Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
10-37414807-C-G c.-77C>G 5_prime_UTR_premature_start_codon_gain ANKRD30A 1 79718 1.25442E-5 39859 0 NA
10-37414814-C-G c.-70C>G 5_prime_UTR_premature_start_codon_gain ANKRD30A 1 80254 1.24604E-5 40127 0 NA
10-37414841-C-G c.-43C>G 5_prime_UTR_premature_start_codon_gain ANKRD30A 1 81550 1.22624E-5 40775 0 NA
10-37414887-A-G p.Thr2Ala missense ANKRD30A 1 82184 1.21678E-5 41092 0 3.18715E-5
10-37414905-A-C p.Ile8Leu missense ANKRD30A 2 82194 2.43327E-5 41097 0 2.00669E-5
10-37414913-T-C p.Leu10Leu synonymous ANKRD30A 1 82152 1.21726E-5 41076 0 4.01452E-6
10-37414917-AT-A p.Ile12fs frameshift ANKRD30A 2 82154 2.43445E-5 41077 0 2.40883E-5
10-37414920-C-A p.Gln13Lys missense ANKRD30A 2 82166 2.4341E-5 41083 0 2.40962E-5
10-37414925-C-T p.Asp14Asp synonymous ANKRD30A 26 82102 3.16679E-4 41051 0 4.46999E-4
10-37414926-G-T p.Ala15Ser missense ANKRD30A 1 82090 1.21818E-5 41045 0 NA
10-37414929-C-T p.Gln16* stop_gained ANKRD30A 67 82094 8.16138E-4 41047 0 0.00193798
10-37414932-A-G p.Lys17Glu missense ANKRD30A 5 82084 6.09132E-5 41042 0 2.00932E-5
10-37418816-C-T c.54-5C>T splice_region ANKRD30A 5 77782 6.42822E-5 38891 0 3.13627E-5
10-37418817-G-A c.54-4G>A splice_region ANKRD30A 4 77866 5.13703E-5 38933 0 1.21773E-4
10-37418822-A-G p.Thr19Ala missense+splice_region ANKRD30A 1 78134 1.27985E-5 39067 0 9.86388E-6
10-37418831-C-A p.His22Asn missense ANKRD30A 3 79754 3.76157E-5 39877 0 6.36983E-5
10-37418836-G-T p.Trp23Cys missense ANKRD30A 1 80186 1.2471E-5 40093 0 NA
10-37418846-A-G p.Asn27Asp missense ANKRD30A 5 80470 6.2135E-5 40235 0 6.36943E-5
10-37418853-A-G p.His29Arg missense ANKRD30A 1 80612 1.24051E-5 40306 0 NA
10-37418876-G-A p.Val37Ile missense ANKRD30A 2 80762 2.47641E-5 40381 0 9.20217E-6
10-37418880-A-G p.Asp38Gly missense ANKRD30A 6 80744 7.43089E-5 40372 0 7.41098E-5
10-37418899-C-T p.Asp44Asp synonymous ANKRD30A 2 80658 2.47961E-5 40329 0 7.73605E-5
10-37418900-G-A p.Val45Ile missense ANKRD30A 2 80662 2.47948E-5 40331 0 3.18654E-5
10-37418902-C-T p.Val45Val synonymous ANKRD30A 1 80600 1.24069E-5 40300 0 NA
10-37418911-C-T p.Gly48Gly synonymous ANKRD30A 5 80356 6.22231E-5 40178 0 1.82478E-4
10-37418912-G-A p.Glu49Lys missense ANKRD30A 2 80408 2.48731E-5 40204 0 1.01937E-4
10-37418924-C-T p.Pro53Ser missense ANKRD30A 1 79920 1.25125E-5 39960 0 NA
10-37418929-G-C p.Leu54Leu synonymous ANKRD30A 33 79588 4.14635E-4 39794 0 0.00108932
10-37419125-A-G c.169-8A>G splice_region ANKRD30A 2 82238 2.43197E-5 41119 0 NA
10-37419126-C-A c.169-7C>A splice_region ANKRD30A 10 82362 1.21415E-4 41181 0 7.09622E-5
10-37419128-G-A c.169-5G>A splice_region ANKRD30A 1 82442 1.21297E-5 41221 0 6.25E-4
10-37419129-A-G c.169-4A>G splice_region ANKRD30A 3 82448 3.63866E-5 41224 0 NA
10-37419141-A-G p.Gln59Gln synonymous ANKRD30A 2 82876 2.41324E-5 41438 0 4.40118E-6
10-37419155-C-T p.Ala64Val missense ANKRD30A 7 83012 8.43252E-5 41506 0 2.23714E-4
10-37419160-G-T p.Ala66Ser missense ANKRD30A 1 83050 1.20409E-5 41525 0 8.29339E-6
10-37419161-C-T p.Ala66Val missense ANKRD30A 2 83050 2.40819E-5 41525 0 1.65851E-5
10-37419170-T-C p.Leu69Pro missense ANKRD30A 10 83122 1.20305E-4 41561 0 1.05373E-4
10-37419172-A-G p.Ile70Val missense ANKRD30A 1 83124 1.20302E-5 41562 0 NA
10-37419177-T-G p.Asp71Glu missense ANKRD30A 1 83134 1.20288E-5 41567 0 NA
10-37419186-C-T p.Ala74Ala synonymous ANKRD30A 9 83140 1.08251E-4 41570 0 5.86968E-5
10-37419187-G-A p.Asp75Asn missense ANKRD30A 1 83156 1.20256E-5 41578 0 1.67521E-5
10-37419194-A-T p.Asn77Ile missense ANKRD30A 1 83170 1.20236E-5 41585 0 NA
10-37419198-C-T p.Leu78Leu synonymous ANKRD30A 1 83192 1.20204E-5 41596 0 3.19061E-5
10-37419199-G-A p.Val79Ile missense ANKRD30A 4 83172 4.80931E-5 41586 0 1.24306E-4
10-37419213-C-A p.Gly83Gly synonymous ANKRD30A 4 83198 4.80781E-5 41599 0 3.19122E-5
10-37419214-A-C p.Asn84His missense ANKRD30A 1 83194 1.20201E-5 41597 0 8.30337E-6
10-37419218-C-T p.Thr85Met missense ANKRD30A 5907 83006 0.0711635 41503 243 0.116875
10-37419219-G-A p.Thr85Thr synonymous ANKRD30A 1 83198 1.20195E-5 41599 0 2.48608E-5
10-37419234-T-C p.Ala90Ala synonymous ANKRD30A 2 83194 2.40402E-5 41597 0 8.2861E-6
10-37419238-T-C p.Tyr92His missense ANKRD30A 3 83156 3.60768E-5 41578 0 4.22201E-6
10-37419253-T-C p.Ser97Pro missense ANKRD30A 1 82908 1.20616E-5 41454 0 3.19203E-5
10-37419259-G-A p.Val99Met missense ANKRD30A 5 82828 6.03661E-5 41414 0 9.02405E-6
10-37419266-A-T p.Lys101Ile missense ANKRD30A 1 82770 1.20817E-5 41385 0 4.55137E-6
10-37419273-G-T p.Leu103Leu synonymous ANKRD30A 1 82492 1.21224E-5 41246 0 NA
10-37419274-T-C p.Ser104Pro missense ANKRD30A 1 82446 1.21292E-5 41223 0 NA
10-37419275-C-G p.Ser104Cys missense ANKRD30A 1 82398 1.21362E-5 41199 0 NA
10-37419275-C-A p.Ser104Tyr missense ANKRD30A 1 82398 1.21362E-5 41199 0 6.38978E-5
10-37419280-G-A p.Gly106Ser missense ANKRD30A 1 82174 1.21693E-5 41087 0 9.72734E-6
10-37419291-C-G p.Ile109Met missense ANKRD30A 2 80682 2.47887E-5 40341 0 NA
10-37419292-G-T p.Glu110* stop_gained ANKRD30A 1162 80596 0.0144176 40298 6 0.0121719
10-37419292-G-A p.Glu110Lys missense ANKRD30A 2 80640 2.48016E-5 40320 0 2.0457E-5
10-37419295-G-A p.Val111Met missense ANKRD30A 1 80740 1.23854E-5 40370 0 8.30689E-6
10-37419298-CACA-C p.Asn113del disruptive_inframe_deletion ANKRD30A 1 80034 1.24947E-5 40017 0 NA
10-37421174-C-T p.Leu117Phe missense ANKRD30A 3 82116 3.65337E-5 41058 0 3.18451E-5
10-37421175-T-C p.Leu117Pro missense ANKRD30A 7 82132 8.52287E-5 41066 0 1.29516E-5
10-37421179-A-G p.Thr118Thr synonymous ANKRD30A 1 82180 1.21684E-5 41090 0 8.64506E-6
10-37421180-C-T p.Pro119Ser missense ANKRD30A 1 82190 1.21669E-5 41095 0 NA
10-37421181-CA-C p.Leu120fs frameshift ANKRD30A 3 82204 3.64946E-5 41102 0 5.83976E-5
10-37421183-C-G p.Leu120Val missense ANKRD30A 6 82274 7.2927E-5 41137 0 2.12844E-5
10-37421189-C-G p.Leu122Val missense ANKRD30A 1 82352 1.2143E-5 41176 0 4.21891E-6
10-37421195-A-G p.Ile124Val missense ANKRD30A 3 82476 3.63742E-5 41238 0 6.3674E-5
10-37421199-C-T p.Thr125Met missense ANKRD30A 3692 82268 0.0448777 41134 112 0.0512829
10-37421200-G-A p.Thr125Thr synonymous ANKRD30A 1 82476 1.21247E-5 41238 0 1.66165E-5
10-37421202-A-T p.Lys126Ile missense ANKRD30A 1 82516 1.21189E-5 41258 0 4.07067E-6
10-37421213-C-A p.Gln130Lys missense ANKRD30A 1 82482 1.21239E-5 41241 0 NA
10-37421218-T-A p.Ile131Ile synonymous ANKRD30A 1 82484 1.21236E-5 41242 0 NA
10-37421224-A-T p.Glu133Asp missense ANKRD30A 5 82460 6.06355E-5 41230 0 5.04541E-4
10-37421250-C-T p.Ala142Val missense ANKRD30A 66 82056 8.04329E-4 41028 0 0.0025
10-37421251-G-A p.Ala142Ala synonymous ANKRD30A 10 82092 1.21815E-4 41046 0 2.54923E-4
10-37421255-G-A p.Ala144Thr missense ANKRD30A 1 82034 1.21901E-5 41017 0 1.00435E-4
10-37421262-A-G p.Asn146Ser missense ANKRD30A 2 81846 2.44361E-5 40923 0 3.37098E-5
10-37421281-T-C c.449+7T>C splice_region ANKRD30A 1 80556 1.24137E-5 40278 0 9.66538E-6
10-37422845-A-G p.Thr151Ala missense+splice_region ANKRD30A 1 83198 1.20195E-5 41599 0 6.3674E-5
10-37422846-CA-C p.Ala152fs frameshift ANKRD30A 1 83200 1.20192E-5 41600 0 8.29738E-6
10-37422855-T-C p.Met154Thr missense ANKRD30A 2 83232 2.40292E-5 41616 0 NA
10-37422856-G-A p.Met154Ile missense ANKRD30A 2 83240 2.40269E-5 41620 0 8.28775E-6
