Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
2-97505829-CGATCT-C c.*902-2_*904delAGATC splice_acceptor ANKRD39 15 80740 1.85782E-4 40370 1 6.37186E-5
2-97505832-TCTGAGAGCAAGTGGGGGTCAGTGCTGGGTCTGGATTGGTGAGGCCTCCCTAACCCATGGGACTACGTGCTCTCTTCTCCAGGAACAGCGTCTGCTCCCGTGTTCCCGACAGGCCCCCAAAGCACCGTGCCCCTCAC-T c.*901+1_*902-1del splice_acceptor ANKRD39 5 80790 6.18888E-5 40395 0 NA
2-97505834-T-TTGTCCCGGGCATTGACCCGGGCTCCCTG c.*902-3_*902-2insCAGGGAGCCCGGGTCAATGCCCGGGACA splice_region ANKRD39 1 80834 1.2371E-5 40417 0 NA
2-97505955-ACCGTGC-A c.*901+8_*901+13delGCACGG splice_region ANKRD39 2 82204 2.43297E-5 41102 0 NA
2-97505962-C-G c.*901+7G>C splice_region ANKRD39 1 82356 1.21424E-5 41178 0 4.15062E-6
2-97505969-CT-C c.*900delA splice_region ANKRD39 1 82418 1.21333E-5 41209 0 6.36943E-5
2-97506067-GCTGCAAAACAAAAGCACCCAAGCACTCAGCTGCTGGGATGTGAAGCTGGGCGTCGACCAGAGGCTGGGCCTTTCCCCATCCTCAC-G c.*802+1_*803-1delGTGAGGATGGGGAAAGGCCCAGCCTCTGGTCGACGCCCAGCTTCACATCCCAGCAGCTGAGTGCTTGGGTGCTTTTGTTTTGCAG splice_acceptor ANKRD39 5 82564 6.05591E-5 41282 0 NA
2-97506152-C-T c.*802+1G>A splice_donor ANKRD39 3 82374 3.64193E-5 41187 0 6.25E-4
2-97506634-GGGCCTGGGACTGCGGCT-G c.*306-2_*320delAGCCGCAGTCCCAGGCC splice_acceptor ANKRD39 3 82960 3.6162E-5 41480 0 NA
2-97506655-T-TG c.*306-7_*306-6insC splice_region ANKRD39 3 82612 3.63143E-5 41306 0 NA
2-97506656-C-A c.*306-7G>T splice_region ANKRD39 3 82608 3.63161E-5 41304 0 NA
2-97506656-C-G c.*306-7G>C splice_region ANKRD39 1 82608 1.21054E-5 41304 0 1.65837E-5
2-97507922-G-GTTT c.*180-1_*180insAAA splice_acceptor ANKRD39 2 83108 2.40651E-5 41554 0 NA
2-97507930-A-G c.*180-8T>C splice_region ANKRD39 1 83030 1.20438E-5 41515 0 NA
2-97508094-T-C c.*179+8A>G splice_region ANKRD39 3 77420 3.87497E-5 38710 0 0.00161616
2-97508096-T-C c.*179+6A>G splice_region ANKRD39 10 78830 1.26855E-4 39415 0 1.43194E-4
2-97508098-T-C c.*179+4A>G splice_region ANKRD39 4 79984 5.001E-5 39992 0 2.51921E-5
2-97508102-TTTC-T c.*176_*178delGAA splice_region ANKRD39 9 80674 1.1156E-4 40337 0 2.71998E-4
2-97508103-T-C c.*178A>G splice_region ANKRD39 1 80796 1.23769E-5 40398 0 NA
2-97508249-C-A c.*33-1G>T splice_acceptor ANKRD39 1 83014 1.20462E-5 41507 0 NA
2-97514043-T-A p.Ser183Cys missense ANKRD39 5 82932 6.02904E-5 41466 0 2.54956E-4
2-97514057-C-T p.Arg178Gln missense ANKRD39 2 83008 2.40941E-5 41504 0 3.18593E-5
