 82008 8.53575E-5 41004 0 1.20536E-4
12-56641984-A-G p.Leu601Leu synonymous ANKRD52 3 81994 3.6588E-5 40997 0 3.18654E-5
12-56641999-C-T p.Gly596Ser missense ANKRD52 1 81674 1.22438E-5 40837 0 4.02453E-6
12-56642000-G-A p.Asn595Asn synonymous ANKRD52 2 81656 2.4493E-5 40828 0 1.6097E-5
12-56642001-T-C p.Asn595Ser missense ANKRD52 2 81656 2.4493E-5 40828 0 3.18613E-5
12-56642004-T-A p.Tyr594Phe missense ANKRD52 2 81572 2.45182E-5 40786 0 4.02573E-6
12-56642305-T-C p.Ile584Val missense ANKRD52 1 82392 1.21371E-5 41196 0 4.46728E-6
12-56642314-C-A p.Glu581* stop_gained ANKRD52 1 82420 1.2133E-5 41210 0 NA
12-56642317-C-G p.Val580Leu missense ANKRD52 1 82410 1.21345E-5 41205 0 NA
12-56642327-G-A p.Cys576Cys synonymous ANKRD52 1 82418 1.21333E-5 41209 0 NA
12-56642341-T-C p.Met572Val missense ANKRD52 16 82406 1.94161E-4 41203 0 3.78469E-4
12-56642351-C-CAGTTCGAGGTTCTGTCTGTTGCCATAGGCGGCTGCATAG c.1705-2_1705-1insCTATGCAGCCGCCTATGGCAACAGACAGAACCTCGAACT splice_acceptor ANKRD52 1 82364 1.21412E-5 41182 0 NA
12-56642351-C-CAG c.1705-2_1705-1insCT splice_acceptor ANKRD52 1 82370 1.21403E-5 41185 0 NA
12-56642549-G-C p.Leu566Leu synonymous ANKRD52 1 82192 1.21666E-5 41096 0 NA
12-56642549-G-A p.Leu566Leu synonymous ANKRD52 1 82192 1.21666E-5 41096 0 3.18451E-5
12-56642553-T-C p.Asn565Ser missense ANKRD52 1 82220 1.21625E-5 41110 0 NA
12-56642559-C-T p.Arg563Lys missense ANKRD52 1 82220 1.21625E-5 41110 0 NA
12-56642572-C-T p.Ala559Thr missense ANKRD52 2 82178 2.43374E-5 41089 0 1.13587E-5
12-56642585-C-T p.Val554Val synonymous ANKRD52 1 82110 1.21788E-5 41055 0 NA
12-56642599-C-T p.Gly550Ser missense ANKRD52 92 82100 0.00112058 41050 1 0.00453629
12-56642620-G-A p.Pro543Ser missense ANKRD52 9 81916 1.09869E-4 40958 0 1.3031E-5
12-56642622-T-C p.Asp542Gly missense ANKRD52 1 81840 1.2219E-5 40920 0 NA
12-56642623-C-T p.Asp542Asn missense ANKRD52 68 81894 8.30342E-4 40947 0 0.00504032
12-56642630-G-A p.Asn539Asn synonymous ANKRD52 1 81716 1.22375E-5 40858 0 6.25E-4
12-56645793-A-G c.1592+6T>C splice_region ANKRD52 2 81694 2.44816E-5 40847 0 8.31352E-6
12-56645825-C-T p.Lys522Lys synonymous ANKRD52 1 82308 1.21495E-5 41154 0 NA
12-56645830-G-C p.Leu521Val missense ANKRD52 1 82316 1.21483E-5 41158 0 NA
12-56645837-G-A p.Asp518Asp synonymous ANKRD52 2 82128 2.43522E-5 41064 0 3.19224E-5
12-56645838-T-C p.Asp518Gly missense ANKRD52 1 82086 1.21823E-5 41043 0 0.022288
12-56645840-C-T p.Glu517Glu synonymous ANKRD52 2 82188 2.43345E-5 41094 0 6.37308E-5
12-56645859-G-A p.Ser511Phe missense ANKRD52 1 82122 1.2177E-5 41061 0 NA
12-56645871-G-C p.Pro507Arg missense ANKRD52 1 82120 1.21773E-5 41060 0 NA
12-56645877-G-A p.Ala505Val missense+splice_region ANKRD52 3 82048 3.6564E-5 41024 0 5.03525E-4