10-37422860-G-T p.Ala156Ser missense ANKRD30A 2 83260 2.40211E-5 41630 0 3.18431E-5
10-37422870-A-G p.His159Arg missense ANKRD30A 1 83278 1.2008E-5 41639 0 NA
10-37422877-A-T p.Ser161Ser synonymous ANKRD30A 1 83296 1.20054E-5 41648 0 NA
10-37422895-G-C p.Met167Ile missense ANKRD30A 1 83302 1.20045E-5 41651 0 NA
10-37422897-T-A p.Leu168His missense ANKRD30A 1 83306 1.20039E-5 41653 0 NA
10-37422915-A-G p.Asp174Gly missense ANKRD30A 4 83308 4.80146E-5 41654 0 3.18512E-5
10-37422916-C-T p.Asp174Asp synonymous ANKRD30A 34 83310 4.08114E-4 41655 0 2.15342E-4
10-37422918-T-A p.Val175Asp missense ANKRD30A 2 83318 2.40044E-5 41659 0 NA
10-37422920-T-C p.Phe176Leu missense ANKRD30A 1 83320 1.20019E-5 41660 0 NA
10-37422928-A-G p.Ala178Ala synonymous ANKRD30A 1 83328 1.20008E-5 41664 0 4.00753E-6
10-37422932-A-G p.Ile180Val missense ANKRD30A 3 83316 3.60075E-5 41658 0 3.1841E-5
10-37422934-A-G p.Ile180Met missense ANKRD30A 93 83320 0.00111618 41660 0 0.00280166
10-37422945-C-G p.Thr184Ser missense ANKRD30A 5 83318 6.0011E-5 41659 0 5.03525E-4
10-37422957-A-G p.Tyr188Cys missense ANKRD30A 1 83326 1.20011E-5 41663 0 4.00991E-6
10-37422957-A-T p.Tyr188Phe missense ANKRD30A 1 83326 1.20011E-5 41663 0 NA
10-37422962-GTTAC-G p.Thr191fs frameshift ANKRD30A 14 83320 1.68027E-4 41660 0 4.41413E-5
10-37422966-C-T p.Thr191Ile missense ANKRD30A 1 83312 1.20031E-5 41656 0 NA
10-37422972-G-T p.Gly193Val missense ANKRD30A 2 83300 2.40096E-5 41650 0 6.25E-4
10-37425527-A-G c.588-8A>G splice_region ANKRD30A 3 77106 3.89075E-5 38553 0 2.38402E-5
10-37425546-A-G p.Gln200Arg missense ANKRD30A 1 77962 1.28268E-5 38981 0 NA
10-37425550-T-C p.Ile201Ile synonymous ANKRD30A 2 78004 2.56397E-5 39002 0 1.86338E-5
10-37425551-A-G p.Met202Val missense ANKRD30A 4 78018 5.12702E-5 39009 0 9.56389E-5
10-37425562-A-G p.Ile205Met missense ANKRD30A 1 78132 1.27989E-5 39066 0 5.1131E-6
10-37425563-C-T p.Arg206* stop_gained ANKRD30A 13 77926 1.66825E-4 38963 0 0.00102145
10-37425564-G-A p.Arg206Gln missense ANKRD30A 8 77902 1.02693E-4 38951 0 3.50409E-4
10-37425568-A-G p.Lys207Lys synonymous ANKRD30A 8 78220 1.02276E-4 39110 0 0.00204499
10-37425569-T-A p.Leu208Ile missense ANKRD30A 10 78186 1.279E-4 39093 0 0.00187735
10-37425569-T-G p.Leu208Val missense ANKRD30A 1 78188 1.27897E-5 39094 0 NA
10-37425596-C-T p.Pro217Ser missense ANKRD30A 1 77874 1.28413E-5 38937 0 NA
10-37425598-A-G p.Pro217Pro splice_region+synonymous ANKRD30A 1 77790 1.28551E-5 38895 0 3.12178E-5
10-37425599-GGTAAGACTTCTGATA-G c.652+1_652+15delGTAAGACTTCTGATA splice_donor ANKRD30A 1 77778 1.28571E-5 38889 0 NA
10-37425604-G-C c.652+5G>C splice_region ANKRD30A 1 77752 1.28614E-5 38876 0 NA
10-37430642-G-A c.653-4G>A splice_region ANKRD30A 1 81624 1.22513E-5 40812 0 NA
10-37430648-G-A p.Gly219Arg missense+splice_region ANKRD30A 1 81868 1.22148E-5 40934 0 NA
10-37430649-G-A p.Gly219Glu missense ANKRD30A 1 81848 1.22178E-5 40924 0 4.04799E-6
10-37430654-T-G p.Ser221Ala missense ANKRD30A 1 81976 1.21987E-5 40988 0 3.4842E-5
10-37430654-T-C p.Ser221Pro missense ANKRD30A 2 81976 2.43974E-5 40988 0 6.46977E-5
10-37430659-AGGAACACCTGATGAGGCTGCACCCTTGGCGGAAAGAACACCTGACACAGCTGAAAGCTTGGT-A p.Thr224fs frameshift ANKRD30A 1 82080 1.21832E-5 41040 0 NA
10-37430661-GAACACCTGATGAGGCTGCACCCTTGGCGGAAAGAACACCTGACACAGCTGAAAGCTTGGTGGAAAA-G p.Ala232_Leu253del disruptive_inframe_deletion ANKRD30A 3 82090 3.65453E-5 41045 0 5.18018E-5
10-37430667-C-CT p.Asp226fs frameshift ANKRD30A 1 82206 1.21646E-5 41103 0 NA
10-37430676-C-T p.Ala228Val missense ANKRD30A 1 82292 1.21518E-5 41146 0 4.27131E-5
10-37430688-CGGAAAGAACACCTGACACAGCTGAAAGCTTGGTGGAAAAAACACCTGATGAGGCTGCACCCTTGGT-C p.Ala239_Thr260del disruptive_inframe_deletion ANKRD30A 2 82404 2.42707E-5 41202 0 3.2002E-5
10-37430688-C-T p.Ala232Val missense ANKRD30A 1 82404 1.21353E-5 41202 0 0.00163043
10-37430689-G-A p.Ala232Ala synonymous ANKRD30A 3 82420 3.63989E-5 41210 0 9.57488E-5
10-37430696-A-T p.Thr235Ser missense ANKRD30A 2 82494 2.42442E-5 41247 0 4.01868E-6
10-37430699-C-A p.Pro236Thr missense ANKRD30A 1 82520 1.21183E-5 41260 0 8.43982E-6
10-37430707-A-G p.Thr238Thr synonymous ANKRD30A 6 82572 7.26639E-5 41286 0 5.20833E-4
10-37430720-G-A p.Val243Met missense ANKRD30A 23 82692 2.78141E-4 41346 0 0.00103306
10-37430724-A-G p.Glu244Gly missense ANKRD30A 2 82710 2.41809E-5 41355 0 NA
10-37430727-A-G p.Lys245Arg missense ANKRD30A 2 82716 2.41791E-5 41358 0 4.01313E-6
10-37430730-C-T p.Thr246Ile missense ANKRD30A 1 82764 1.20825E-5 41382 0 NA
10-37430732-C-T p.Pro247Ser missense ANKRD30A 1 82802 1.2077E-5 41401 0 3.18674E-5
10-37430740-G-A p.Glu249Glu synonymous ANKRD30A 1 82916 1.20604E-5 41458 0 NA
10-37430743-T-C p.Ala250Ala synonymous ANKRD30A 2 82958 2.41086E-5 41479 0 6.37308E-5
10-37430745-C-A p.Ala251Glu missense ANKRD30A 16 82974 1.92831E-4 41487 0 0.00152439
10-37430748-C-T p.Pro252Leu missense ANKRD30A 4 83036 4.81719E-5 41518 0 3.24931E-4
10-37430750-T-C p.Leu253Leu synonymous ANKRD30A 1 83054 1.20404E-5 41527 0 3.18593E-5
10-37430759-A-G p.Arg256Gly missense ANKRD30A 3 83144 3.6082E-5 41572 0 8.02092E-6
10-37430772-C-T p.Thr260Met missense ANKRD30A 4 83244 4.80515E-5 41622 0 1.59959E-4
10-37430773-G-A p.Thr260Thr synonymous ANKRD30A 1 83254 1.20114E-5 41627 0 1.64387E-4
10-37430800-T-C p.Pro269Pro synonymous ANKRD30A 1 83394 1.19913E-5 41697 0 8.28555E-6
10-37430815-C-T p.Ser274Ser synonymous ANKRD30A 6 83406 7.19373E-5 41703 0 1.60299E-5
10-37430822-G-C p.Glu277Gln missense ANKRD30A 2 83412 2.39774E-5 41706 0 NA
10-37430826-G-C p.Gly278Ala missense ANKRD30A 1 83410 1.1989E-5 41705 0 NA
10-37430828-A-G p.Thr279Ala missense ANKRD30A 1 83412 1.19887E-5 41706 0 NA
10-37430829-C-T p.Thr279Ile missense ANKRD30A 1 83414 1.19884E-5 41707 0 8.28487E-6
10-37430845-A-G p.Gln284Gln synonymous ANKRD30A 1 83418 1.19878E-5 41709 0 1.60345E-5
10-37430859-C-T p.Ala289Val missense ANKRD30A 2 83412 2.39774E-5 41706 0 9.55414E-5
10-37430875-C-G p.Phe294Leu missense ANKRD30A 17 83396 2.03847E-4 41698 0 5.63936E-4
10-37430875-C-A p.Phe294Leu missense ANKRD30A 2 83396 2.3982E-5 41698 0 8.28583E-6
10-37430875-C-T p.Phe294Phe synonymous ANKRD30A 2 83396 2.3982E-5 41698 0 1.65717E-5
10-37430876-G-A p.Glu295Lys missense ANKRD30A 1 83394 1.19913E-5 41697 0 4.41228E-5
10-37430891-GAA-G p.Glu300fs frameshift ANKRD30A 1 83360 1.19962E-5 41680 0 NA
10-37430896-AC-A p.Pro302fs frameshift ANKRD30A 4 83352 4.79893E-5 41676 0 2.07084E-4
10-37430907-T-C p.Ile305Thr missense ANKRD30A 1 83334 1.19999E-5 41667 0 8.28432E-6
10-37430910-CGAGTCCTGCAAAAGAAACATCTGAGAAATTTACGTGGCCAGCAAAAGGAAGACCTAGGAAGATCGCATGGGAGAAAAAAGAAGACACACCTAGGGAAATTAT-C p.Ala309_Pro342del disruptive_inframe_deletion ANKRD30A 1 83314 1.20028E-5 41657 0 3.18674E-5
10-37430910-C-T p.Thr306Met missense ANKRD30A 10 83314 1.20028E-4 41657 0 2.86807E-4
10-37430911-G-C p.Thr306Thr synonymous ANKRD30A 2 83306 2.40079E-5 41653 0 NA
10-37430912-A-G p.Ser307Gly missense ANKRD30A 1 83308 1.20036E-5 41654 0 NA
10-37430926-A-G p.Glu311Glu synonymous ANKRD30A 1 83298 1.20051E-5 41649 0 NA
10-37430943-C-T p.Thr317Met missense ANKRD30A 11 83292 1.32065E-4 41646 0 5.04032E-4
10-37430944-G-A p.Thr317Thr synonymous ANKRD30A 1 83290 1.20062E-5 41645 0 6.76727E-5