2-97514058-G-A p.Arg178Trp missense ANKRD39 16 83006 1.92757E-4 41503 0 1.59266E-4
2-97514058-G-T p.Arg178Arg synonymous ANKRD39 1 83006 1.20473E-5 41503 0 3.18532E-5
2-97514080-C-A p.Leu170Leu synonymous ANKRD39 1 83090 1.20351E-5 41545 0 3.98073E-6
2-97514081-A-C p.Leu170Arg missense ANKRD39 1 83096 1.20343E-5 41548 0 NA
2-97514082-G-C p.Leu170Val missense ANKRD39 1 83096 1.20343E-5 41548 0 NA
2-97514090-G-C p.Ala167Gly missense ANKRD39 2 83078 2.40738E-5 41539 0 3.18431E-5
2-97514095-C-CCGT p.Arg165dup disruptive_inframe_insertion ANKRD39 1 83090 1.20351E-5 41545 0 NA
2-97514096-C-T p.Arg165Gln missense ANKRD39 1 83084 1.2036E-5 41542 0 0.00100705
2-97514100-C-A p.Ala164Ser missense ANKRD39 2 83096 2.40685E-5 41548 0 3.18512E-5
2-97514105-C-T p.Arg162Gln missense ANKRD39 2 83112 2.40639E-5 41556 0 4.9613E-5
2-97514106-G-A p.Arg162* stop_gained ANKRD39 1 83114 1.20317E-5 41557 0 1.99003E-5
2-97514111-C-T p.Arg160Gln missense ANKRD39 3 83114 3.6095E-5 41557 0 6.25E-4
2-97514122-C-T p.Leu156Leu synonymous ANKRD39 3 83142 3.60828E-5 41571 0 NA
2-97514126-G-C p.Ala155Gly missense ANKRD39 4 83144 4.81093E-5 41572 0 3.18492E-5
2-97514128-T-C p.Pro154Pro synonymous ANKRD39 1 83148 1.20267E-5 41574 0 8.26651E-6
2-97514130-G-C p.Pro154Ala missense ANKRD39 3 83128 3.60889E-5 41564 0 3.18471E-5
2-97514139-G-T p.Gln151Lys missense ANKRD39 2 83100 2.40674E-5 41550 0 NA
2-97514144-A-G p.Leu149Pro missense ANKRD39 6 83100 7.22022E-5 41550 0 3.98004E-6
2-97514163-C-T p.Gly143Arg missense ANKRD39 5 82956 6.02729E-5 41478 0 6.36943E-5
2-97514164-G-A p.His142His synonymous ANKRD39 2 82934 2.41156E-5 41467 0 2.48077E-5
2-97514167-AC-A p.Gly141fs frameshift ANKRD39 2 82872 2.41336E-5 41436 0 NA
2-97514169-C-A p.Gly141Cys missense ANKRD39 1 82904 1.20621E-5 41452 0 NA
2-97514183-T-TTATGCAGACTGGTCATGCCGTCGTCATCCACCACCCTGGG c.409-3_409-2insCCCAGGGTGGTGGATGACGACGGCATGACCAGTCTGCATA splice_region ANKRD39 1 82810 1.20758E-5 41405 0 NA
2-97519142-T-C p.His135Arg missense ANKRD39 2 82160 2.43427E-5 41080 0 3.6547E-5
2-97519144-C-T p.Leu134Leu synonymous ANKRD39 1 82170 1.21699E-5 41085 0 NA
2-97519149-T-C p.Ser133Gly missense ANKRD39 1 82244 1.21589E-5 41122 0 NA
2-97519151-G-T p.Thr132Asn missense ANKRD39 1 82252 1.21578E-5 41126 0 NA
2-97519156-G-C p.Gly130Gly synonymous ANKRD39 1 82278 1.21539E-5 41139 0 NA
