Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
11-94227125-C-T c.-167C>T 5_prime_UTR_premature_start_codon_gain ANKRD49 2 2880 6.94444E-4 1440 0 0.002234
11-94227208-T-C c.-91+7T>C splice_region ANKRD49 9 2894 0.00310988 1447 0 0.010426
11-94227241-G-T c.-186G>T 5_prime_UTR_premature_start_codon_gain ANKRD49 2 2660 7.5188E-4 1330 1 2.23243E-4
11-94229860-A-C p.Met1? initiator_codon ANKRD49 2 83102 2.40668E-5 41551 0 NA
11-94229879-A-G p.Asn7Ser missense ANKRD49 3 83194 3.60603E-5 41597 0 4.18817E-5
11-94229880-T-A p.Asn7Lys missense ANKRD49 2 83192 2.40408E-5 41596 0 3.50831E-5
11-94229893-C-G p.Pro12Ala missense ANKRD49 1 83238 1.20137E-5 41619 0 NA
11-94229902-G-A p.Glu15Lys missense ANKRD49 1 83266 1.20097E-5 41633 0 NA
11-94229922-T-C p.Ser21Ser synonymous ANKRD49 3 83264 3.603E-5 41632 0 NA
11-94229930-T-C p.Phe24Ser missense ANKRD49 1 83278 1.2008E-5 41639 0 NA
11-94229948-T-C p.Leu30Ser missense ANKRD49 1 83314 1.20028E-5 41657 0 NA
11-94229981-C-G p.Thr41Ser missense ANKRD49 1 83306 1.20039E-5 41653 0 NA
11-94229985-A-T p.Gln42His missense ANKRD49 3 83308 3.60109E-5 41654 0 3.97772E-6
11-94229993-G-C p.Trp45Ser missense+splice_region ANKRD49 1 83300 1.20048E-5 41650 0 NA
11-94229995-G-A c.135+1G>A splice_donor ANKRD49 11 83298 1.32056E-4 41649 0 5.09749E-4
11-94230011-A-C p.Glu51Ala missense ANKRD49 2 83286 2.40136E-5 41643 0 NA
11-94230024-A-G p.Gln55Gln synonymous ANKRD49 1 83278 1.2008E-5 41639 0 NA
11-94230050-G-A p.Arg64Gln missense ANKRD49 1 83194 1.20201E-5 41597 0 6.39632E-5
11-94230050-G-T p.Arg64Leu missense ANKRD49 1 83194 1.20201E-5 41597 0 NA
11-94230054-G-A p.Leu65Leu synonymous ANKRD49 4 83146 4.81081E-5 41573 0 4.80973E-5
11-94230066-A-G p.Lys69Lys synonymous ANKRD49 1 83144 1.20273E-5 41572 0 NA
11-94230083-G-A p.Ser75Asn missense ANKRD49 2 82924 2.41185E-5 41462 0 5.01437E-5
11-94230093-T-G p.Leu78Leu synonymous ANKRD49 1 82812 1.20755E-5 41406 0 3.19346E-5
11-94230108-A-C p.Glu83Asp missense ANKRD49 2 82508 2.42401E-5 41254 0 2.53824E-5
11-94230110-A-ACACAAATAC p.Lys84delinsAsnThrAsnThr disruptive_inframe_insertion ANKRD49 1 82464 1.21265E-5 41232 0 NA
11-94230115-C-T p.Arg86Trp missense+splice_region ANKRD49 1 82208 1.21643E-5 41104 0 8.50311E-6
11-94230118-G-GT p.Ile91fs frameshift ANKRD49 1 82218 1.21628E-5 41109 0 NA
11-94230119-TA-T p.Ile91fs frameshift ANKRD49 7 79392 8.81701E-5 39696 0 0.0153206
11-94230119-T-TA p.Ile91fs frameshift ANKRD49 24 80690 2.97435E-4 40345 0 0.00429523
11-94230125-A-C p.Lys89Thr missense ANKRD49 1 82072 1.21844E-5 41036 0 NA
11-94230173-G-T p.Ser105Ile missense ANKRD49 2 79522 2.51503E-5 39761 0 NA
11-94230176-A-T p.Gln106Leu missense ANKRD49 1 79406 1.25935E-5 39703 0 NA
11-94230180-G-T p.Lys107Asn missense ANKRD49 1 79294 1.26113E-5 39647 0 1.69735E-5
11-94230180-G-A p.Lys107Lys synonymous ANKRD49 1 79294 1.26113E-5 39647 0 NA
11-94230194-G-A p.Cys112Tyr missense ANKRD49 1 78726 1.27023E-5 39363 0 4.28949E-6
11-94230198-T-C p.Tyr113Tyr synonymous ANKRD49 20 78570 2.5455E-4 39285 0 1.85617E-4
11-94230204-T-C p.His115His synonymous ANKRD49 1 78366 1.27606E-5 39183 0 NA
11-94230210-C-G p.Thr117Thr synonymous ANKRD49 1 78208 1.27864E-5 39104 0 4.3751E-6
11-94230291-T-A c.*47+7T>A splice_region ANKRD49 3 71250 4.21053E-5 35625 0 9.5584E-5
11-94231065-C-T c.259-3C>T splice_region ANKRD49 19 28598 6.64382E-4 14299 0 9.55414E-5
11-94231130-AGTAAGTTTTTATTCAACTTAATTAAATCTAACACCACAAGACAATTTTGTTTTAGTTATTGTTTTGGTTTGAGTTGAGTTGAAAGATTTCTTTTTTTTCTTCTCAG-A c.259-106_259-1del splice_acceptor ANKRD49 2 66450 3.00978E-5 33225 0 NA