10-37430946-G-C p.Trp318Ser missense ANKRD30A 2 83294 2.40113E-5 41647 0 NA
10-37430957-G-C p.Gly322Arg missense ANKRD30A 1 83298 1.20051E-5 41649 0 1.27551E-4
10-37430974-C-T p.Ile327Ile synonymous ANKRD30A 3 83272 3.60265E-5 41636 0 1.60429E-5
10-37430975-G-C p.Ala328Pro missense ANKRD30A 1 83260 1.20106E-5 41630 0 3.29554E-5
10-37430975-G-A p.Ala328Thr missense ANKRD30A 9 83260 1.08095E-4 41630 0 1.31822E-4
10-37430978-T-C p.Trp329Arg missense ANKRD30A 9 83278 1.08072E-4 41639 0 2.63644E-4
10-37430984-A-T p.Lys331* stop_gained ANKRD30A 4 83280 4.80307E-5 41640 0 8.2971E-6
10-37430990-G-C p.Glu333Gln missense ANKRD30A 10 83290 1.20062E-4 41645 0 6.35324E-4
10-37430993-G-GAC p.Pro336fs frameshift ANKRD30A 1 83280 1.20077E-5 41640 0 NA
10-37431010-T-G p.Ile339Met missense ANKRD30A 1 83266 1.20097E-5 41633 0 6.40123E-5
10-37431019-C-T p.Pro342Pro synonymous ANKRD30A 2 83262 2.40206E-5 41631 0 4.01558E-5
10-37431031-A-G p.Thr346Thr synonymous ANKRD30A 1 83254 1.20114E-5 41627 0 8.30468E-6
10-37431044-A-T p.Thr351Ser missense ANKRD30A 1 83250 1.2012E-5 41625 0 3.32242E-5
10-37431045-C-T p.Thr351Met missense ANKRD30A 6 83240 7.20807E-5 41620 0 6.82331E-5
10-37431046-G-A p.Thr351Thr synonymous ANKRD30A 5 83246 6.00629E-5 41623 0 6.34921E-4
10-37431049-G-A p.Trp352* stop_gained ANKRD30A 2 83238 2.40275E-5 41619 0 NA
10-37431055-A-C p.Ala354Ala synonymous ANKRD30A 1 83238 1.20137E-5 41619 0 6.36983E-5
10-37431058-A-C p.Lys355Asn missense ANKRD30A 1 83248 1.20123E-5 41624 0 NA
10-37431072-A-G p.Lys360Arg missense ANKRD30A 2 83240 2.40269E-5 41620 0 1.60492E-5
10-37431073-G-C p.Lys360Asn missense ANKRD30A 1 83236 1.2014E-5 41618 0 NA
10-37431075-T-C p.Ile361Thr missense ANKRD30A 1 83214 1.20172E-5 41607 0 NA
10-37431076-C-T p.Ile361Ile synonymous ANKRD30A 1 83218 1.20166E-5 41609 0 8.02781E-6
10-37431077-G-A p.Ala362Thr missense ANKRD30A 5 83204 6.00933E-5 41602 0 1.27421E-4
10-37431079-A-G p.Ala362Ala synonymous ANKRD30A 3 83212 3.60525E-5 41606 0 4.01284E-6
10-37431083-G-A p.Glu364Lys missense ANKRD30A 1 83212 1.20175E-5 41606 0 4.0139E-6
10-37431083-G-T p.Glu364* stop_gained ANKRD30A 1 83212 1.20175E-5 41606 0 1.66221E-5
10-37431101-G-T p.Val370Leu missense ANKRD30A 1 83194 1.20201E-5 41597 0 8.31546E-6
10-37431105-A-G p.Lys371Arg missense ANKRD30A 1 83190 1.20207E-5 41595 0 4.01439E-6
10-37431111-G-A p.Gly373Glu missense ANKRD30A 1 83190 1.20207E-5 41595 0 NA
10-37431116-G-A p.Val375Met missense ANKRD30A 8 83184 9.61723E-5 41592 0 4.15946E-5
10-37431125-G-A p.Val378Ile missense ANKRD30A 1 83186 1.20213E-5 41593 0 NA
10-37431126-T-G p.Val378Gly missense ANKRD30A 1 83188 1.2021E-5 41594 0 NA
10-37431129-C-T p.Thr379Ile missense ANKRD30A 1 83192 1.20204E-5 41596 0 2.01764E-5
10-37431131-T-A p.Ser380Thr missense ANKRD30A 2 83198 2.4039E-5 41599 0 NA
10-37431143-A-C p.Lys384Gln missense ANKRD30A 2 83198 2.4039E-5 41599 0 1.2352E-5
10-37431157-A-G p.Lys388Lys synonymous ANKRD30A 1 83202 1.20189E-5 41601 0 NA
10-37431164-T-C p.Ser391Pro missense ANKRD30A 17 83200 2.04327E-4 41600 0 1.201E-4
10-37431173-A-T p.Ile394Phe missense ANKRD30A 1 83182 1.20218E-5 41591 0 NA
10-37431174-T-C p.Ile394Thr missense ANKRD30A 3 83184 3.60646E-5 41592 0 1.26465E-5
10-37431175-T-G p.Ile394Met missense ANKRD30A 1 83182 1.20218E-5 41591 0 1.68769E-5
10-37431185-A-G p.Thr398Ala missense ANKRD30A 5 83152 6.01308E-5 41576 0 1.70987E-5
10-37431188-A-G p.Lys399Glu missense ANKRD30A 1 83146 1.2027E-5 41573 0 NA
10-37431191-G-T p.Glu400* stop_gained ANKRD30A 2 83140 2.40558E-5 41570 0 NA
10-37431209-A-G p.Ser406Gly missense ANKRD30A 1 83016 1.20459E-5 41508 0 NA
10-37431220-T-G c.1225+2T>G splice_donor ANKRD30A 1 82872 1.20668E-5 41436 0 NA
10-37431226-G-A c.1225+8G>A splice_region ANKRD30A 19 82784 2.29513E-4 41392 0 2.31671E-4
10-37433923-A-G p.Asp409Gly missense+splice_region ANKRD30A 1 81418 1.22823E-5 40709 0 NA
10-37433923-A-T p.Asp409Val missense+splice_region ANKRD30A 1 81418 1.22823E-5 40709 0 4.18064E-6
10-37433925-C-T p.Gln410* stop_gained ANKRD30A 1 81486 1.2272E-5 40743 0 NA
10-37433958-G-A p.Asp421Asn missense ANKRD30A 1 81726 1.2236E-5 40863 0 4.17795E-6
10-37433960-T-C p.Asp421Asp synonymous ANKRD30A 4 81720 4.89476E-5 40860 0 1.59256E-4
10-37433976-G-A p.Asp427Asn missense ANKRD30A 1 81432 1.22802E-5 40716 0 NA
10-37433982-C-T p.Arg429Trp missense+splice_region ANKRD30A 4 81128 4.93048E-5 40564 0 7.47272E-5
10-37433983-G-T p.Arg429Leu missense+splice_region ANKRD30A 18 81106 2.21932E-4 40553 0 0.00315773
10-37433983-G-A p.Arg429Gln missense+splice_region ANKRD30A 3 81108 3.69877E-5 40554 0 NA
10-37433985-G-A c.1287+1G>A splice_donor ANKRD30A 2 81164 2.46415E-5 40582 0 1.57778E-4
10-37436298-A-G p.Ser430Gly missense+splice_region ANKRD30A 1 81168 1.23201E-5 40584 0 3.39928E-5
10-37436299-G-T p.Ser430Ile missense+splice_region ANKRD30A 1 81122 1.23271E-5 40561 0 NA
10-37436303-C-G p.Leu431Leu synonymous ANKRD30A 1 81326 1.22962E-5 40663 0 8.66086E-6
10-37436317-C-T p.Ala436Val missense ANKRD30A 2 81662 2.44912E-5 40831 0 8.53781E-6
10-37436326-A-G p.Gln439Arg missense ANKRD30A 2 81670 2.44888E-5 40835 0 8.48796E-6
10-37436334-A-G p.Ile442Val missense ANKRD30A 1 81688 1.22417E-5 40844 0 NA
10-37436340-G-T p.Glu444* stop_gained ANKRD30A 1 81634 1.22498E-5 40817 0 NA
10-37436346-A-G p.Ile446Val missense ANKRD30A 1 81610 1.22534E-5 40805 0 NA
10-37436347-T-C p.Ile446Thr missense ANKRD30A 1 81604 1.22543E-5 40802 0 0.00141072
10-37436366-GATAA-G p.Asn454fs frameshift ANKRD30A 2 81536 2.4529E-5 40768 0 1.71136E-5
10-37436367-A-G p.Ile453Val missense ANKRD30A 32 81480 3.92734E-4 40740 2 5.73504E-4
10-37436371-A-G p.Asn454Ser missense ANKRD30A 5 81460 6.13798E-5 40730 0 6.01333E-5
10-37436386-G-A c.1375+1G>A splice_donor ANKRD30A 1 81078 1.23338E-5 40539 0 NA
10-37436393-C-T c.1375+8C>T splice_region ANKRD30A 1 80734 1.23864E-5 40367 0 5.36884E-5
10-37438580-G-A p.Glu459Glu splice_region+synonymous ANKRD30A 4 81996 4.87829E-5 40998 0 3.18837E-5
10-37438586-T-C p.Pro461Pro synonymous ANKRD30A 23 81998 2.80495E-4 40999 0 0.00125
10-37438586-TA-CG p.ProLys461ProGlu missense ANKRD30A 2 82010 2.43873E-5 41005 0 NA
10-37438587-A-G p.Lys462Glu missense ANKRD30A 24 82000 2.92683E-4 41000 0 0.00125
10-37438588-A-G p.Lys462Arg missense ANKRD30A 1 82002 1.21948E-5 41001 0 3.18613E-5
10-37438591-A-T p.Lys463Met missense ANKRD30A 38 82006 4.63381E-4 41003 0 3.05089E-4
10-37438605-A-G p.Lys468Glu missense+splice_region ANKRD30A 17 81938 2.07474E-4 40969 0 0.00424628
10-37438712-T-C p.Ile471Thr missense ANKRD30A 133 81708 0.00162775 40854 0 0.00503505
10-37438714-G-A p.Glu472Lys missense ANKRD30A 1 81708 1.22387E-5 40854 0 NA
10-37438725-C-G p.Asn475Lys missense ANKRD30A 380 81638 0.0046547 40819 4 0.0201794
10-37438725-C-T p.Asn475Asn synonymous ANKRD30A 1 81704 1.22393E-5 40852 0 3.20041E-5
10-37438738-A-C p.Lys480Gln missense ANKRD30A 1 81700 1.22399E-5 40850 0 2.00848E-5
10-37438741-G-A p.Ala481Thr missense ANKRD30A 2 81694 2.44816E-5 40847 0 8.29862E-6
10-37438743-C-T p.Ala481Ala synonymous ANKRD30A 5 81692 6.12055E-5 40846 0 1.65975E-5
10-37438746-T-G p.Phe482Leu missense ANKRD30A 64 81654 7.83795E-4 40827 0 0.00610527
10-37438758-T-C p.Asn486Asn synonymous ANKRD30A 3 81672 3.67323E-5 40836 0 8.30496E-6