2-97519158-C-T p.Gly130Ser missense ANKRD39 1 82256 1.21572E-5 41128 0 1.89239E-4
2-97519159-G-A p.Asp129Asp synonymous ANKRD39 322 82254 0.0039147 41127 1 0.00833333
2-97519161-C-T p.Asp129Asn missense ANKRD39 2 82310 2.42984E-5 41155 0 6.0042E-5
2-97519162-G-A p.Asp128Asp synonymous ANKRD39 4 82322 4.85897E-5 41161 0 1.76616E-4
2-97519170-C-T p.Val126Met missense ANKRD39 9 82378 1.09252E-4 41189 0 8.06018E-5
2-97519174-C-A p.Arg124Ser missense ANKRD39 1 82364 1.21412E-5 41182 0 NA
2-97519189-A-G p.His119His synonymous ANKRD39 1 82358 1.21421E-5 41179 0 6.25E-4
2-97519198-C-T p.Leu116Leu synonymous ANKRD39 1 82396 1.21365E-5 41198 0 5.06073E-4
2-97519205-C-T p.Arg114Gln missense ANKRD39 5 82338 6.07253E-5 41169 0 1.91034E-4
2-97519206-G-A p.Arg114Trp missense ANKRD39 18 82352 2.18574E-4 41176 0 0.00151668
2-97519206-G-T p.Arg114Arg synonymous ANKRD39 1 82352 1.2143E-5 41176 0 1.7733E-5
2-97519207-C-T p.Ala113Ala synonymous ANKRD39 1 82350 1.21433E-5 41175 0 8.63468E-5
2-97519209-C-T p.Ala113Thr missense ANKRD39 7 82358 8.49948E-5 41179 0 1.45495E-4
2-97519210-G-A p.Ile112Ile synonymous ANKRD39 3 82374 3.64193E-5 41187 0 1.67157E-5
2-97519221-G-C p.His109Asp missense ANKRD39 1 82362 1.21415E-5 41181 0 NA
2-97519225-G-A p.Cys107Cys synonymous ANKRD39 3 82334 3.6437E-5 41167 0 8.29187E-5
2-97519228-G-A p.Tyr106Tyr synonymous ANKRD39 2 82406 2.42701E-5 41203 0 NA
2-97519238-C-T p.Arg103Gln missense ANKRD39 1 82308 1.21495E-5 41154 0 3.07579E-5
2-97519239-G-A p.Arg103* stop_gained ANKRD39 4 82318 4.8592E-5 41159 0 9.55536E-5
2-97519255-A-AC p.Ala98fs frameshift ANKRD39 1 82328 1.21465E-5 41164 0 NA
2-97519261-G-A p.His95His synonymous ANKRD39 1 82404 1.21353E-5 41202 0 6.36902E-5
2-97519279-C-T p.Lys89Lys synonymous ANKRD39 1 82350 1.21433E-5 41175 0 1.74883E-5
2-97519279-C-A p.Lys89Asn missense ANKRD39 1 82350 1.21433E-5 41175 0 NA
2-97519287-C-T p.Gly87Arg missense ANKRD39 1 82190 1.21669E-5 41095 0 6.36983E-5
2-97519294-C-T p.Leu84Leu synonymous ANKRD39 1 82058 1.21865E-5 41029 0 3.1841E-5
2-97519303-C-A p.Gln81His missense ANKRD39 2 81822 2.44433E-5 40911 0 NA
2-97519311-C-T p.Val79Met missense ANKRD39 1 81400 1.2285E-5 40700 0 3.18431E-5
2-97519314-C-T p.Ala78Thr missense ANKRD39 2 81152 2.46451E-5 40576 0 7.98843E-6
2-97519315-G-A p.Tyr77Tyr synonymous ANKRD39 7 81150 8.626E-5 40575 0 9.66727E-5
