Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
3-15711780-G-A p.Tyr1086Tyr synonymous ANKRD28 1 82412 1.21342E-5 41206 0 1.91034E-4
3-15711815-C-T p.Val1075Met missense ANKRD28 2 82500 2.42424E-5 41250 0 4.14401E-5
3-15711816-G-A p.Asp1074Asp synonymous ANKRD28 5 82498 6.06075E-5 41249 0 6.3678E-5
3-15711824-A-G p.Tyr1072His missense ANKRD28 1 82532 1.21165E-5 41266 0 8.28583E-6
3-15711834-C-T p.Gln1068Gln synonymous ANKRD28 1 82556 1.2113E-5 41278 0 NA
3-15711853-T-C p.Asn1062Ser missense ANKRD28 5 82560 6.0562E-5 41280 0 3.6135E-5
3-15711864-A-G p.Tyr1058Tyr synonymous ANKRD28 1 82560 1.21124E-5 41280 0 3.31257E-5
3-15711889-A-G p.Ile1050Thr missense ANKRD28 20 82532 2.4233E-4 41266 1 6.25E-4
3-15711892-G-C p.Pro1049Arg missense ANKRD28 1 82544 1.21148E-5 41272 0 8.28061E-6
3-15711895-A-G p.Leu1048Ser missense ANKRD28 1 82556 1.2113E-5 41278 0 NA
3-15711899-C-A p.Ala1047Ser missense ANKRD28 3 82538 3.63469E-5 41269 0 6.36862E-5
3-15711907-C-T p.Ser1044Asn missense ANKRD28 1 82522 1.2118E-5 41261 0 NA
3-15711914-T-C p.Thr1042Ala missense ANKRD28 1 82532 1.21165E-5 41266 0 3.31225E-5
3-15711921-G-C p.Thr1039Thr synonymous ANKRD28 2 82564 2.42236E-5 41282 0 NA
3-15711922-G-A p.Thr1039Ile missense ANKRD28 1 82570 1.21109E-5 41285 0 NA
3-15711928-G-C p.Thr1037Ser missense ANKRD28 1 82558 1.21127E-5 41279 0 NA
3-15711934-C-T p.Arg1035His missense ANKRD28 1 82540 1.21153E-5 41270 0 6.62471E-5
3-15711935-G-A p.Arg1035Cys missense ANKRD28 1 82546 1.21145E-5 41273 0 NA
3-15711943-G-A p.Ala1032Val missense ANKRD28 1 82544 1.21148E-5 41272 0 3.18431E-5
3-15711946-T-C p.Asn1031Ser missense ANKRD28 4 82536 4.84637E-5 41268 0 3.61469E-5
3-15711991-ATGG-A p.Thr1015del disruptive_inframe_deletion ANKRD28 2 82396 2.4273E-5 41198 0 8.28487E-6
3-15712004-T-C p.Ile1012Val missense ANKRD28 1 82354 1.21427E-5 41177 0 NA
3-15712005-G-A p.Leu1011Leu synonymous ANKRD28 7 82362 8.49907E-5 41181 0 4.01884E-6
3-15712010-C-T p.Ala1010Thr missense ANKRD28 1 82306 1.21498E-5 41153 0 4.02059E-6
3-15712013-G-A p.Leu1009Leu synonymous ANKRD28 3 82296 3.64538E-5 41148 0 3.18451E-5
3-15712019-C-T p.Asp1007Asn missense ANKRD28 1 82246 1.21586E-5 41123 0 NA
3-15712023-C-A p.Val1005Val synonymous ANKRD28 2 82214 2.43268E-5 41107 0 NA
3-15712033-T-C p.Asn1002Ser missense ANKRD28 2 82114 2.43564E-5 41057 0 2.01202E-5
3-15712044-G-T p.Ala998Ala synonymous ANKRD28 1 81972 1.21993E-5 40986 0 NA
3-15712059-A-G p.Tyr993Tyr synonymous ANKRD28 13 81674 1.59169E-4 40837 0 NA
3-15712060-T-A p.Tyr993Phe missense ANKRD28 1 81644 1.22483E-5 40822 0 NA