10-37438772-G-A p.Arg491Lys missense ANKRD30A 5 81622 6.1258E-5 40811 0 9.55962E-5
10-37438777-G-A p.Asp493Asn missense+splice_region ANKRD30A 2 81594 2.45116E-5 40797 0 8.31559E-6
10-37438779-T-C c.1477+2T>C splice_donor ANKRD30A 1 81586 1.2257E-5 40793 0 NA
10-37438781-A-C c.1477+4A>C splice_region ANKRD30A 3 81588 3.67701E-5 40794 0 3.18695E-5
10-37440988-A-G p.Asp493Gly missense+splice_region ANKRD30A 1 81762 1.22306E-5 40881 0 NA
10-37440991-C-T p.Pro494Leu missense ANKRD30A 13 81796 1.58932E-4 40898 0 6.25782E-4
10-37440992-G-A p.Pro494Pro synonymous ANKRD30A 1 81842 1.22187E-5 40921 0 7.48055E-5
10-37440998-C-G p.Phe496Leu missense ANKRD30A 1 81998 1.21954E-5 40999 0 NA
10-37441002-C-T p.Pro498Ser missense ANKRD30A 4 82034 4.87603E-5 41017 0 4.83037E-5
10-37441002-C-G p.Pro498Ala missense ANKRD30A 1 82034 1.21901E-5 41017 0 NA
10-37441004-A-G p.Pro498Pro synonymous ANKRD30A 2 82082 2.43659E-5 41041 0 2.01167E-5
10-37441014-C-G p.Gln502Glu missense ANKRD30A 1 82170 1.21699E-5 41085 0 3.1904E-5
10-37441024-A-G p.Tyr505Cys missense ANKRD30A 3 82326 3.64405E-5 41163 0 4.02842E-6
10-37441025-T-A p.Tyr505* stop_gained ANKRD30A 1 82318 1.2148E-5 41159 0 NA
10-37441029-G-T p.Glu507* stop_gained ANKRD30A 3 82358 3.64263E-5 41179 0 NA
10-37441033-A-G p.Asn508Ser missense ANKRD30A 2 82378 2.42783E-5 41189 0 1.66174E-5
10-37441038-T-G p.Trp510Gly missense ANKRD30A 1 82376 1.21395E-5 41188 0 NA
10-37441039-G-A p.Trp510* stop_gained ANKRD30A 1 82366 1.21409E-5 41183 0 NA
10-37441044-T-A p.Ser512Thr missense ANKRD30A 1 82372 1.214E-5 41186 0 3.18715E-5
10-37441053-C-T c.1539+4C>T splice_region ANKRD30A 6 82366 7.28456E-5 41183 0 1.9131E-4
10-37441055-A-G c.1539+6A>G splice_region ANKRD30A 4 82360 4.85673E-5 41180 0 4.15946E-5
10-37441057-G-A c.1539+8G>A splice_region ANKRD30A 1 82338 1.21451E-5 41169 0 NA
10-37442497-CAG-C c.1540-2_1540-1delAG splice_acceptor ANKRD30A 1 80802 1.23759E-5 40401 0 NA
10-37442532-G-A p.Val524Val synonymous ANKRD30A 1 80906 1.236E-5 40453 0 2.00724E-5
10-37442547-T-C p.Ala529Ala synonymous ANKRD30A 1 80946 1.23539E-5 40473 0 8.28926E-6
10-37442548-A-G p.Thr530Ala missense ANKRD30A 1 80944 1.23542E-5 40472 0 8.28967E-6
10-37442550-A-G p.Thr530Thr synonymous ANKRD30A 1 80952 1.2353E-5 40476 0 1.65791E-5
10-37442556-A-G p.Gln532Gln synonymous ANKRD30A 1 80984 1.23481E-5 40492 0 NA
10-37442564-T-C p.Ile535Thr missense ANKRD30A 10 81044 1.2339E-4 40522 0 0.00195822
10-37442577-T-C p.Asn539Asn synonymous ANKRD30A 2 81106 2.46591E-5 40553 0 5.37634E-4
10-37442579-G-C p.Gly540Ala missense ANKRD30A 1 81128 1.23262E-5 40564 0 NA
10-37442583-A-G p.Lys541Lys synonymous ANKRD30A 1 81136 1.2325E-5 40568 0 2.48959E-5
10-37442591-G-A c.1630+1G>A splice_donor ANKRD30A 4 81152 4.92902E-5 40576 0 6.37471E-5
10-37442593-A-C c.1630+3A>C splice_region ANKRD30A 1 81166 1.23204E-5 40583 0 NA
10-37447326-CT-C p.Asn547fs frameshift ANKRD30A 3 81604 3.67629E-5 40802 0 NA
10-37447328-A-G p.Asn547Asp missense ANKRD30A 3 81604 3.67629E-5 40802 0 9.55962E-5
10-37447328-AA-GT p.Asn547Val missense ANKRD30A 2 81606 2.4508E-5 40803 0 NA
10-37447329-A-T p.Asn547Ile missense ANKRD30A 2 81604 2.45086E-5 40802 0 6.37227E-5
10-37447345-G-A p.Leu552Leu synonymous ANKRD30A 1 81678 1.22432E-5 40839 0 NA
10-37447352-A-G c.1659+4A>G splice_region ANKRD30A 1 81694 1.22408E-5 40847 0 2.81364E-5
10-37447434-C-T c.1660-8C>T splice_region ANKRD30A 2 81802 2.44493E-5 40901 0 1.60654E-5
10-37447445-A-G p.Thr555Ala missense ANKRD30A 773 81798 0.00945011 40899 12 0.0160684
10-37447445-A-C p.Thr555Pro missense ANKRD30A 27 81806 3.30049E-4 40903 0 0.00189994
10-37447446-C-A p.Thr555Asn missense ANKRD30A 28 81776 3.42399E-4 40888 0 0.00184275
10-37447451-G-A p.Gly557Arg missense ANKRD30A 23 81768 2.81284E-4 40884 0 0.00307125
10-37447469-C-G p.Pro563Ala missense ANKRD30A 2 81798 2.44505E-5 40899 0 NA
10-37447473-C-A p.Thr564Asn missense ANKRD30A 1 81794 1.22258E-5 40897 0 NA
10-37447491-A-T p.Lys570Met missense ANKRD30A 18 81748 2.20189E-4 40874 0 2.33138E-4
10-37447496-A-C p.Met572Leu missense ANKRD30A 3 81764 3.6691E-5 40882 0 8.03884E-6
10-37447496-A-G p.Met572Val missense ANKRD30A 1 81764 1.22303E-5 40882 0 3.1841E-5
10-37447502-A-G p.Thr574Ala missense ANKRD30A 1 81764 1.22303E-5 40882 0 NA
10-37447503-C-T p.Thr574Ile missense ANKRD30A 1 81754 1.22318E-5 40877 0 4.02625E-6
10-37447514-G-A p.Glu578Lys missense+splice_region ANKRD30A 3 81714 3.67134E-5 40857 0 0.00204918
10-37447519-A-G c.1732+5A>G splice_region ANKRD30A 1 81682 1.22426E-5 40841 0 8.31988E-6
10-37451568-GC-G c.1733-8delC splice_region ANKRD30A 2 81070 2.467E-5 40535 0 8.28157E-6
10-37451569-C-G c.1733-8C>G splice_region ANKRD30A 1 81062 1.23362E-5 40531 0 NA
10-37451570-T-A c.1733-7T>A splice_region ANKRD30A 2 81068 2.46706E-5 40534 0 8.28157E-6
10-37451575-A-C c.1733-2A>C splice_acceptor ANKRD30A 2 81074 2.46688E-5 40537 0 0.00127877
10-37451578-G-T p.Glu578Asp missense+splice_region ANKRD30A 1 81076 1.23341E-5 40538 0 NA
10-37451581-T-C p.Pro579Pro synonymous ANKRD30A 1 81092 1.23317E-5 40546 0 NA
10-37451583-C-T p.Pro580Leu missense ANKRD30A 1 81092 1.23317E-5 40546 0 9.10973E-5
10-37451584-G-C p.Pro580Pro synonymous ANKRD30A 1663 76592 0.0217125 38296 100 0.0520695
10-37451584-GGG-CGA p.ProGly580ProGlu missense ANKRD30A 3 81090 3.69959E-5 40545 1 NA
10-37451584-G-A p.Pro580Pro synonymous ANKRD30A 3 81090 3.69959E-5 40545 0 6.61376E-4
10-37451585-G-T p.Gly581Trp missense ANKRD30A 1 81090 1.2332E-5 40545 0 NA
10-37451585-G-A p.Gly581Arg missense ANKRD30A 2 81092 2.46633E-5 40546 0 8.28116E-6
10-37451586-G-A p.Gly581Glu missense ANKRD30A 2554 78348 0.0325982 39174 110 0.0521236
10-37451593-A-G p.Pro583Pro synonymous ANKRD30A 1 81126 1.23265E-5 40563 0 NA
10-37451603-G-A p.Glu587Lys missense+splice_region ANKRD30A 4 81124 4.93072E-5 40562 0 1.56484E-4
10-37451605-G-A p.Glu587Glu splice_region+synonymous ANKRD30A 2 81146 2.46469E-5 40573 0 3.61115E-5
10-37451606-G-T c.1761+1G>T splice_donor ANKRD30A 1 81138 1.23247E-5 40569 0 NA
10-37451611-T-G c.1761+6T>G splice_region ANKRD30A 1 81174 1.23192E-5 40587 0 NA
10-37451698-A-G c.1762-6A>G splice_region ANKRD30A 1 81674 1.22438E-5 40837 0 4.01294E-6
10-37451700-T-C c.1762-4T>C splice_region ANKRD30A 5 81674 6.1219E-5 40837 0 4.0131E-6
10-37451705-C-A p.Pro588His missense+splice_region ANKRD30A 5 81686 6.121E-5 40843 0 6.37024E-5
10-37451711-C-T p.Thr590Ile missense ANKRD30A 19 81668 2.32649E-4 40834 0 0.00125313
10-37451724-G-C p.Lys594Asn missense ANKRD30A 2 81716 2.4475E-5 40858 0 1.65719E-5
10-37451730-C-T p.Val596Val synonymous ANKRD30A 236 81236 0.00290512 40618 4 0.0106007
10-37451741-C-A p.Ala600Asp missense ANKRD30A 1 81686 1.2242E-5 40843 0 NA
10-37451754-A-G p.Lys604Lys synonymous ANKRD30A 249 81212 0.00306605 40606 3 0.010083
10-37451756-A-C p.Asn605Thr missense ANKRD30A 1 81656 1.22465E-5 40828 0 5.80277E-5
10-37451765-C-T p.Thr608Ile missense ANKRD30A 1 81604 1.22543E-5 40802 0 8.29077E-6
10-37451767-T-C p.Leu609Leu synonymous ANKRD30A 1 81586 1.2257E-5 40793 0 8.29105E-6
10-37451768-T-G p.Leu609Trp missense ANKRD30A 5712 81196 0.0703483 40598 239 0.115288
10-37451769-G-T p.Leu609Phe missense ANKRD30A 2 81562 2.45212E-5 40781 0 3.31735E-5
10-37451769-G-A p.Leu609Leu synonymous ANKRD30A 1 81562 1.22606E-5 40781 0 3.18817E-5