2-97519328-C-T p.Arg73His missense ANKRD39 1 80188 1.24707E-5 40094 0 2.70348E-5
2-97519329-G-A p.Arg73Cys missense ANKRD39 1 80122 1.2481E-5 40061 0 4.00529E-6
2-97519330-G-A p.Ser72Ser synonymous ANKRD39 4 80020 4.99875E-5 40010 0 2.22887E-4
2-97519334-G-C p.Ala71Gly missense ANKRD39 2 79630 2.51162E-5 39815 0 3.18471E-5
2-97519336-A-AT p.Tyr70fs frameshift ANKRD39 1 79414 1.25922E-5 39707 0 9.15097E-6
2-97519342-C-CAGCGCAG c.205-2_205-1insCTGCGCT splice_acceptor ANKRD39 2 78854 2.53633E-5 39427 1 NA
2-97519342-C-CT c.205-2_205-1insA splice_acceptor ANKRD39 1 78854 1.26817E-5 39427 0 NA
2-97520078-C-T p.Ala67Ala synonymous ANKRD39 1 82154 1.21723E-5 41077 0 3.18552E-5
2-97520079-G-A p.Ala67Val missense ANKRD39 1 82198 1.21657E-5 41099 0 8.26979E-6
2-97520082-G-C p.Thr66Ser missense ANKRD39 3 82250 3.64742E-5 41125 0 6.61179E-5
2-97520089-C-T p.Gly64Ser missense ANKRD39 4 82270 4.86204E-5 41135 0 3.18634E-5
2-97520089-C-G p.Gly64Arg missense ANKRD39 8 82270 9.72408E-5 41135 0 3.18634E-5
2-97520090-G-A p.Ala63Ala synonymous ANKRD39 1 82296 1.21513E-5 41148 0 0.00125
2-97520093-C-T p.Ser62Ser synonymous ANKRD39 2 82366 2.42819E-5 41183 0 6.25E-4
2-97520094-G-A p.Ser62Leu missense ANKRD39 63 82414 7.64433E-4 41207 0 7.09477E-4
2-97520096-G-T p.Asp61Glu missense ANKRD39 1 82472 1.21253E-5 41236 0 1.19372E-5
2-97520098-C-T p.Asp61Asn missense ANKRD39 4 82498 4.8486E-5 41249 0 4.94813E-5
2-97520099-G-A p.Pro60Pro synonymous ANKRD39 53 82532 6.42175E-4 41266 0 4.6157E-4
2-97520104-G-T p.Gln59Lys missense ANKRD39 1 82658 1.2098E-5 41329 0 NA
2-97520105-A-T p.Ser58Arg missense ANKRD39 1 82652 1.20989E-5 41326 0 8.24307E-6
2-97520116-C-T p.Glu55Lys missense ANKRD39 2 82720 2.41779E-5 41360 0 2.47243E-5
2-97520117-G-A p.Ala54Ala synonymous ANKRD39 1 82752 1.20843E-5 41376 0 3.29652E-5
2-97520122-T-C p.Lys53Glu missense ANKRD39 29 82802 3.50233E-4 41401 1 0.00503525
2-97520124-T-C p.Gln52Arg missense ANKRD39 1 82834 1.20723E-5 41417 0 4.94429E-5
2-97520142-C-T p.Arg46Gln missense ANKRD39 6 82902 7.23746E-5 41451 0 5.04032E-4
2-97520143-G-C p.Arg46Gly missense ANKRD39 1 82890 1.20642E-5 41445 0 7.95583E-6
2-97520143-G-A p.Arg46* stop_gained ANKRD39 1 82890 1.20642E-5 41445 0 1.19337E-5
2-97520145-C-T p.Gly45Asp missense ANKRD39 1 82904 1.20621E-5 41452 0 NA
2-97520147-C-T p.Leu44Leu synonymous ANKRD39 1 82930 1.20584E-5 41465 0 3.1837E-5