3-15712060-T-C p.Tyr993Cys missense ANKRD28 2 81644 2.44966E-5 40822 0 NA
3-15712062-G-C p.Gly992Gly splice_region+synonymous ANKRD28 2 81588 2.45134E-5 40794 0 NA
3-15717397-C-A c.2974+8G>T splice_region ANKRD28 2 82202 2.43303E-5 41101 0 NA
3-15717420-C-T p.Ala987Thr missense ANKRD28 1 82370 1.21403E-5 41185 0 NA
3-15717421-A-C p.Leu986Leu synonymous ANKRD28 417 82370 0.00506252 41185 5 0.009375
3-15717462-T-C p.Met973Val missense ANKRD28 28 82344 3.40037E-4 41172 0 5.55122E-4
3-15717476-C-T p.Arg968Gln missense ANKRD28 3 82234 3.64813E-5 41117 0 8.31228E-6
3-15717477-G-A p.Arg968* stop_gained ANKRD28 1 82230 1.2161E-5 41115 0 NA
3-15717480-C-A p.Ala967Ser missense ANKRD28 1 82212 1.21637E-5 41106 0 NA
3-15717486-C-T p.Val965Ile missense ANKRD28 1 82198 1.21657E-5 41099 0 NA
3-15717496-T-TGTTTGCAAGG c.2883-1_2883insCCTTGCAAAC splice_acceptor ANKRD28 1 82044 1.21886E-5 41022 0 NA
3-15717501-G-A c.2883-5C>T splice_region ANKRD28 1 81946 1.22032E-5 40973 0 NA
3-15718482-T-C p.Thr961Ala missense+splice_region ANKRD28 1 81854 1.22169E-5 40927 0 4.01926E-6
3-15718491-C-A p.Ala958Ser missense ANKRD28 1 81904 1.22094E-5 40952 0 3.61658E-5
3-15718494-C-T p.Ala957Thr missense ANKRD28 27 81906 3.29646E-4 40953 0 8.6053E-4
3-15718495-G-A p.Asn956Asn synonymous ANKRD28 2 81944 2.44069E-5 40972 0 3.18756E-5
3-15718505-T-C p.Asn953Ser missense ANKRD28 6 81966 7.32011E-5 40983 0 0.00100705
3-15718507-G-A p.Ile952Ile synonymous ANKRD28 14 81974 1.70786E-4 40987 0 1.24322E-4
3-15718514-T-C p.Asn950Ser missense ANKRD28 1 81966 1.22002E-5 40983 0 NA
3-15718517-C-T p.Arg949Lys missense ANKRD28 1 81970 1.21996E-5 40985 0 NA
3-15718518-T-C p.Arg949Gly missense ANKRD28 2 81974 2.4398E-5 40987 0 3.18492E-5
3-15718537-T-A p.Ile942Ile synonymous ANKRD28 4 81892 4.88448E-5 40946 0 8.2894E-6
3-15718563-C-CCTTG c.2800-1_2800insCAAG splice_acceptor ANKRD28 1 81642 1.22486E-5 40821 0 NA
3-15718563-C-T p.Gly934Ser missense+splice_region ANKRD28 1 81642 1.22486E-5 40821 0 NA
3-15718565-T-TTGCTACAAGCCAA c.2800-3_2800-2insTTGGCTTGTAGCA splice_region ANKRD28 1 81618 1.22522E-5 40809 0 NA
3-15718565-TA-T c.2800-3delT splice_region ANKRD28 2 81618 2.45044E-5 40809 1 NA
3-15718566-A-G c.2800-3T>C splice_region ANKRD28 3 81574 3.67764E-5 40787 0 2.01313E-5
3-15719014-A-G p.Asn924Asn synonymous ANKRD28 1 82020 1.21921E-5 41010 0 8.31808E-6
3-15719020-A-T p.Ser922Arg missense ANKRD28 3 82072 3.65533E-5 41036 0 6.37349E-5
3-15719027-T-C p.Asp920Gly missense ANKRD28 1 82112 1.21785E-5 41056 0 8.32418E-6
3-15719048-C-T p.Ser913Asn missense ANKRD28 1 82098 1.21806E-5 41049 0 1.27389E-4