10-37451780-A-C c.1834+4A>C splice_region ANKRD30A 2 81492 2.45423E-5 40746 0 4.148E-5
10-37454022-A-T p.Asp612Val missense+splice_region ANKRD30A 173 81218 0.00213007 40609 0 0.00216781
10-37454024-G-A p.Glu613Lys missense+splice_region ANKRD30A 1 81232 1.23104E-5 40616 0 NA
10-37454027-A-G p.Ile614Val missense ANKRD30A 11 81228 1.35421E-4 40614 0 5.81395E-4
10-37454028-T-C p.Ile614Thr missense ANKRD30A 2 80996 2.46926E-5 40498 0 7.47136E-5
10-37454030-C-A p.Leu615Ile missense ANKRD30A 1 81258 1.23065E-5 40629 0 NA
10-37454048-C-G p.Gln621Glu missense ANKRD30A 4714 80666 0.0584385 40333 182 0.0725
10-37454051-A-G p.Lys622Glu missense ANKRD30A 2 81306 2.45984E-5 40653 0 8.03155E-6
10-37454055-A-G p.Asp623Gly missense ANKRD30A 74 81328 9.09896E-4 40664 1 0.00174014
10-37454057-T-A p.Tyr624Asn missense ANKRD30A 2 81326 2.45924E-5 40663 0 NA
10-37454062-A-G p.Glu625Glu synonymous ANKRD30A 13 81328 1.59847E-4 40664 0 0.00125
10-37454063-G-C p.Glu626Gln missense ANKRD30A 10 81318 1.22974E-4 40659 0 1.41067E-4
10-37454067-A-G p.Asn627Ser missense ANKRD30A 4 81314 4.9192E-5 40657 0 2.8765E-4
10-37454067-A-C p.Asn627Thr missense ANKRD30A 2 81316 2.45954E-5 40658 0 2.00987E-5
10-37454068-T-C p.Asn627Asn synonymous ANKRD30A 1 81310 1.22986E-5 40655 0 5.80903E-5
10-37454069-TC-T p.Ser628fs frameshift ANKRD30A 1 81320 1.22971E-5 40660 0 NA
10-37454076-A-G p.Asp630Gly missense ANKRD30A 1 81280 1.23031E-5 40640 0 NA
10-37454078-A-T p.Thr631Ser missense ANKRD30A 4 81264 4.92223E-5 40632 0 2.23485E-4
10-37454079-C-A p.Thr631Asn missense ANKRD30A 2 81258 2.4613E-5 40629 0 8.30234E-5
10-37454089-G-A c.1896+6G>A splice_region ANKRD30A 11 81202 1.35465E-4 40601 0 3.18979E-5
10-37454089-G-T c.1896+6G>T splice_region ANKRD30A 1 81202 1.2315E-5 40601 0 8.31255E-6
10-37455536-C-G p.Leu634Val missense ANKRD30A 2 68216 2.93186E-5 34108 0 1.25802E-5
10-37455538-C-A p.Leu634Leu synonymous ANKRD30A 1 68590 1.45794E-5 34295 0 NA
10-37455540-G-T p.Cys635Phe missense ANKRD30A 3 68980 4.34909E-5 34490 0 9.59386E-5
10-37455551-T-C p.Ser639Pro missense ANKRD30A 1 70398 1.42049E-5 35199 0 NA
10-37455558-A-G p.Lys641Arg missense ANKRD30A 4 71028 5.63158E-5 35514 0 3.53132E-5
10-37455565-G-C p.Val643Val synonymous ANKRD30A 3 71412 4.20097E-5 35706 0 NA
10-37455581-G-A p.Ala649Thr missense ANKRD30A 83 71736 0.00115702 35868 2 0.0200594
10-37455582-C-T p.Ala649Val missense ANKRD30A 6 71978 8.33588E-5 35989 1 3.35886E-5
10-37455583-G-A p.Ala649Ala synonymous ANKRD30A 112 71748 0.00156102 35874 2 0.0201493
10-37455593-GAA-G p.Glu653fs frameshift ANKRD30A 1 72770 1.37419E-5 36385 0 3.19795E-5
10-37455607-A-G p.Ile657Met missense ANKRD30A 1 72730 1.37495E-5 36365 0 5.61205E-6
10-37455612-G-A p.Gly659Glu missense ANKRD30A 1 72340 1.38236E-5 36170 0 NA
10-37455613-A-G p.Gly659Gly synonymous ANKRD30A 1 72274 1.38362E-5 36137 0 3.18756E-5
10-37455627-A-G c.1987+4A>G splice_region ANKRD30A 12 70696 1.69741E-4 35348 0 2.02079E-4
10-37466642-G-A p.Ala768Thr missense ANKRD30A 41 33636 0.00121893 16818 0 0.0245807
10-37466644-G-A p.Ala768Ala synonymous ANKRD30A 41 33582 0.00122089 16791 0 0.0256048
10-37466692-C-A c.2344+8C>A splice_region ANKRD30A 20 35680 5.60538E-4 17840 3 0.0174788
10-37478440-G-T p.Ala767Ser missense ANKRD30A 14 35066 3.99247E-4 17533 0 0.0165414
10-37478443-A-G p.Thr768Ala missense ANKRD30A 2 34614 5.77801E-5 17307 0 0.0120822
10-37478445-G-A p.Thr768Thr synonymous ANKRD30A 865 4522 0.191287 2261 410 0.918396
10-37478486-G-T c.2344+1G>T splice_donor ANKRD30A 53 30518 0.00173668 15259 1 0.0418808
10-37481985-C-T c.2345-7C>T splice_region ANKRD30A 1 81132 1.23256E-5 40566 0 8.28391E-6
10-37481991-G-A c.2345-1G>A splice_acceptor ANKRD30A 16 81176 1.97103E-4 40588 0 2.44872E-4
10-37481991-G-C c.2345-1G>C splice_acceptor ANKRD30A 1 81180 1.23183E-5 40590 0 NA
10-37481992-A-G p.Glu782Gly missense+splice_region ANKRD30A 109 81114 0.00134379 40557 2 0.00786925
10-37481996-T-C p.Ser783Ser synonymous ANKRD30A 1 81238 1.23095E-5 40619 0 NA
10-37482002-T-C p.Asp785Asp synonymous ANKRD30A 1 81304 1.22995E-5 40652 0 NA
10-37482005-T-C p.Asn786Asn synonymous ANKRD30A 1 81324 1.22965E-5 40662 0 NA
10-37482008-T-C p.Asp787Asp synonymous ANKRD30A 262 81318 0.00322192 40659 2 0.00325089
10-37482010-G-T p.Gly788Val missense ANKRD30A 2 81356 2.45833E-5 40678 0 8.03019E-6
10-37482012-T-C p.Phe789Leu missense ANKRD30A 3 81386 3.68614E-5 40693 0 1.59378E-4
10-37482020-G-A p.Lys791Lys splice_region+synonymous ANKRD30A 4 81498 4.9081E-5 40749 0 3.61472E-5
10-37482026-A-C c.2373+6A>C splice_region ANKRD30A 1 81544 1.22633E-5 40772 0 3.18735E-5
10-37482028-C-G c.2373+8C>G splice_region ANKRD30A 2 81578 2.45164E-5 40789 0 4.01774E-6
10-37482107-C-A c.2374-7C>A splice_region ANKRD30A 45 81724 5.50634E-4 40862 0 3.78008E-4
10-37482107-CA-C c.2374-6delA splice_region ANKRD30A 2 81740 2.44678E-5 40870 0 8.30579E-6
10-37482112-A-G c.2374-2A>G splice_acceptor ANKRD30A 1 81742 1.22336E-5 40871 0 4.01974E-6
10-37482114-G-T p.Ala792Ser missense+splice_region ANKRD30A 110 81728 0.00134593 40864 0 0.00373659
10-37482117-C-T p.Pro793Ser missense ANKRD30A 3 81724 3.67089E-5 40862 0 1.29634E-4
10-37482117-C-A p.Pro793Thr missense ANKRD30A 3 81572 3.67773E-5 40786 0 0.00772452
10-37482118-C-A p.Pro793His missense ANKRD30A 2 81584 2.45146E-5 40792 0 0.00775815
10-37482119-C-CTAA p.Pro793_Cys794insTer stop_gained ANKRD30A 1 81730 1.22354E-5 40865 0 NA
10-37482123-A-G p.Arg795Gly missense ANKRD30A 5 81652 6.12355E-5 40826 0 0.00772017
10-37482127-T-C p.Met796Thr missense ANKRD30A 1 81748 1.22327E-5 40874 0 NA
10-37482132-G-A p.Val798Ile missense ANKRD30A 1 81750 1.22324E-5 40875 0 8.3073E-6
10-37482135-T-C p.Ser799Pro missense ANKRD30A 4 81750 4.89297E-5 40875 0 8.30813E-6
10-37482136-C-G p.Ser799Cys missense ANKRD30A 1 81748 1.22327E-5 40874 0 NA
10-37482144-A-G p.Thr802Ala missense ANKRD30A 1 81742 1.22336E-5 40871 0 1.60908E-5
10-37482145-C-T p.Thr802Ile missense ANKRD30A 1 81740 1.22339E-5 40870 0 NA
10-37482148-A-C p.Lys803Thr missense ANKRD30A 2 81744 2.44666E-5 40872 0 4.02369E-6
10-37482163-T-A p.Met808Lys missense ANKRD30A 1 81714 1.22378E-5 40857 0 6.66411E-5
10-37482169-T-C p.Met810Thr missense ANKRD30A 1 81716 1.22375E-5 40858 0 NA
10-37482182-AG-A p.Ala815fs frameshift ANKRD30A 1389 81646 0.0170125 40823 29 0.0208698
10-37486201-C-CT c.2447-8_2447-7insT splice_region ANKRD30A 1 81676 1.22435E-5 40838 0 NA
10-37486216-C-G p.Pro818Pro synonymous ANKRD30A 15 81710 1.83576E-4 40855 0 4.14567E-4
10-37486216-C-T p.Pro818Pro synonymous ANKRD30A 3 81708 3.67161E-5 40854 0 3.18898E-5
10-37486217-G-A p.Glu819Lys missense ANKRD30A 4 81686 4.8968E-5 40843 0 3.19061E-5
10-37486218-A-G p.Glu819Gly missense ANKRD30A 12 81700 1.46879E-4 40850 0 4.46087E-4
10-37486222-G-T p.Lys820Asn missense ANKRD30A 1 81718 1.22372E-5 40859 0 3.31268E-5
10-37486225-A-C p.Pro821Pro synonymous ANKRD30A 1 81710 1.22384E-5 40855 0 NA
10-37486230-C-T p.Ala823Val missense ANKRD30A 1 81696 1.22405E-5 40848 0 0.0018797
10-37486231-C-G p.Ala823Ala synonymous ANKRD30A 9 81692 1.1017E-4 40846 0 5.31915E-4
10-37486234-C-T p.Phe824Phe synonymous ANKRD30A 1 81688 1.22417E-5 40844 0 4.4109E-5
10-37486235-G-A p.Glu825Lys missense+splice_region ANKRD30A 6 81668 7.34682E-5 40834 0 0.0037234