11-94231220-C-CT c.259-9dupT splice_region ANKRD49 1 81134 1.23253E-5 40567 0 5.22379E-5
11-94231245-A-G p.Thr89Thr synonymous ANKRD49 4 82924 4.82369E-5 41462 0 5.03525E-4
11-94231249-C-T p.Arg91Trp missense ANKRD49 1 82954 1.20549E-5 41477 0 NA
11-94231250-G-A p.Arg91Gln missense ANKRD49 3 82962 3.61611E-5 41481 0 3.62252E-5
11-94231251-G-A p.Arg91Arg synonymous ANKRD49 1 82970 1.20525E-5 41485 0 8.45209E-6
11-94231257-C-G p.Leu93Leu synonymous ANKRD49 39029 75138 0.519431 37569 9548 0.586405
11-94231273-A-G p.Thr99Ala missense ANKRD49 40 83190 4.80827E-4 41595 0 0.00124275
11-94231274-C-T p.Thr99Ile missense ANKRD49 1 83198 1.20195E-5 41599 0 8.2575E-5
11-94231278-C-T c.*48C>T splice_region ANKRD49 4 83228 4.80607E-5 41614 0 1.23707E-4
11-94231292-A-C p.Asp105Ala missense ANKRD49 1 83300 1.20048E-5 41650 0 NA
11-94231311-T-G p.Pro146Pro splice_region+synonymous ANKRD49 2 83322 2.40033E-5 41661 0 8.35695E-5
11-94231319-G-A p.Arg114Gln missense ANKRD49 1 83328 1.20008E-5 41664 0 1.1938E-5
11-94231323-A-T p.Ala115Ala synonymous ANKRD49 133 83338 0.00159591 41669 5 0.00483784
11-94231330-A-G p.Ser118Gly missense ANKRD49 1 83346 1.19982E-5 41673 0 NA
11-94231377-T-C p.Asp133Asp synonymous ANKRD49 1 83354 1.1997E-5 41677 0 NA
11-94231407-G-A p.Thr143Thr synonymous ANKRD49 7 83346 8.39872E-5 41673 0 1.07387E-4
11-94231439-C-G p.Thr154Ser missense ANKRD49 1 83326 1.20011E-5 41663 0 9.55597E-5
11-94231446-G-A p.Val156Val synonymous ANKRD49 2 83326 2.40021E-5 41663 0 NA
11-94231455-C-T p.Phe159Phe synonymous ANKRD49 4 83276 4.8033E-5 41638 0 0.00280403
11-94231463-A-G p.Gln162Arg missense ANKRD49 1 83314 1.20028E-5 41657 0 6.25E-4
11-94231495-G-A p.Gly173Ser missense ANKRD49 1 83250 1.2012E-5 41625 0 NA
11-94231496-G-C p.Gly173Ala missense ANKRD49 1 83240 1.20135E-5 41620 0 NA
11-94231506-C-T p.Thr176Thr synonymous ANKRD49 2 83086 2.40714E-5 41543 0 9.55292E-5
11-94231532-G-A p.Arg185Lys missense ANKRD49 2 82600 2.42131E-5 41300 0 3.18471E-5
11-94231545-T-C p.Asp189Asp synonymous ANKRD49 1 82332 1.21459E-5 41166 0 3.18451E-5
11-94231549-C-G p.Leu191Val missense ANKRD49 1 82234 1.21604E-5 41117 0 3.98175E-6
11-94231554-ACTC-A p.Leu195del disruptive_inframe_deletion ANKRD49 2 82148 2.43463E-5 41074 0 1.1946E-5
11-94231561-C-T p.Leu195Leu synonymous ANKRD49 1 82088 1.2182E-5 41044 0 1.64848E-5
11-94231570-C-T p.Arg198Cys missense ANKRD49 1 81968 1.21999E-5 40984 0 1.19519E-5
11-94231571-G-A p.Arg198His missense ANKRD49 2 81966 2.44004E-5 40983 0 8.24457E-6
11-94231576-G-A p.Val200Ile missense ANKRD49 14 81914 1.70911E-4 40957 0 6.36821E-5
11-94231592-A-G p.Lys205Arg missense ANKRD49 1 81942 1.22038E-5 40971 0 NA
11-94231602-G-A p.Leu208Leu synonymous ANKRD49 15 81940 1.83061E-4 40970 0 1.59342E-4
11-94231607-A-G p.Glu210Gly missense ANKRD49 1 81960 1.22011E-5 40980 0 3.98356E-6
11-94231628-G-A p.Arg217Lys missense ANKRD49 4 81826 4.88842E-5 40913 0 NA
11-94231632-G-A p.Arg218Arg synonymous ANKRD49 1 81816 1.22225E-5 40908 0 NA
11-94231643-A-ATCAC p.Tyr224fs frameshift ANKRD49 1 81774 1.22288E-5 40887 0 3.18471E-5
11-94231646-A-G p.His223Arg missense ANKRD49 1 81760 1.22309E-5 40880 0 8.32348E-6
11-94231648-T-C p.Tyr224His missense ANKRD49 1 81754 1.22318E-5 40877 0 3.1841E-5
11-94231657-G-A p.Glu227Lys missense ANKRD49 1 81706 1.2239E-5 40853 0 4.00782E-6
11-94231682-C-T p.Ser235Phe missense ANKRD49 1 81546 1.2263E-5 40773 0 NA