3-15719049-T-C p.Ser913Gly missense ANKRD28 2611 81988 0.0318461 40994 56 0.0316005
3-15719049-TA-CG p.AlaSer912AlaGly missense ANKRD28 2 82074 2.43683E-5 41037 0 NA
3-15719051-G-C p.Ala912Gly missense ANKRD28 2 82082 2.43659E-5 41041 0 4.0211E-6
3-15719067-T-C p.Met907Val missense+splice_region ANKRD28 1 81938 1.22043E-5 40969 0 NA
3-15719069-T-TCAA c.2717-1_2717insTTG splice_acceptor ANKRD28 4 81952 4.88091E-5 40976 1 NA
3-15719070-C-CAACTGTATTTGTTTGTCCATTTTCTGCAGCCATCATAAGAGG c.2717-2_2717-1insCCTCTTATGATGGCTGCAGAAAATGGACAAACAAATACAGTT splice_acceptor ANKRD28 2 81936 2.44093E-5 40968 1 NA
3-15719709-T-A c.2716+7A>T splice_region ANKRD28 2 81726 2.4472E-5 40863 0 6.36983E-5
3-15719764-T-C p.Lys890Glu missense ANKRD28 2 82020 2.43843E-5 41010 0 1.68825E-5
3-15719766-C-T p.Gly889Glu missense ANKRD28 1 82026 1.21913E-5 41013 0 1.20992E-5
3-15719772-G-A p.Ser887Phe missense ANKRD28 1 82050 1.21877E-5 41025 0 1.20901E-5
3-15719784-T-C p.Asn883Ser missense ANKRD28 5 82058 6.09325E-5 41029 0 3.18431E-5
3-15719795-A-G p.Asn879Asn synonymous ANKRD28 1 82070 1.21847E-5 41035 0 NA
3-15719804-G-T p.Leu876Leu synonymous ANKRD28 2 82054 2.43742E-5 41027 0 4.83684E-5
3-15719818-A-G p.Leu872Leu synonymous ANKRD28 53 82006 6.46294E-4 41003 0 0.00117804
3-15719822-C-T p.Glu870Glu synonymous ANKRD28 28 81962 3.41622E-4 40981 0 2.86606E-4
3-15719828-A-G p.Met722Thr missense ANKRD28 1 81930 1.22055E-5 40965 0 NA
3-15719843-G-A p.Pro717Leu missense ANKRD28 4 81744 4.89333E-5 40872 1 4.54234E-5
3-15719847-G-A p.Gln716* stop_gained ANKRD28 1 81682 1.22426E-5 40841 0 4.15987E-6
3-15719852-G-C p.Ser714Cys missense ANKRD28 1 81658 1.22462E-5 40829 0 NA
3-15719857-G-T p.Pro859Thr missense ANKRD28 2 81636 2.4499E-5 40818 0 2.51492E-5
3-15719859-G-A p.Thr858Ile missense+splice_region ANKRD28 2 81560 2.45218E-5 40780 0 NA
3-15719869-A-T c.2571-8T>A splice_region ANKRD28 1 81416 1.22826E-5 40708 0 6.37267E-5
3-15720812-C-T p.Gly856Arg missense ANKRD28 1 81998 1.21954E-5 40999 0 4.97603E-5
3-15720825-G-A p.Ala851Ala synonymous ANKRD28 2 82152 2.43451E-5 41076 0 1.20526E-5
3-15720828-G-A p.Asn850Asn synonymous ANKRD28 3 82214 3.64901E-5 41107 0 6.37349E-5
3-15720842-C-T p.Ala846Thr missense ANKRD28 1 82370 1.21403E-5 41185 0 NA
3-15720845-C-T p.Gly845Ser missense ANKRD28 1 82408 1.21347E-5 41204 0 NA
3-15720880-T-C p.Asn833Ser missense ANKRD28 1 82624 1.2103E-5 41312 0 6.25E-4
3-15720890-TCCTGTGTAAGGTAACAAGGTGATCATTCTCACAGCAATGGTGTATTTCTTAAAACACTCAAACCAAATCTGATTCATTCTGGCTTTACTTA-T p.Ile830fs frameshift ANKRD28 7 82644 8.47006E-5 41322 0 NA