10-37486240-A-G c.2475+3A>G splice_region ANKRD30A 1 81654 1.22468E-5 40827 0 3.60924E-5
10-37486335-G-A c.2476-1G>A splice_acceptor ANKRD30A 1 81066 1.23356E-5 40533 0 NA
10-37486336-C-T p.Pro826Ser missense+splice_region ANKRD30A 1 81068 1.23353E-5 40534 0 3.18695E-5
10-37486337-C-T p.Pro826Leu missense+splice_region ANKRD30A 2 81070 2.467E-5 40535 0 0.00112613
10-37486343-T-C p.Ile828Thr missense ANKRD30A 9 81074 1.1101E-4 40537 0 0.00125313
10-37486345-G-A p.Glu829Lys missense ANKRD30A 2 81102 2.46603E-5 40551 0 3.31735E-5
10-37486351-CA-C p.Lys832fs frameshift ANKRD30A 1 81110 1.23289E-5 40555 0 NA
10-37486356-G-C p.Lys832Asn missense ANKRD30A 1 81124 1.23268E-5 40562 0 NA
10-37486356-G-T p.Lys832Asn missense ANKRD30A 1 81124 1.23268E-5 40562 0 8.29284E-6
10-37486362-T-C p.Val834Val synonymous ANKRD30A 13 81140 1.60217E-4 40570 0 5.41643E-4
10-37486372-G-A p.Ala838Thr missense ANKRD30A 16 81166 1.97127E-4 40583 0 2.8699E-4
10-37486380-A-G p.Glu840Glu synonymous ANKRD30A 1 81170 1.23198E-5 40585 0 NA
10-37486386-G-A p.Lys842Lys synonymous ANKRD30A 5 81168 6.16006E-5 40584 0 1.6059E-5
10-37486387-A-G p.Asn843Asp missense ANKRD30A 4 81172 4.92781E-5 40586 0 1.00369E-4
10-37486388-A-G p.Asn843Ser missense ANKRD30A 4 81180 4.92732E-5 40590 0 9.12046E-5
10-37486393-C-G p.Gln845Glu missense ANKRD30A 1 81170 1.23198E-5 40585 0 NA
10-37486404-A-G p.Arg848Arg synonymous ANKRD30A 2 81138 2.46494E-5 40569 0 NA
10-37486405-G-A p.Ala849Thr missense ANKRD30A 3 81134 3.69759E-5 40567 0 8.29105E-6
10-37486409-G-C c.2548+1G>C splice_donor ANKRD30A 1 81110 1.23289E-5 40555 0 4.01497E-6
10-37486411-A-T c.2548+3A>T splice_region ANKRD30A 1 81114 1.23283E-5 40557 0 NA
10-37486412-C-T c.2548+4C>T splice_region ANKRD30A 2 81110 2.46579E-5 40555 0 6.37186E-5
10-37486412-C-A c.2548+4C>A splice_region ANKRD30A 32 81102 3.94565E-4 40551 1 0.00188206
10-37488665-C-T p.Phe853Phe synonymous ANKRD30A 1 80758 1.23827E-5 40379 0 NA
10-37488674-A-G p.Glu856Glu synonymous ANKRD30A 1 80848 1.23689E-5 40424 0 6.37349E-5
10-37488689-G-C p.Lys861Asn missense ANKRD30A 44227 79986 0.552934 39993 12455 0.55978
10-37488690-G-A p.Val862Ile missense ANKRD30A 1 80980 1.23487E-5 40490 0 1.80976E-5
10-37488691-T-C p.Val862Ala missense ANKRD30A 1 81038 1.23399E-5 40519 0 7.25242E-5
10-37488700-A-G p.Asn865Ser missense ANKRD30A 1 81060 1.23365E-5 40530 0 4.24531E-6
10-37488706-G-A p.Trp867* stop_gained ANKRD30A 1 81030 1.23411E-5 40515 0 3.18817E-5
10-37488712-C-G p.Ser869Cys missense ANKRD30A 2 81022 2.46847E-5 40511 0 NA
10-37488722-A-G c.2610+6A>G splice_region ANKRD30A 1 80794 1.23772E-5 40397 0 NA
10-37488724-G-A c.2610+8G>A splice_region ANKRD30A 1 80784 1.23787E-5 40392 0 9.50047E-6
10-37488724-G-T c.2610+8G>T splice_region ANKRD30A 1 80784 1.23787E-5 40392 0 NA
10-37490168-C-T p.Leu872Leu synonymous ANKRD30A 1 81982 1.21978E-5 40991 0 NA
10-37490169-C-T p.Arg873Cys missense ANKRD30A 2 81954 2.44039E-5 40977 0 7.49276E-5
10-37490170-G-A p.Arg873His missense ANKRD30A 7 81982 8.53846E-5 40991 0 6.38937E-5
10-37490177-T-A p.Thr875Thr synonymous ANKRD30A 1 82202 1.21652E-5 41101 0 NA
10-37490181-T-G p.Ser877Ala missense ANKRD30A 3 82242 3.64777E-5 41121 0 NA
10-37490191-A-T p.Asp880Val missense ANKRD30A 11 82274 1.337E-4 41137 0 5.1076E-5
10-37490191-ATG-A p.Val883fs frameshift ANKRD30A 1 82274 1.21545E-5 41137 0 8.3102E-6
10-37490192-T-A p.Asp880Glu missense ANKRD30A 1 82278 1.21539E-5 41139 0 4.25651E-6
10-37490195-G-C p.Val881Val synonymous ANKRD30A 14 82312 1.70085E-4 41156 0 0.001875
10-37490199-G-T p.Val883Leu missense ANKRD30A 1 82318 1.2148E-5 41159 0 NA
10-37490208-G-A p.Ala886Thr missense ANKRD30A 4 82388 4.85508E-5 41194 0 0.001875
10-37490217-C-A p.Gln889Lys missense ANKRD30A 1 82360 1.21418E-5 41180 0 3.19775E-5
10-37490223-G-A p.Glu891Lys missense ANKRD30A 23 82356 2.79275E-4 41178 0 2.55086E-4
10-37490234-A-C p.Lys894Asn missense ANKRD30A 2 82296 2.43025E-5 41148 0 1.66495E-5
10-37490235-A-G p.Ile895Val missense ANKRD30A 7 82270 8.50857E-5 41135 0 3.0769E-5
10-37490239-G-A p.Ser896Asn missense ANKRD30A 95 82226 0.00115535 41113 2 0.00226374
10-37490239-G-C p.Ser896Thr missense ANKRD30A 1 82228 1.21613E-5 41114 0 3.33244E-5
10-37505111-T-G p.Ser902Ala missense+splice_region ANKRD30A 6 80084 7.49213E-5 40042 0 NA
10-37505119-C-G p.Ser904Arg missense ANKRD30A 1 80234 1.24635E-5 40117 0 NA
10-37505130-T-A p.Ile908Asn missense ANKRD30A 1 80434 1.24326E-5 40217 0 NA
10-37505140-A-G p.Thr911Thr synonymous ANKRD30A 13 80568 1.61354E-4 40284 0 2.23814E-4
10-37505141-G-A p.Val912Ile missense ANKRD30A 15498 79424 0.19513 39712 1587 0.208483
10-37505145-A-G p.His913Arg missense ANKRD30A 13 80588 1.61314E-4 40294 0 2.00501E-4
10-37505147-T-C p.Ser914Pro missense ANKRD30A 1 80594 1.24079E-5 40297 0 4.04967E-6
10-37505157-G-A p.Arg917Lys missense ANKRD30A 4 80634 4.96069E-5 40317 0 1.92074E-4
10-37505159-G-A p.Ala918Thr missense ANKRD30A 19246 79942 0.24075 39971 2458 0.255808
10-37505164-G-A p.Arg919Arg synonymous ANKRD30A 2 80662 2.47948E-5 40331 0 NA
10-37505165-G-A p.Glu920Lys missense ANKRD30A 222 80656 0.00275243 40328 2 0.0031747
10-37505167-A-G p.Glu920Glu synonymous ANKRD30A 1 80672 1.23959E-5 40336 0 6.14251E-4
10-37505179-T-C p.Asp924Asp synonymous ANKRD30A 14882 80338 0.185242 40169 1508 0.191375
10-37505192-C-T p.Arg929Cys missense ANKRD30A 16198 80300 0.201719 40150 1845 0.208999
10-37505193-G-A p.Arg929His missense ANKRD30A 1 80718 1.23888E-5 40359 0 3.20082E-5
10-37505193-G-C p.Arg929Pro missense ANKRD30A 1 80718 1.23888E-5 40359 0 NA
10-37505196-C-G p.Thr930Arg missense ANKRD30A 1 80734 1.23864E-5 40367 0 8.34028E-6
10-37505215-G-A p.Met936Ile missense ANKRD30A 1 80818 1.23735E-5 40409 0 8.3478E-6
10-37505219-A-G p.Lys938Glu missense ANKRD30A 1 80834 1.2371E-5 40417 0 NA
10-37505224-G-A p.Lys939Lys synonymous ANKRD30A 10 80828 1.2372E-4 40414 0 6.06767E-5
10-37505242-G-C p.Lys945Asn missense ANKRD30A 71 80934 8.77258E-4 40467 0 0.00214606
10-37505243-A-G p.Lys946Glu missense ANKRD30A 1 80950 1.23533E-5 40475 0 4.04116E-6
10-37505256-CA-C p.Glu952fs frameshift ANKRD30A 1 80988 1.23475E-5 40494 0 1.21323E-5
10-37505270-TCA-T p.Gln956fs frameshift ANKRD30A 2 80962 2.47029E-5 40481 0 NA
10-37505271-CA-C p.Gln956fs frameshift ANKRD30A 1 80974 1.23496E-5 40487 0 NA
10-37505273-CAGTT-C p.Leu957fs frameshift ANKRD30A 1 80958 1.23521E-5 40479 0 2.51033E-5
10-37505281-G-A p.Glu958Glu synonymous ANKRD30A 1 80906 1.236E-5 40453 0 4.06025E-6
10-37505284-C-T p.Asn959Asn synonymous ANKRD30A 2 80884 2.47268E-5 40442 0 2.8453E-5
10-37505310-T-C p.Leu968Pro missense ANKRD30A 1 80472 1.24267E-5 40236 0 NA
10-37505323-G-A c.2915+1G>A splice_donor ANKRD30A 2 80058 2.49819E-5 40029 0 6.64011E-4
10-37505325-G-A c.2915+3G>A splice_region ANKRD30A 1 79956 1.25069E-5 39978 0 NA
10-37506630-T-C p.Leu975Leu synonymous ANKRD30A 1 79024 1.26544E-5 39512 0 NA
10-37506640-A-AAGAAG p.Asn984fs frameshift ANKRD30A 1 79668 1.25521E-5 39834 0 NA
10-37506641-A-G p.Glu978Glu synonymous ANKRD30A 4 79604 5.02487E-5 39802 0 NA
10-37506642-G-T p.Glu979* stop_gained ANKRD30A 1 79750 1.25392E-5 39875 0 NA
10-37506652-GAAGAA-G p.Arg983fs frameshift ANKRD30A 2 80284 2.49116E-5 40142 0 4.41653E-6