12-56645879-T-C p.Arg504Arg splice_region+synonymous ANKRD52 1 82048 1.2188E-5 41024 0 NA
12-56645879-TCTGGGGAAGAGAGAGAGAAAGTTAGGGCCAGGCTCAGGGAGGTGAATGGGGCTGAGAAGGACCAGACTGGTAGCCTCAC-T c.1511+1_1512-1delGTGAGGCTACCAGTCTGGTCCTTCTCAGCCCCATTCACCTCCCTGAGCCTGGCCCTAACTTTCTCTCTCTCTTCCCCAG splice_acceptor ANKRD52 11 82048 1.34068E-4 41024 4 NA
12-56645880-C-T c.1512-1G>A splice_acceptor ANKRD52 1 82064 1.21856E-5 41032 0 NA
12-56645883-G-A c.1512-4C>T splice_region ANKRD52 1 82058 1.21865E-5 41029 0 8.03219E-6
12-56645885-G-C c.1512-6C>G splice_region ANKRD52 1 82068 1.2185E-5 41034 0 NA
12-56645886-AAG-A c.1512-9_1512-8delCT splice_region ANKRD52 1 81998 1.21954E-5 40999 0 4.02667E-6
12-56645886-AAGAG-A c.1512-11_1512-8delCTCT splice_region ANKRD52 1 82010 1.21936E-5 41005 0 1.07775E-4
12-56645886-A-AAGAG c.1512-8_1512-7insCTCT splice_region ANKRD52 1 82010 1.21936E-5 41005 0 8.29036E-6
12-56645956-C-T c.1511+3G>A splice_region ANKRD52 7 82236 8.51209E-5 41118 0 3.31334E-5
12-56645984-C-T p.Ala496Thr missense ANKRD52 3 82342 3.64334E-5 41171 0 1.6564E-5
12-56645985-G-A p.Tyr495Tyr synonymous ANKRD52 5 82344 6.07209E-5 41172 0 6.25E-4
12-56645991-G-A p.Leu493Leu synonymous ANKRD52 1 82358 1.21421E-5 41179 0 NA
12-56646012-G-A p.Asp486Asp synonymous ANKRD52 1 82364 1.21412E-5 41182 0 NA
12-56646015-G-A p.Ala485Ala synonymous ANKRD52 7 82348 8.50051E-5 41174 0 6.37674E-5
12-56646020-C-T p.Glu484Lys missense ANKRD52 1 82356 1.21424E-5 41178 0 8.02427E-6
12-56646033-C-G p.Gly479Gly synonymous ANKRD52 1 82392 1.21371E-5 41196 0 4.01229E-6
12-56646036-A-G p.Ala478Ala synonymous ANKRD52 2 82392 2.42742E-5 41196 0 6.37267E-5
12-56646042-C-A p.Val476Val synonymous ANKRD52 1 82388 1.21377E-5 41194 0 NA
12-56646068-T-G p.Ser468Arg missense ANKRD52 1 82380 1.21389E-5 41190 0 NA
12-56646072-G-A p.Asn466Asn synonymous ANKRD52 189 82366 0.00229464 41183 2 0.00445831
12-56646079-G-A p.Ala464Val missense ANKRD52 1 82366 1.21409E-5 41183 0 NA
12-56646100-C-CTGGGGAAGAAGTGAAGGAGGG c.1371-2_1371-1insCCCTCCTTCACTTCTTCCCCA splice_acceptor ANKRD52 4 82360 4.85673E-5 41180 0 4.0191E-6
12-56646105-G-A c.1371-6C>T splice_region ANKRD52 6 82354 7.28562E-5 41177 0 2.86588E-4
12-56646292-A-G p.Phe455Ser missense ANKRD52 1 82322 1.21474E-5 41161 0 NA
12-56646295-T-C p.Lys454Arg missense ANKRD52 1 82324 1.21471E-5 41162 0 8.02459E-6
12-56646304-C-T p.Arg451Lys missense ANKRD52 1 82328 1.21465E-5 41164 0 3.1839E-5
12-56646332-G-A p.Leu442Leu synonymous ANKRD52 4 82302 4.86015E-5 41151 0 7.45403E-5
12-56646335-A-G p.Leu441Leu synonymous ANKRD52 6 82296 7.29076E-5 41148 0 1.6564E-5
12-56646350-C-G p.Val436Leu missense ANKRD52 2 82258 2.43137E-5 41129 0 8.28267E-6