3-15720984-C-T p.Val829Met missense+splice_region ANKRD28 6 82630 7.26128E-5 41315 0 3.18593E-5
3-15720987-C-T p.Ala828Thr missense ANKRD28 1 82622 1.21033E-5 41311 0 8.03432E-6
3-15720987-C-A p.Ala828Ser missense ANKRD28 5 82622 6.05166E-5 41311 0 2.81201E-5
3-15720996-A-G p.Leu825Leu synonymous ANKRD28 5 82634 6.05078E-5 41317 0 1.76771E-4
3-15720999-G-A p.Pro824Ser missense ANKRD28 1 82630 1.21021E-5 41315 0 8.3925E-6
3-15721013-C-T p.Gly819Glu missense ANKRD28 1 82628 1.21024E-5 41314 0 9.44806E-5
3-15721018-C-T p.Thr817Thr synonymous ANKRD28 4 82618 4.84156E-5 41309 0 6.09024E-5
3-15721019-G-A p.Thr817Met missense ANKRD28 115 82612 0.00139205 41306 1 0.00375
3-15721025-T-C p.Gln815Arg missense ANKRD28 1 82596 1.21071E-5 41298 0 NA
3-15721027-G-A p.Phe814Phe synonymous ANKRD28 2 82596 2.42142E-5 41298 0 NA
3-15721056-C-T p.Val805Ile missense ANKRD28 10 82538 1.21156E-4 41269 0 2.86624E-4
3-15721058-CAT-C p.Val805fs frameshift ANKRD28 1 82534 1.21162E-5 41267 0 4.0996E-6
3-15721060-T-C p.Thr803Thr synonymous ANKRD28 1 82514 1.21192E-5 41257 0 NA
3-15721066-G-A p.His801His synonymous ANKRD28 6 82484 7.27414E-5 41242 0 9.56084E-5
3-15721077-A-G c.2399-7T>C splice_region ANKRD28 1 82396 1.21365E-5 41198 0 8.62917E-6
3-15726733-C-T p.Gly800Ser missense+splice_region ANKRD28 2 82174 2.43386E-5 41087 0 1.2053E-5
3-15726735-T-C p.Asn799Ser missense+splice_region ANKRD28 7 82190 8.51685E-5 41095 0 1.24527E-4
3-15726739-A-G p.Tyr798His missense ANKRD28 1 82230 1.2161E-5 41115 0 8.03381E-6
3-15726744-G-A p.Ala796Val missense ANKRD28 1 82246 1.21586E-5 41123 0 3.1839E-5
3-15726749-G-C p.His794Gln missense ANKRD28 1 82270 1.21551E-5 41135 0 NA
3-15726758-C-T p.Thr791Thr synonymous ANKRD28 3 82298 3.64529E-5 41149 0 2.00773E-5
3-15726759-G-A p.Thr791Met missense ANKRD28 4 82306 4.85991E-5 41153 0 9.55353E-5
3-15726769-G-A p.His788Tyr missense ANKRD28 1 82332 1.21459E-5 41166 0 3.18471E-5
3-15726774-T-C p.Asp786Gly missense ANKRD28 1 82332 1.21459E-5 41166 0 3.1841E-5
3-15726781-T-C p.Thr784Ala missense ANKRD28 2 82332 2.42919E-5 41166 0 3.1837E-5
3-15726790-TTGCATCCATAGATGC-T p.Ala776_Ala780del conservative_inframe_deletion ANKRD28 1 82336 1.21454E-5 41168 0 NA
3-15726791-T-G p.Ala780Ala synonymous ANKRD28 1 82342 1.21445E-5 41171 0 8.02968E-6
3-15726796-C-T p.Asp779Asn missense ANKRD28 1 82346 1.21439E-5 41173 0 NA
3-15726805-C-T p.Ala776Thr missense ANKRD28 3 82358 3.64263E-5 41179 0 8.2813E-6
3-15726823-C-T p.Ala770Thr missense ANKRD28 9 82402 1.09221E-4 41201 0 3.18512E-5