10-37506656-A-C p.Arg983Ser missense ANKRD30A 1 80476 1.24261E-5 40238 0 8.55388E-6
10-37506662-C-T p.Ala985Ala synonymous ANKRD30A 7 80554 8.68982E-5 40277 0 2.38387E-4
10-37506666-A-C p.Ile987Leu missense ANKRD30A 1 80826 1.23723E-5 40413 0 8.48652E-6
10-37506669-T-G p.Leu988Val missense ANKRD30A 3 80890 3.70874E-5 40445 0 3.20965E-5
10-37506685-G-A p.Arg993Lys missense ANKRD30A 30 81104 3.69895E-4 40552 1 1.09855E-4
10-37506685-G-C p.Arg993Thr missense ANKRD30A 1 81108 1.23292E-5 40554 0 NA
10-37506702-A-T p.Ile999Phe missense ANKRD30A 12 81336 1.47536E-4 40668 0 6.41026E-5
10-37506704-C-G p.Ile999Met missense ANKRD30A 1 81334 1.2295E-5 40667 0 NA
10-37506705-G-A p.Glu1000Lys missense ANKRD30A 1 81364 1.22904E-5 40682 0 1.2586E-5
10-37506708-G-A p.Glu1001Lys missense ANKRD30A 11 81442 1.35065E-4 40721 0 4.48747E-4
10-37506716-T-C p.His1003His synonymous ANKRD30A 1 81538 1.22642E-5 40769 0 1.65888E-5
10-37506718-G-C p.Arg1004Thr missense ANKRD30A 6 81566 7.35601E-5 40783 0 6.21793E-5
10-37506720-A-G p.Lys1005Glu missense ANKRD30A 2 81610 2.45068E-5 40805 0 1.68842E-5
10-37506725-G-A p.Glu1006Glu synonymous ANKRD30A 11 81636 1.34744E-4 40818 0 8.44409E-5
10-37506732-G-A p.Val1009Met missense ANKRD30A 35 81694 4.28428E-4 40847 0 0.00152749
10-37506740-AC-A p.Gln1012fs frameshift ANKRD30A 1 81646 1.2248E-5 40823 0 NA
10-37506753-G-A p.Ala1016Thr missense ANKRD30A 1 81654 1.22468E-5 40827 0 NA
10-37506763-T-C p.Ile1019Thr missense ANKRD30A 1 81522 1.22666E-5 40761 0 NA
10-37506764-A-G p.Ile1019Met missense ANKRD30A 1 81504 1.22693E-5 40752 0 4.22062E-6
10-37506767-A-T p.Gln1020His missense ANKRD30A 5 81482 6.13632E-5 40741 0 NA
10-37506770-T-C p.Asp1021Asp synonymous ANKRD30A 3 81362 3.68723E-5 40681 0 3.20883E-5
10-37506774-G-C p.Glu1023Gln missense ANKRD30A 1 81300 1.23001E-5 40650 0 4.47567E-6
10-37506784-G-C p.Ser1026Thr missense ANKRD30A 5 80674 6.19778E-5 40337 0 6.42343E-5
10-37506784-G-A p.Ser1026Asn missense ANKRD30A 1 80674 1.23956E-5 40337 0 NA
10-37506785-T-G p.Ser1026Arg missense ANKRD30A 12 80626 1.48835E-4 40313 0 6.13475E-5
10-37506788-A-G p.Val1027Val synonymous ANKRD30A 1 80538 1.24165E-5 40269 0 NA
10-37506789-G-T p.Glu1028* stop_gained ANKRD30A 1 80508 1.24211E-5 40254 0 NA
10-37506814-A-C c.3099+8A>C splice_region ANKRD30A 1 78890 1.26759E-5 39445 0 NA
10-37507900-T-A c.3100-8T>A splice_region ANKRD30A 3 78506 3.82136E-5 39253 0 1.27913E-5
10-37507905-T-C c.3100-3T>C splice_region ANKRD30A 1 78794 1.26913E-5 39397 0 2.32894E-5
10-37507912-C-T p.Ser1035Phe missense ANKRD30A 2 79074 2.52928E-5 39537 0 5.44203E-5
10-37507916-C-T p.His1036His synonymous ANKRD30A 1 79222 1.26228E-5 39611 0 NA
10-37507926-A-G p.Asn1040Asp missense ANKRD30A 1 79532 1.25736E-5 39766 0 NA
10-37507940-C-T p.Leu1044Leu synonymous ANKRD30A 9 79864 1.12692E-4 39932 0 3.19959E-5
10-37507946-T-A p.His1046Gln missense ANKRD30A 15 80030 1.8743E-4 40015 0 3.19939E-4
10-37507953-T-C p.Cys1049Arg missense ANKRD30A 1 80162 1.24747E-5 40081 0 3.19898E-5
10-37507956-A-G p.Met1050Val missense ANKRD30A 201 80246 0.0025048 40123 3 0.0025
10-37507957-T-C p.Met1050Thr missense ANKRD30A 42 80264 5.23273E-4 40132 0 8.96804E-4
10-37507963-A-G p.Lys1052Arg missense ANKRD30A 1 80446 1.24307E-5 40223 0 NA
10-37507982-A-C p.Leu1058Leu synonymous ANKRD30A 2925 80684 0.0362525 40342 50 0.0519399
10-37507989-G-C p.Glu1061Gln missense ANKRD30A 1 80852 1.23683E-5 40426 0 NA
10-37507990-A-G p.Glu1061Gly missense ANKRD30A 1 80880 1.2364E-5 40440 0 8.12572E-6
10-37507998-A-G p.Thr1064Ala missense ANKRD30A 1 81020 1.23426E-5 40510 0 3.19898E-5
10-37508000-A-G p.Thr1064Thr synonymous ANKRD30A 1 81062 1.23362E-5 40531 0 NA
10-37508004-A-T p.Lys1066* stop_gained ANKRD30A 2 81114 2.46567E-5 40557 0 NA
10-37508015-C-T p.Tyr1069Tyr synonymous ANKRD30A 5 81336 6.14734E-5 40668 0 2.88517E-4
10-37508027-A-G p.Glu1073Glu synonymous ANKRD30A 2 81782 2.44553E-5 40891 0 NA
10-37508035-A-T p.Tyr1076Phe missense ANKRD30A 3 81968 3.65996E-5 40984 0 8.35087E-6
10-37508036-C-A p.Tyr1076* stop_gained ANKRD30A 2 81992 2.43926E-5 40996 0 4.03177E-6
10-37508038-T-C p.Phe1077Ser missense ANKRD30A 39 82026 4.75459E-4 41013 0 5.75853E-4
10-37508045-C-T p.Asp1079Asp synonymous ANKRD30A 2 82212 2.43273E-5 41106 0 2.01515E-5
10-37508045-C-A p.Asp1079Glu missense ANKRD30A 2 82212 2.43273E-5 41106 0 NA
10-37508046-A-G p.Ile1080Val missense ANKRD30A 1 82212 1.21637E-5 41106 0 4.02924E-6
10-37508056-TAAAAG-T p.Lys1086fs frameshift ANKRD30A 2 82352 2.4286E-5 41176 0 NA
10-37508062-A-G p.Glu1085Gly missense ANKRD30A 1 82428 1.21318E-5 41214 0 3.19693E-5
10-37508079-C-T p.Gln1091* stop_gained ANKRD30A 1 82508 1.212E-5 41254 0 3.19877E-5
10-37508086-C-A p.Thr1093Asn missense ANKRD30A 1 82516 1.21189E-5 41258 0 NA
10-37508089-TA-T p.Lys1095fs frameshift ANKRD30A 10 82518 1.21186E-4 41259 0 4.99442E-5
10-37508094-C-T p.Leu1096Leu synonymous ANKRD30A 1 82516 1.21189E-5 41258 0 6.25E-4
10-37508121-G-A p.Ala1105Thr missense ANKRD30A 4 82496 4.84872E-5 41248 0 4.99226E-5
10-37508127-C-T p.Gln1107* stop_gained ANKRD30A 1 82502 1.21209E-5 41251 0 4.02427E-6
10-37508129-A-G p.Gln1107Gln synonymous ANKRD30A 1 82492 1.21224E-5 41246 0 9.59018E-5
10-37508132-T-C p.Tyr1108Tyr synonymous ANKRD30A 1 82492 1.21224E-5 41246 0 8.32154E-6
10-37508133-A-G p.Ser1109Gly missense ANKRD30A 2 82492 2.42448E-5 41246 0 3.19857E-5
10-37508137-G-A p.Gly1110Glu missense ANKRD30A 1 82478 1.21244E-5 41239 0 3.1998E-5
10-37508141-G-A p.Gln1111Gln synonymous ANKRD30A 1 82474 1.2125E-5 41237 0 2.49692E-5
10-37508151-C-G p.Leu1115Val missense ANKRD30A 1 82480 1.21242E-5 41240 0 NA
10-37508161-A-G p.Glu1118Gly missense ANKRD30A 12 82474 1.455E-4 41237 0 0.00252016
10-37508165-C-A p.Asn1119Lys missense ANKRD30A 1 82486 1.21233E-5 41243 0 NA
10-37508169-A-G p.Met1121Val missense ANKRD30A 1 82504 1.21206E-5 41252 0 8.32861E-6
10-37508183-A-G p.Lys1125Lys synonymous ANKRD30A 1 82482 1.21239E-5 41241 0 NA
10-37508205-G-T p.Glu1133* stop_gained ANKRD30A 1 82472 1.21253E-5 41236 0 NA
10-37508211-C-T p.Leu1135Leu synonymous ANKRD30A 1 82444 1.21294E-5 41222 0 6.25E-4
10-37508213-A-G p.Leu1135Leu synonymous ANKRD30A 33 82440 4.00291E-4 41220 0 3.58644E-4
10-37508230-C-T p.Ser1141Leu missense ANKRD30A 2 82442 2.42595E-5 41221 0 8.33903E-6
10-37508239-C-T p.Pro1144Leu missense ANKRD30A 2 82486 2.42465E-5 41243 1 5.03525E-4
10-37508247-G-A p.Ala1147Thr missense ANKRD30A 2 82470 2.42512E-5 41235 0 3.19877E-5
10-37508256-G-C p.Val1150Leu missense ANKRD30A 512 82472 0.00620817 41236 3 0.00642871
10-37508256-G-A p.Val1150Ile missense ANKRD30A 7 82480 8.48691E-5 41240 0 3.63481E-5
10-37508264-C-A p.Asp1152Glu missense ANKRD30A 1 82494 1.21221E-5 41247 0 NA
10-37508266-A-G p.His1153Arg missense ANKRD30A 1 82500 1.21212E-5 41250 0 NA
10-37508288-A-G p.Arg1160Arg synonymous ANKRD30A 2 82514 2.42383E-5 41257 0 9.67789E-5
10-37508298-G-C p.Glu1164Gln missense ANKRD30A 1 82486 1.21233E-5 41243 0 NA
10-37508315-T-C p.Ile1169Ile synonymous ANKRD30A 2 82462 2.42536E-5 41231 0 4.0319E-6
10-37508317-C-A p.Ala1170Glu missense ANKRD30A 1 82448 1.21289E-5 41224 0 3.19918E-5
10-37508317-C-T p.Ala1170Val missense ANKRD30A 2 82448 2.42577E-5 41224 0 NA
10-37508331-T-C p.Leu1175Leu synonymous ANKRD30A 2 82436 2.42612E-5 41218 0 5.03525E-4