12-56646355-C-CCTCCGGAAGCAGCAGCATGAAGACAGGTACGGCCAAGGTTGTCAGGTGTA c.1302-2_1302-1insTACACCTGACAACCTTGGCCGTACCTGTCTTCATGCTGCTGCTTCCGGAG splice_acceptor ANKRD52 2 82234 2.43208E-5 41117 1 NA
12-56646361-G-T c.1302-7C>A splice_region ANKRD52 1 82166 1.21705E-5 41083 0 NA
12-56646569-G-A p.Ser432Ser synonymous ANKRD52 16 82472 1.94005E-4 41236 0 1.59266E-4
12-56646596-G-A p.Gly423Gly synonymous ANKRD52 3 82630 3.63064E-5 41315 0 4.01355E-6
12-56646601-G-C p.Leu422Val missense ANKRD52 1 82676 1.20954E-5 41338 0 NA
12-56646643-G-A p.His408Tyr missense ANKRD52 1 82718 1.20893E-5 41359 0 NA
12-56646644-C-T p.Glu407Glu synonymous ANKRD52 5 82714 6.04493E-5 41357 0 1.34494E-4
12-56646651-C-A p.Ser405Ile missense ANKRD52 6 82702 7.25496E-5 41351 0 6.25E-4
12-56646653-G-C p.Leu404Leu synonymous ANKRD52 1 82700 1.20919E-5 41350 0 NA
12-56646679-GACCTGGAGGCACAGAACAGCCACAGGTCACATCTGAGAGTGTTCAGCAGGGAGGGAAAGGCCTTTGCTCTCCTATACACCTGCCAATCCCCAGCCCATCAGCACAT-G p.Gly395fs frameshift ANKRD52 5 82622 6.05166E-5 41311 0 NA
12-56646681-C-T p.Gly395Asp missense+splice_region ANKRD52 1 82626 1.21027E-5 41313 0 NA
12-56646810-A-G p.Cys387Cys synonymous ANKRD52 1 82744 1.20855E-5 41372 0 3.18512E-5
12-56646840-G-A p.His377His synonymous ANKRD52 1 82724 1.20884E-5 41362 0 NA
12-56646848-G-C p.Pro375Ala missense ANKRD52 1 82696 1.20925E-5 41348 0 NA
12-56646849-G-A p.Phe374Phe synonymous ANKRD52 2 82698 2.41844E-5 41349 0 4.97795E-6
12-56647077-G-A p.Thr365Thr synonymous ANKRD52 4 82028 4.87638E-5 41014 0 2.41332E-5
12-56647086-G-A p.Gly362Gly synonymous ANKRD52 3 82128 3.65283E-5 41064 0 8.33403E-6
12-56647095-C-T p.Met359Ile missense ANKRD52 1 82218 1.21628E-5 41109 0 NA
12-56647118-C-G p.Glu352Gln missense ANKRD52 1 82202 1.21652E-5 41101 0 NA
12-56647129-C-T p.Arg348Gln missense ANKRD52 1 82230 1.2161E-5 41115 0 6.25E-4
12-56647143-C-T p.Leu343Leu synonymous ANKRD52 1 82242 1.21592E-5 41121 0 8.32251E-6
12-56647149-C-T p.Thr341Thr synonymous ANKRD52 1 82162 1.21711E-5 41081 0 3.18573E-5
12-56647167-G-A p.Ala335Ala synonymous ANKRD52 1 81972 1.21993E-5 40986 0 2.00879E-5
12-56647182-G-A p.Ser330Ser synonymous ANKRD52 2 81518 2.45345E-5 40759 0 5.03626E-5
12-56647193-G-A c.986-7C>T splice_region ANKRD52 2 81234 2.46202E-5 40617 0 9.55292E-5
12-56647537-A-G p.Arg318Arg synonymous ANKRD52 1 82500 1.21212E-5 41250 0 NA
12-56647575-C-A p.Gly306Trp missense ANKRD52 3 82502 3.63628E-5 41251 0 NA
12-56647583-C-G p.Ser303Thr missense+splice_region ANKRD52 1 82478 1.21244E-5 41239 0 NA
12-56647587-G-GGTAGTTGACGTCAGCCCCATTATTAACCAGTAGC c.907-4_907-3insGCTACTGGTTAATAATGGGGCTGACGTCAACTAC splice_region ANKRD52 1 82462 1.21268E-5 41231 0 NA
12-56647845-A-G c.906+6T>C splice_region ANKRD52 1 82366 1.21409E-5 41183 0 NA
12-56647862-C-T p.Val299Ile missense ANKRD52 1 82568 1.21112E-5 41284 0 1.20393E-5