3-15726837-A-G p.Ile765Thr missense ANKRD28 5 82458 6.06369E-5 41229 0 5.03525E-4
3-15726844-C-T p.Gly763Arg missense ANKRD28 2 82472 2.42507E-5 41236 0 NA
3-15726854-A-C p.Ser759Ser synonymous ANKRD28 1 82496 1.21218E-5 41248 0 NA
3-15726857-C-G p.Leu758Leu synonymous ANKRD28 1 82488 1.2123E-5 41244 0 NA
3-15726860-G-T p.His757Gln missense ANKRD28 1 82500 1.21212E-5 41250 0 NA
3-15726869-C-T p.Thr754Thr synonymous ANKRD28 30 82508 3.63601E-4 41254 0 9.55657E-4
3-15726871-T-C p.Thr754Ala missense ANKRD28 1 82502 1.21209E-5 41251 0 NA
3-15726873-C-T p.Arg753Gln missense ANKRD28 3 82514 3.63575E-5 41257 0 1.6567E-5
3-15726874-G-A p.Arg753Trp missense ANKRD28 2 82524 2.42354E-5 41262 0 1.20427E-5
3-15726888-C-T p.Arg748Gln missense ANKRD28 6 82512 7.27167E-5 41256 0 1.15988E-4
3-15726889-G-A p.Arg748Trp missense ANKRD28 16 82510 1.93916E-4 41255 0 8.28487E-5
3-15726893-T-C p.Leu746Leu synonymous ANKRD28 76 82520 9.20989E-4 41260 0 0.00171942
3-15726898-A-C p.Cys745Gly missense ANKRD28 1 82506 1.21203E-5 41253 0 4.01413E-6
3-15726899-C-A p.Lys744Asn missense ANKRD28 2 82506 2.42407E-5 41253 0 8.28624E-6
3-15726908-A-T p.His741Gln missense ANKRD28 2 82468 2.42518E-5 41234 0 0.00100705
3-15726911-T-C p.Gln740Gln synonymous ANKRD28 1 82456 1.21277E-5 41228 0 8.29022E-6
3-15726938-A-G p.His731His synonymous ANKRD28 2 82200 2.43309E-5 41100 0 NA
3-15726950-T-C p.Ala727Ala splice_region+synonymous ANKRD28 4 82098 4.87223E-5 41049 0 1.97228E-4
3-15727515-A-G p.His724His synonymous ANKRD28 1 82642 1.21004E-5 41321 0 9.62371E-6
3-15727522-G-A p.Ala722Val missense ANKRD28 3 82660 3.62932E-5 41330 0 3.18492E-5
3-15727528-C-T p.Arg720Lys missense ANKRD28 1 82688 1.20937E-5 41344 0 9.01534E-6
3-15727599-G-A p.Asn696Asn synonymous ANKRD28 2 82694 2.41856E-5 41347 0 4.03825E-6
3-15727599-G-C p.Asn696Lys missense ANKRD28 1 82694 1.20928E-5 41347 0 NA
3-15727600-T-C p.Asn696Ser missense ANKRD28 1 82702 1.20916E-5 41351 0 1.80626E-5
3-15727604-G-C p.Leu695Val missense ANKRD28 1 82722 1.20887E-5 41361 0 NA
3-15727607-C-T p.Val694Ile missense ANKRD28 1 82730 1.20875E-5 41365 0 NA
3-15727611-T-C p.Leu692Leu synonymous ANKRD28 2 82726 2.41762E-5 41363 0 9.5511E-5
3-15727617-C-G p.Leu690Leu synonymous ANKRD28 1 82728 1.20878E-5 41364 0 4.05249E-6
3-15727621-G-A p.Pro689Leu missense ANKRD28 1 82718 1.20893E-5 41359 0 9.49289E-6
3-15727624-G-A p.Thr688Met missense+splice_region ANKRD28 3 82710 3.62713E-5 41355 0 5.03525E-4
3-15727625-TCCTGAGCAACAACAGGAATAGGTTCAGTGCTGTCACTTAAGACTGTACTCTGGTTTTCGAAATACGCCCTTCTGTGATGCAACAATTATTTATCGAAACTTA-T p.Thr688fs frameshift ANKRD28 7 82704 8.46392E-5 41352 2 NA