2-97520168-C-T p.Ser37Ser synonymous ANKRD39 1 82854 1.20694E-5 41427 0 9.55049E-5
2-97520172-C-T p.Trp36* stop_gained ANKRD39 1 82854 1.20694E-5 41427 0 NA
2-97520174-G-A p.Ile35Ile synonymous ANKRD39 1 82846 1.20706E-5 41423 0 NA
2-97520177-T-TCC p.Ile35fs frameshift ANKRD39 2 82820 2.41488E-5 41410 1 NA
2-97520183-A-G c.101-5T>C splice_region ANKRD39 1 82786 1.20793E-5 41393 0 NA
2-97520185-A-G c.101-7T>C splice_region ANKRD39 1 82788 1.2079E-5 41394 0 NA
2-97523619-C-T c.100+6G>A splice_region ANKRD39 6 77466 7.74533E-5 38733 0 8.98083E-5
2-97523624-C-G c.100+1G>C splice_donor ANKRD39 1 77604 1.28859E-5 38802 0 1.53052E-5
2-97523634-A-C p.Phe31Val missense ANKRD39 1 77780 1.28568E-5 38890 0 NA
2-97523635-G-A p.Asp30Asp synonymous ANKRD39 88 77736 0.00113204 38868 1 0.00231802
2-97523640-T-A p.Met29Leu missense ANKRD39 3 77750 3.85852E-5 38875 0 4.85446E-6
2-97523640-T-C p.Met29Val missense ANKRD39 1 77750 1.28617E-5 38875 0 1.45634E-5
2-97523652-T-G p.Thr25Pro missense ANKRD39 1 77724 1.2866E-5 38862 0 NA
2-97523655-G-C p.Gln24Glu missense ANKRD39 2 77706 2.5738E-5 38853 0 4.83952E-6
2-97523657-T-C p.Gln23Arg missense ANKRD39 2 77676 2.5748E-5 38838 0 2.68557E-5
2-97523664-C-T p.Gly21Ser missense ANKRD39 1 77532 1.28979E-5 38766 0 NA
2-97523670-C-T p.Val19Met missense ANKRD39 1 77424 1.29159E-5 38712 0 NA
2-97523685-A-G p.Ser14Pro missense ANKRD39 2 76994 2.59761E-5 38497 1 NA
2-97523692-G-C p.Pro11Pro synonymous ANKRD39 2 76704 2.60743E-5 38352 0 3.32403E-5
2-97523694-G-T p.Pro11Thr missense ANKRD39 1 76486 1.30743E-5 38243 0 NA
2-97523695-C-T p.Gly10Gly synonymous ANKRD39 8 76420 1.04685E-4 38210 0 0.00203874
2-97523697-C-G p.Gly10Arg missense ANKRD39 3 76310 3.93133E-5 38155 0 1.27673E-4
2-97523697-C-CGTCCGCGCAGGGCCG p.Asp9_Gly10insArgProCysAlaAsp conservative_inframe_insertion ANKRD39 4 76310 5.24178E-5 38155 0 2.10275E-4
2-97523697-C-A p.Gly10Trp missense ANKRD39 1 76310 1.31044E-5 38155 0 3.50459E-5
2-97523705-C-A p.Cys7Phe missense ANKRD39 1 75862 1.31818E-5 37931 0 8.12546E-5
2-97523710-C-A p.Arg5Arg synonymous ANKRD39 9 75556 1.19117E-4 37778 0 2.2719E-4
2-97523719-C-T p.Ala2Ala synonymous ANKRD39 1 74730 1.33815E-5 37365 0 NA
2-97523720-G-A p.Ala2Val missense ANKRD39 203 74594 0.0027214 37297 0 0.00463918
2-97523741-G-A c.-17C>T 5_prime_UTR_premature_start_codon_gain ANKRD39 2 72790 2.74763E-5 36395 0 NA