12-56647902-G-A p.Gly285Gly synonymous ANKRD52 1 82754 1.2084E-5 41377 0 1.20364E-5
12-56647906-T-C p.Asn284Ser missense ANKRD52 1 82762 1.20828E-5 41381 0 8.28199E-6
12-56647911-G-C p.Ser282Ser synonymous ANKRD52 72294 82340 0.877994 41170 32571 0.951875
12-56647911-G-T p.Ser282Ser synonymous ANKRD52 3 82758 3.62503E-5 41379 0 3.31208E-5
12-56647917-T-C p.Ala280Ala synonymous ANKRD52 8 82772 9.6651E-5 41386 0 6.38162E-5
12-56647936-G-A p.Thr274Met missense ANKRD52 2 82774 2.41622E-5 41387 0 3.18695E-5
12-56647951-T-C p.Asn269Ser missense ANKRD52 1 82770 1.20817E-5 41385 0 8.27993E-6
12-56647953-C-A p.Pro268Pro synonymous ANKRD52 2 82776 2.41616E-5 41388 0 1.91156E-4
12-56647953-C-T p.Pro268Pro synonymous ANKRD52 5 82776 6.0404E-5 41388 0 6.25E-4
12-56647966-T-C p.Asn264Ser missense ANKRD52 1 82788 1.2079E-5 41394 0 NA
12-56647971-T-G p.Gly262Gly synonymous ANKRD52 1 82794 1.20782E-5 41397 0 NA
12-56647974-G-A p.Ala261Ala synonymous ANKRD52 20 82794 2.41563E-4 41397 0 5.04032E-4
12-56647990-A-G p.Ile256Thr missense ANKRD52 1 82818 1.20747E-5 41409 0 1.65604E-5
12-56647991-T-C p.Ile256Val missense ANKRD52 1 82824 1.20738E-5 41412 0 5.03525E-4
12-56648007-G-A p.Gly250Gly synonymous ANKRD52 2 82830 2.41458E-5 41415 0 NA
12-56648021-C-T p.Ala246Thr missense ANKRD52 43 82824 5.19173E-4 41412 0 5.49711E-4
12-56648022-G-A p.Ile245Ile synonymous ANKRD52 2 82828 2.41464E-5 41414 0 4.01236E-6
12-56648031-A-G p.Ala242Ala synonymous ANKRD52 20 82822 2.41482E-4 41411 0 3.89202E-4
12-56648043-A-G p.Phe238Phe synonymous ANKRD52 1 82824 1.20738E-5 41412 0 4.14072E-5
12-56648047-G-A p.Ala237Val missense ANKRD52 1 82826 1.20735E-5 41413 0 8.28253E-6
12-56648050-T-C p.Asn236Ser missense ANKRD52 2 82818 2.41493E-5 41409 0 NA
12-56648066-G-A c.694-3C>T splice_region ANKRD52 190 82756 0.00229591 41378 2 0.00436639
12-56648365-C-T p.Ala230Ala synonymous ANKRD52 10 82078 1.21835E-4 41039 0 6.67256E-5
12-56648366-G-A p.Ala230Val missense ANKRD52 11 82078 1.34019E-4 41039 0 6.05751E-4
12-56648376-G-A p.Arg227Trp missense ANKRD52 1 82262 1.21563E-5 41131 0 2.00815E-5
12-56648384-T-C p.Tyr224Cys missense ANKRD52 1 82316 1.21483E-5 41158 0 4.0149E-6
12-56648392-C-A p.Val221Val synonymous ANKRD52 1 82334 1.21457E-5 41167 0 6.36821E-5
12-56648409-T-C p.Ser216Gly missense ANKRD52 5 82334 6.07283E-5 41167 0 5.04032E-4
12-56648435-T-C p.Tyr207Cys missense ANKRD52 1 82332 1.21459E-5 41166 0 NA
12-56648440-C-T p.Lys205Lys synonymous ANKRD52 2 82374 2.42795E-5 41187 0 NA
12-56648444-C-T p.Arg204His missense ANKRD52 1 82382 1.21386E-5 41191 0 3.18573E-5
12-56648445-G-A p.Arg204Cys missense ANKRD52 3 82376 3.64184E-5 41188 0 0.00151057
12-56648458-G-A p.Leu199Leu synonymous ANKRD52 3 82356 3.64272E-5 41178 0 3.35362E-5