3-15727726-T-C c.2060+3A>G splice_region ANKRD28 2 82650 2.41984E-5 41325 0 NA
3-15727754-C-T p.Val679Met missense ANKRD28 1 82610 1.21051E-5 41305 0 NA
3-15727756-G-T p.Ala678Glu missense ANKRD28 1 82588 1.21083E-5 41294 0 NA
3-15727759-T-C p.Asn677Ser missense ANKRD28 2 82580 2.42189E-5 41290 0 0.00100705
3-15727768-T-A p.Glu674Val missense ANKRD28 2 82526 2.42348E-5 41263 0 NA
3-15727774-T-C p.Asn672Ser missense ANKRD28 24 82490 2.90944E-4 41245 0 0.0020141
3-15727800-T-C p.Ser663Ser synonymous ANKRD28 96 82200 0.00116788 41100 0 0.00280237
3-15727813-G-A p.Thr659Ile missense ANKRD28 2 81992 2.43926E-5 40996 0 2.23374E-5
3-15727819-G-GCTGCATGAA c.1973-4_1973-3insTTCATGCAG splice_region ANKRD28 1 81836 1.22196E-5 40918 0 NA
3-15727819-G-GC c.1973-4_1973-3insG splice_region ANKRD28 4 81836 4.88782E-5 40918 2 NA
3-15727821-A-G c.1973-5T>C splice_region ANKRD28 2 81768 2.44594E-5 40884 0 NA
3-15727823-A-G c.1973-7T>C splice_region ANKRD28 8879 80406 0.110427 40203 509 0.207416
3-15731532-C-T p.Ala656Thr missense ANKRD28 2 81762 2.44612E-5 40881 0 NA
3-15731536-A-T p.Ile654Ile synonymous ANKRD28 2228 81784 0.0272425 40892 147 0.0561894
3-15731538-T-G p.Ile654Leu missense ANKRD28 1 81918 1.22073E-5 40959 0 1.45231E-5
3-15731545-C-G p.Arg651Ser missense ANKRD28 3 82052 3.65622E-5 41026 0 NA
3-15731571-A-C p.Leu643Val missense ANKRD28 6 82450 7.27714E-5 41225 0 7.74868E-5
3-15731575-T-C p.Ser641Ser synonymous ANKRD28 1 82516 1.21189E-5 41258 0 NA
3-15731578-G-A p.Ala640Ala synonymous ANKRD28 1 82532 1.21165E-5 41266 0 NA
3-15731593-G-A p.Leu635Leu synonymous ANKRD28 7 82594 8.47519E-5 41297 0 0.00100705
3-15731610-C-T p.Glu630Lys missense ANKRD28 2 82626 2.42055E-5 41313 0 4.06904E-6
3-15731631-C-T p.Ala623Thr missense ANKRD28 1 82652 1.20989E-5 41326 0 NA
3-15731636-T-G p.Asp621Ala missense ANKRD28 1 82648 1.20995E-5 41324 0 NA
3-15731653-A-G p.Ser615Ser synonymous ANKRD28 1 82624 1.2103E-5 41312 0 NA
3-15731667-C-G p.Val611Leu missense ANKRD28 1 82564 1.21118E-5 41282 0 0.00105102
3-15731667-C-T p.Val611Ile missense ANKRD28 2 82564 2.42236E-5 41282 0 NA
3-15731668-A-ATATAATATT p.Asp610delinsGluIleLeuTyr disruptive_inframe_insertion ANKRD28 1 82574 1.21103E-5 41287 0 NA
3-15731669-T-TATAATATTTC p.Asp610fs frameshift ANKRD28 1 82568 1.21112E-5 41284 0 NA
3-15731689-T-C p.Val603Val synonymous ANKRD28 2 82392 2.42742E-5 41196 0 NA
3-15731691-C-G p.Val603Leu missense ANKRD28 6 82366 7.28456E-5 41183 0 1.38609E-4
3-15731707-T-A p.Gln597His missense ANKRD28 1 82114 1.21782E-5 41057 0 NA