10-37508355-G-C p.Val1183Leu missense ANKRD30A 3 82388 3.64131E-5 41194 0 1.67171E-5
10-37508358-A-G p.Ser1184Gly missense ANKRD30A 1 82364 1.21412E-5 41182 0 8.35925E-6
10-37508362-G-A p.Ser1185Asn missense ANKRD30A 2 82342 2.42889E-5 41171 0 0.00100806
10-37508363-T-C p.Ser1185Ser synonymous ANKRD30A 1 82336 1.21454E-5 41168 0 8.3612E-6
10-37508365-C-T p.Thr1186Met missense ANKRD30A 50 82344 6.07209E-4 41172 0 0.0015998
10-37508375-C-G p.Asn1189Lys missense ANKRD30A 4 82386 4.85519E-5 41193 0 8.36764E-6
10-37508381-G-A p.Glu1191Glu synonymous ANKRD30A 2 82398 2.42724E-5 41199 0 1.67398E-5
10-37508388-C-T p.His1194Tyr missense ANKRD30A 2 82446 2.42583E-5 41223 0 6.69927E-5
10-37508394-C-T p.Pro1196Ser missense ANKRD30A 10 82460 1.21271E-4 41230 0 5.75668E-4
10-37508401-C-G p.Ser1198Cys missense ANKRD30A 1 82486 1.21233E-5 41243 0 8.37535E-6
10-37508401-C-A p.Ser1198Tyr missense ANKRD30A 1 82486 1.21233E-5 41243 0 NA
10-37508410-A-G p.Gln1201Arg missense ANKRD30A 1 82492 1.21224E-5 41246 0 NA
10-37508413-G-C p.Arg1202Thr missense ANKRD30A 1 82498 1.21215E-5 41249 0 8.3783E-6
10-37508420-C-T p.Ser1204Ser synonymous ANKRD30A 1 82492 1.21224E-5 41246 0 NA
10-37508426-C-T p.Ser1206Ser synonymous ANKRD30A 1 82502 1.21209E-5 41251 0 8.38054E-6
10-37508432-A-G p.Lys1208Lys synonymous ANKRD30A 1 82570 1.21109E-5 41285 0 8.38251E-6
10-37508435-TA-T p.Asn1210fs frameshift ANKRD30A 3 82562 3.63363E-5 41281 0 3.3534E-5
10-37508446-A-C p.Tyr1213Ser missense ANKRD30A 3 82580 3.63284E-5 41290 0 6.39672E-5
10-37508450-A-C p.Ala1214Ala synonymous ANKRD30A 36850 82276 0.447883 41138 8358 0.569375
10-37508477-G-A p.Leu1223Leu synonymous ANKRD30A 1 82610 1.21051E-5 41305 0 NA
10-37508482-C-G p.Ser1225* stop_gained ANKRD30A 1 82650 1.20992E-5 41325 0 NA
10-37508499-G-T p.Asp1231Tyr missense ANKRD30A 7 82694 8.46494E-5 41347 0 0.00151515
10-37508503-A-G p.Gln1232Arg missense ANKRD30A 23 82714 2.78067E-4 41357 0 4.79724E-4
10-37508504-A-G p.Gln1232Gln synonymous ANKRD30A 2 82716 2.41791E-5 41358 0 1.27951E-4
10-37508505-C-T p.Arg1233Cys missense ANKRD30A 5 82708 6.04536E-5 41354 0 5.88869E-5
10-37508506-G-A p.Arg1233His missense ANKRD30A 1 82704 1.20913E-5 41352 0 8.41467E-6
10-37508510-AAC-A p.Gln1236fs frameshift ANKRD30A 6 82720 7.25338E-5 41360 0 3.36423E-5
10-37508513-A-G p.Thr1235Thr synonymous ANKRD30A 1 82720 1.2089E-5 41360 0 4.03359E-5
10-37508517-T-C p.Cys1237Arg missense ANKRD30A 2 82718 2.41785E-5 41359 0 NA
10-37508524-TGAAG-T p.Glu1241fs frameshift ANKRD30A 1 82728 1.20878E-5 41364 0 NA
10-37508532-G-T p.Ala1242Ser missense ANKRD30A 1 82692 1.20931E-5 41346 0 NA
10-37508534-T-A p.Ala1242Ala synonymous ANKRD30A 2 82700 2.41838E-5 41350 0 NA
10-37508538-C-A p.His1244Asn missense ANKRD30A 3 82694 3.62783E-5 41347 0 1.60133E-4
10-37508539-A-G p.His1244Arg missense ANKRD30A 21 82698 2.53936E-4 41349 0 9.5957E-5
10-37508540-C-T p.His1244His synonymous ANKRD30A 2 82692 2.41861E-5 41346 0 4.03411E-6
10-37508540-CAT-C p.Met1245fs frameshift ANKRD30A 1 82692 1.20931E-5 41346 0 NA
10-37508548-A-C p.Gln1247Pro missense ANKRD30A 1 82642 1.21004E-5 41321 0 NA
10-37508552-C-T p.Asn1248Asn synonymous ANKRD30A 2 82614 2.4209E-5 41307 0 4.03711E-6
10-37508564-T-C p.Asn1252Asn synonymous ANKRD30A 1 82548 1.21142E-5 41274 0 0.00125
10-37508565-G-A p.Val1253Met missense ANKRD30A 2 82526 2.42348E-5 41263 0 8.42701E-6
10-37508572-A-G p.Lys1255Arg missense ANKRD30A 1 82504 1.21206E-5 41252 0 4.03975E-6
10-37508577-A-G p.Thr1257Ala missense ANKRD30A 1 82466 1.21262E-5 41233 0 NA
10-37508578-CTG-C p.Glu1258fs frameshift ANKRD30A 215 82460 0.00260732 41230 1 0.002784
10-37508602-A-G p.Gln1265Arg missense ANKRD30A 2 82196 2.43321E-5 41098 0 4.45297E-5
10-37508607-T-G p.Leu1267Val missense ANKRD30A 1 82130 1.21758E-5 41065 0 NA
10-37508609-A-G p.Leu1267Leu synonymous ANKRD30A 1 82098 1.21806E-5 41049 0 NA
10-37508610-T-G p.Phe1268Val missense ANKRD30A 1 82096 1.21809E-5 41048 0 NA
10-37508620-A-G p.Gln1271Arg missense ANKRD30A 2 82010 2.43873E-5 41005 0 6.88465E-5
10-37508624-C-T p.Ser1272Ser synonymous ANKRD30A 1 81996 1.21957E-5 40998 0 NA
10-37508631-A-ATGTGG p.Leu1277fs frameshift ANKRD30A 1 81946 1.22032E-5 40973 0 6.41026E-5
10-37508631-A-G p.Met1275Val missense ANKRD30A 1 81946 1.22032E-5 40973 0 4.05078E-6
10-37508633-G-A p.Met1275Ile missense ANKRD30A 2 81914 2.44159E-5 40957 0 NA
10-37508643-C-T p.Gln1279* stop_gained ANKRD30A 2 81850 2.44349E-5 40925 0 3.21295E-5
10-37508645-G-A p.Gln1279Gln synonymous ANKRD30A 4 81842 4.88747E-5 40921 0 4.25786E-5
10-37508648-A-G p.Gln1280Gln synonymous ANKRD30A 2 81826 2.44421E-5 40913 0 1.94551E-4
10-37508648-A-AT p.Leu1281fs frameshift ANKRD30A 2 81826 2.44421E-5 40913 0 3.20636E-5
10-37508651-A-AT p.Val1282fs frameshift ANKRD30A 1 81822 1.22217E-5 40911 0 3.20554E-5
10-37508657-T-G p.His1283Gln missense ANKRD30A 1 81770 1.22294E-5 40885 0 NA
10-37508662-A-G p.His1285Arg missense ANKRD30A 8 81740 9.78713E-5 40870 0 9.62649E-5
10-37508671-C-A p.Ala1288Asp missense ANKRD30A 2 81656 2.4493E-5 40828 0 3.21668E-5
10-37508672-T-A p.Ala1288Ala synonymous ANKRD30A 1 81644 1.22483E-5 40822 0 NA
10-37508679-A-C p.Lys1291Gln missense ANKRD30A 1 81620 1.22519E-5 40810 0 4.05749E-6
10-37508692-C-A p.Thr1295Lys missense ANKRD30A 2 81474 2.45477E-5 40737 0 8.96957E-6
10-37508695-T-C p.Ile1296Thr missense ANKRD30A 1 81440 1.2279E-5 40720 0 4.06878E-6
10-37508701-T-C p.Ile1298Thr missense ANKRD30A 1 81360 1.22911E-5 40680 0 NA
10-37508703-C-G p.His1299Asp missense ANKRD30A 4 81328 4.91836E-5 40664 0 9.36575E-6
10-37508717-G-A p.Arg1303Arg synonymous ANKRD30A 8 81062 9.86899E-5 40531 0 5.03525E-4
10-37508726-A-G p.Gln1306Gln synonymous ANKRD30A 1 80930 1.23564E-5 40465 0 4.1157E-6
10-37508735-C-T p.Leu1309Leu synonymous ANKRD30A 1 80784 1.23787E-5 40392 0 1.1722E-5
10-37508744-GA-G p.Asn1314fs frameshift ANKRD30A 8 80536 9.93345E-5 40268 0 0.00100705
10-37508750-T-C p.Asn1314Asn synonymous ANKRD30A 1 80318 1.24505E-5 40159 0 NA
10-37508753-G-T p.Glu1315Asp missense ANKRD30A 3 80196 3.74084E-5 40098 0 NA
10-37508775-C-T p.His1323Tyr missense ANKRD30A 2 79102 2.52838E-5 39551 0 5.29455E-5
10-37508781-A-T p.Lys1325* stop_gained ANKRD30A 1 78714 1.27042E-5 39357 0 9.67333E-6
10-37508787-C-T p.Arg1327Cys missense ANKRD30A 1 78152 1.27956E-5 39076 0 6.40205E-4
10-37508788-G-A p.Arg1327His missense ANKRD30A 8 78116 1.02412E-4 39058 0 6.42674E-4
10-37508799-T-G p.Tyr1331Asp missense ANKRD30A 2 77002 2.59734E-5 38501 0 0.00132275
10-37508804-A-G p.Glu1332Glu synonymous ANKRD30A 1 76558 1.3062E-5 38279 0 6.55824E-5
10-37508808-G-A p.Glu1334Lys missense ANKRD30A 1 76312 1.31041E-5 38156 0 1.27998E-5
10-37508814-G-C p.Ala1336Pro missense ANKRD30A 16 75786 2.11121E-4 37893 0 0.00457782
10-37508815-C-G p.Ala1336Gly missense ANKRD30A 1 75798 1.3193E-5 37899 0 NA
10-37508827-TAAGTATC-T c.4017+3_4017+9delAAGTATC splice_region ANKRD30A 8 74040 1.0805E-4 37020 0 4.07398E-4
10-37520381-C-T c.4018-8C>T splice_region ANKRD30A 1 81104 1.23298E-5 40552 0 1.68175E-5
10-37520393-C-T p.Ser1341Leu missense ANKRD30A 1 81160 1.23213E-5 40580 0 4.20539E-6
10-37520395-T-C p.Ter1342Argext*? stop_lost ANKRD30A 1 81126 1.23265E-5 40563 0 NA
10-37520608-G-A c.*211G>A splice_region ANKRD30A 3 46698 6.42426E-5 23349 0 8.33333E-4