12-56648461-G-C p.Asp198Glu missense ANKRD52 52 82358 6.3139E-4 41179 0 0.00140208
12-56648472-G-A p.Arg195Trp missense ANKRD52 3 82334 3.6437E-5 41167 0 2.8677E-4
12-56648474-G-A p.Ala194Val missense ANKRD52 1 82330 1.21462E-5 41165 0 NA
12-56648479-C-T p.Leu192Leu synonymous ANKRD52 1 82334 1.21457E-5 41167 0 NA
12-56648491-G-A p.Val188Val synonymous ANKRD52 2 82326 2.42937E-5 41163 0 5.03525E-4
12-56648501-T-C p.His185Arg missense ANKRD52 1 82308 1.21495E-5 41154 0 NA
12-56648507-G-A c.551-3C>T splice_region ANKRD52 2 82312 2.42978E-5 41156 0 NA
12-56648681-TC-AA p.Glu173Leu missense ANKRD52 1 81930 1.22055E-5 40965 0 NA
12-56648683-C-T p.Lys172Lys synonymous ANKRD52 1 81932 1.22052E-5 40966 0 4.01191E-6
12-56648722-G-A p.Leu159Leu synonymous ANKRD52 2 81660 2.44918E-5 40830 0 1.20406E-5
12-56648734-C-T p.Thr155Thr splice_region+synonymous ANKRD52 4 81438 4.91171E-5 40719 0 3.18613E-5
12-56649562-C-A c.462+6G>T splice_region ANKRD52 5 78020 6.40861E-5 39010 0 1.91071E-4
12-56649562-C-T c.462+6G>A splice_region ANKRD52 8 78020 1.02538E-4 39010 0 1.59226E-4
12-56649577-C-T p.Gly151Gly synonymous ANKRD52 2 78406 2.55083E-5 39203 0 NA
12-56649583-A-G p.His149His synonymous ANKRD52 1 78586 1.27249E-5 39293 0 NA
12-56649587-A-G p.Val148Ala missense ANKRD52 1 78608 1.27214E-5 39304 0 NA
12-56649601-A-G p.Ala143Ala synonymous ANKRD52 66349 76006 0.872944 38003 29760 0.95125
12-56649608-C-T p.Arg141His missense ANKRD52 2 78848 2.53653E-5 39424 0 4.92354E-6
12-56649626-A-G p.Val135Ala missense ANKRD52 3 79184 3.78864E-5 39592 0 1.02115E-5
12-56649627-C-T p.Val135Met missense ANKRD52 1 79200 1.26263E-5 39600 0 0.00125
12-56649628-G-A p.Asn134Asn synonymous ANKRD52 1 79242 1.26196E-5 39621 0 2.56819E-5
12-56649633-G-A p.Leu133Phe missense ANKRD52 1 79270 1.26151E-5 39635 0 NA
12-56649677-C-T p.Arg118Gln missense ANKRD52 1 79438 1.25884E-5 39719 0 3.40229E-5
12-56649691-C-T p.Val113Val synonymous ANKRD52 1 79530 1.25739E-5 39765 0 3.44709E-5
12-56649700-T-C p.Pro110Pro synonymous ANKRD52 1 79580 1.2566E-5 39790 0 0.0010352
12-56649732-C-T p.Val100Met missense ANKRD52 1 79728 1.25426E-5 39864 0 NA
12-56650802-G-A p.Asn86Asn synonymous ANKRD52 1 82336 1.21454E-5 41168 0 NA
12-56650832-G-A p.Thr76Thr synonymous ANKRD52 2 82420 2.4266E-5 41210 0 NA
12-56650835-C-T p.Leu75Leu synonymous ANKRD52 4 82416 4.85343E-5 41208 0 6.25E-4
12-56650837-G-C p.Leu75Val missense ANKRD52 2 82412 2.42683E-5 41206 0 NA
12-56650839-C-G p.Trp74Ser missense ANKRD52 1 82402 1.21356E-5 41201 0 NA
12-56650846-T-A p.Thr72Ser missense ANKRD52 1 82386 1.2138E-5 41193 0 8.48882E-6
12-56650851-T-A p.Lys70Met missense ANKRD52 1 82384 1.21383E-5 41192 0 8.06705E-6