3-15731721-G-T p.His593Asn missense ANKRD28 1 81788 1.22267E-5 40894 0 NA
3-15731723-T-C p.Tyr592Cys missense ANKRD28 2 81744 2.44666E-5 40872 0 4.88186E-5
3-15731727-C-CAGCCAAGTGTAAAGGGCTTATTGTTGCTCTATTATCTGAAT c.1771-1_1771insATTCAGATAATAGAGCAACAATAAGCCCTTTACACTTGGCT splice_acceptor ANKRD28 2 81542 2.45272E-5 40771 1 NA
3-15731727-C-CAGCCAAGTGTAAAGGGCTTATTGTTGCTCTATTATCTGAATCACTCAGCATGT c.1771-1_1771insACATGCTGAGTGATTCAGATAATAGAGCAACAATAAGCCCTTTACACTTGGCT splice_acceptor ANKRD28 1 81542 1.22636E-5 40771 0 NA
3-15736238-G-A c.1770+8C>T splice_region ANKRD28 5 82266 6.07784E-5 41133 0 2.41369E-5
3-15736255-T-C p.Leu587Leu synonymous ANKRD28 1 82364 1.21412E-5 41182 0 4.42016E-5
3-15736266-T-C p.Ile584Val missense ANKRD28 1 82402 1.21356E-5 41201 0 NA
3-15736271-G-C p.Ala582Gly missense ANKRD28 1 82410 1.21345E-5 41205 0 NA
3-15736278-T-G p.Asn580His missense ANKRD28 1 82412 1.21342E-5 41206 0 NA
3-15736320-A-AAACATCTAGAGGAGTTTCACTTGCAATCAGCTGAAGACATAGACGGTGACCATAAGCAG c.1696-1_1696insCTGCTTATGGTCACCGTCTATGTCTTCAGCTGATTGCAAGTGAAACTCCTCTAGATGTT splice_acceptor ANKRD28 2 82326 2.42937E-5 41163 1 NA
3-15736323-G-GA c.1696-4_1696-3insT splice_region ANKRD28 1 82312 1.21489E-5 41156 0 NA
3-15736692-TACA-T p.Leu566fs frameshift ANKRD28 1 81762 1.22306E-5 40881 0 NA
3-15736706-G-A p.Pro562Ser missense ANKRD28 2 81736 2.4469E-5 40868 0 NA
3-15737644-C-T p.Gln555Gln synonymous ANKRD28 1 81824 1.22214E-5 40912 0 3.18613E-5
3-15737645-T-C p.Gln555Arg missense ANKRD28 3 81838 3.66578E-5 40919 0 NA
3-15737658-G-A p.Arg551Cys missense ANKRD28 2 81974 2.4398E-5 40987 0 3.18573E-5
3-15737665-A-G p.Tyr548Tyr synonymous ANKRD28 1 82034 1.21901E-5 41017 0 4.24646E-5
3-15737669-G-A p.Ala547Val missense ANKRD28 2 82052 2.43748E-5 41026 0 4.16025E-5
3-15737676-A-C p.Ser545Ala missense ANKRD28 7 82082 8.52806E-5 41041 0 6.37146E-5
3-15737689-G-A p.Asn540Asn synonymous ANKRD28 46497 81574 0.569998 40787 13480 0.60425
3-15737689-GT-AC p.Asn540Ser missense ANKRD28 1 82094 1.21812E-5 41047 0 NA
3-15737698-T-C p.Gln537Gln synonymous ANKRD28 44512 81592 0.545544 40796 12716 0.585739
3-15737708-C-T p.Arg534His missense ANKRD28 3 82066 3.65559E-5 41033 0 3.18817E-5
3-15737708-C-A p.Arg534Leu missense ANKRD28 2 82066 2.43706E-5 41033 0 5.04032E-4
3-15737709-G-A p.Arg534Cys missense ANKRD28 2 82054 2.43742E-5 41027 0 5.09182E-5
3-15737713-C-T p.Gly532Gly synonymous ANKRD28 1 82050 1.21877E-5 41025 0 NA
3-15737736-A-G p.Leu525Leu synonymous ANKRD28 3 81904 3.66282E-5 40952 0 1.98578E-5
3-15737744-T-A p.Glu522Val missense ANKRD28 1 81780 1.22279E-5 40890 0 NA