12-56650872-G-A c.191-3C>T splice_region ANKRD52 340 82248 0.00413384 41124 1 0.00405916
12-56651088-G-A p.Leu57Phe missense ANKRD52 1 82234 1.21604E-5 41117 0 8.95039E-6
12-56651097-C-T p.Val54Ile missense ANKRD52 8 82220 9.72999E-5 41110 0 0.0020141
12-56651100-C-T p.Asp53Asn missense ANKRD52 1 82192 1.21666E-5 41096 0 NA
12-56651110-G-A p.Ala49Ala synonymous ANKRD52 2 82150 2.43457E-5 41075 0 1.89147E-4
12-56651111-G-A p.Ala49Val missense ANKRD52 7 82144 8.52162E-5 41072 0 4.23962E-5
12-56651145-C-CCAGCACATTGATGTTCTCCTT c.112-1_112insAAGGAGAACATCAATGTGCTG splice_acceptor ANKRD52 1 81742 1.22336E-5 40871 0 NA
12-56651147-T-TTGATGTTCTCCTTCTGCGAGAGTA c.112-3_112-2insTACTCTCGCAGAAGGAGAACATCA splice_region ANKRD52 1 81682 1.22426E-5 40841 0 NA
12-56651150-G-A c.112-5C>T splice_region ANKRD52 1 81648 1.22477E-5 40824 0 3.21357E-5
12-56651619-T-C p.Asn35Ser missense ANKRD52 4 81128 4.93048E-5 40564 0 0.00111685
12-56651630-C-T p.Lys31Lys synonymous ANKRD52 4 81374 4.91558E-5 40687 0 4.2875E-5
12-56651639-G-A p.Leu28Leu synonymous ANKRD52 1 81458 1.22763E-5 40729 0 NA
12-56651641-G-T p.Leu28Ile missense ANKRD52 2 81458 2.45525E-5 40729 0 2.41593E-5
12-56651645-G-A p.Ser26Ser synonymous ANKRD52 1 81534 1.22648E-5 40767 0 NA
12-56651655-T-A p.Glu23Val missense ANKRD52 1 81442 1.22787E-5 40721 0 8.05497E-6
12-56651657-C-T p.Glu22Glu synonymous ANKRD52 2 81464 2.45507E-5 40732 0 NA
12-56651664-T-C p.Asp20Gly missense ANKRD52 1 81266 1.23053E-5 40633 0 NA
12-56651669-G-A p.Ser18Ser synonymous ANKRD52 1 81168 1.23201E-5 40584 0 NA
12-56651678-G-A p.Ala15Ala synonymous ANKRD52 1 80974 1.23496E-5 40487 0 NA
12-56651687-C-G p.Leu12Leu synonymous ANKRD52 1 80704 1.2391E-5 40352 0 4.25062E-5
12-56651701-G-C c.28-6C>G splice_region ANKRD52 1 80118 1.24816E-5 40059 0 NA
12-56651701-G-GA c.28-7_28-6insT splice_region ANKRD52 1 80118 1.24816E-5 40059 0 4.05124E-6
12-56652019-G-A c.27+8C>T splice_region ANKRD52 1 75948 1.31669E-5 37974 0 NA
12-56652033-C-A p.Thr7Thr synonymous ANKRD52 2 75832 2.63741E-5 37916 0 NA
12-56652039-G-A p.Ser5Ser synonymous ANKRD52 1 75874 1.31797E-5 37937 0 4.53128E-6
12-56652059-G-A c.-6C>T 5_prime_UTR_premature_start_codon_gain ANKRD52 1 74478 1.34268E-5 37239 0 NA
12-56652094-G-A c.-41C>T 5_prime_UTR_premature_start_codon_gain ANKRD52 3 70132 4.27765E-5 35066 0 1.28941E-4
12-56652097-G-A c.-44C>T 5_prime_UTR_premature_start_codon_gain ANKRD52 1 69384 1.44125E-5 34692 0 7.8765E-6
12-56652110-C-G c.-57G>C 5_prime_UTR_premature_start_codon_gain ANKRD52 1 66536 1.50295E-5 33268 0 9.68992E-5
12-56652119-C-A c.-66G>T 5_prime_UTR_premature_start_codon_gain ANKRD52 1 64046 1.56138E-5 32023 0 NA
12-56652134-G-A c.-81C>T 5_prime_UTR_premature_start_codon_gain ANKRD52 5 59074 8.46396E-5 29537 0 0.00135318