3-15737752-C-CTTGCCATCTGTGTCTGATGTAGCTGCATAGTG c.1557-1_1557insCACTATGCAGCTACATCAGACACAGATGGCAA splice_acceptor ANKRD28 3 81610 3.67602E-5 40805 1 NA
3-15737752-C-CTTGCCATCTGTGTCTGATGTAGCTGCATAGTGCAGGGGTGTGCAGCCT c.1557-1_1557insAGGCTGCACACCCCTGCACTATGCAGCTACATCAGACACAGATGGCAA splice_acceptor ANKRD28 1 81610 1.22534E-5 40805 0 NA
3-15737752-C-CTTGCCATCTGTGTCTGATGTAGCTG c.1557-1_1557insCAGCTACATCAGACACAGATGGCAA splice_acceptor ANKRD28 1 81610 1.22534E-5 40805 0 NA
3-15737756-T-C c.1557-4A>G splice_region ANKRD28 4 81514 4.90713E-5 40757 0 2.4599E-5
3-15737758-T-TACA c.1557-7_1557-6insTGT splice_region ANKRD28 222 81404 0.00272714 40702 3 0.00583583
3-15737758-TACA-T c.1557-9_1557-7delTGT splice_region ANKRD28 1328 81350 0.0163245 40675 23 0.0148288
3-15749431-T-C p.Lys519Arg missense+splice_region ANKRD28 2 82552 2.42272E-5 41276 0 8.06354E-6
3-15749436-A-G p.Asp517Asp synonymous ANKRD28 147 82560 0.00178052 41280 1 0.010574
3-15749452-G-C p.Ala512Gly missense ANKRD28 5 82550 6.05694E-5 41275 0 2.82047E-5
3-15749453-C-T p.Ala512Thr missense ANKRD28 2 82550 2.42277E-5 41275 0 3.1839E-5
3-15749465-G-A p.Leu508Leu synonymous ANKRD28 5 82542 6.05752E-5 41271 0 6.36862E-5
3-15749474-A-G p.Cys505Arg missense ANKRD28 1 82512 1.21194E-5 41256 0 NA
3-15749498-C-G p.Val497Leu missense ANKRD28 1 82444 1.21294E-5 41222 0 4.06911E-6
3-15749521-G-C p.Ala489Gly missense ANKRD28 1 82372 1.214E-5 41186 0 NA
3-15749541-G-A p.Cys482Cys synonymous ANKRD28 2 82314 2.42972E-5 41157 0 0.00151057
3-15749544-G-A p.Asn481Asn synonymous ANKRD28 1 82292 1.21518E-5 41146 0 NA
3-15749545-T-C p.Asn481Ser missense ANKRD28 1 82292 1.21518E-5 41146 0 1.2191E-5
3-15749555-C-T p.Ala478Thr missense ANKRD28 2 82204 2.43297E-5 41102 0 5.29857E-5
3-15749569-G-C p.Ser473Cys missense+splice_region ANKRD28 1 82112 1.21785E-5 41056 0 NA
3-15749579-G-A c.1416-8C>T splice_region ANKRD28 1 81952 1.22023E-5 40976 0 1.60767E-5
3-15751178-C-T p.Gly471Glu missense ANKRD28 1 82200 1.21655E-5 41100 0 NA
3-15751202-T-C p.Asp463Gly missense ANKRD28 1 82226 1.21616E-5 41113 0 2.82614E-5
3-15751210-A-T p.Thr460Thr synonymous ANKRD28 1 82222 1.21622E-5 41111 0 NA
3-15751215-T-G p.Asn459His missense ANKRD28 2 82218 2.43256E-5 41109 0 NA
3-15751218-G-C p.Leu458Val missense ANKRD28 4 82204 4.86594E-5 41102 0 9.55597E-5
3-15751234-C-T p.Glu452Glu synonymous ANKRD28 1 82034 1.21901E-5 41017 0 2.96472E-5
3-15751244-C-CCTCCAGCTGCAGCTGCATGTAGACAAGTCCTGCCAAAATCATCTGGGG c.1347-2_1347-1insCCCCAGATGATTTTGGCAGGACTTGTCTACATGCAGCTGCAGCTGGAG splice_acceptor ANKRD28 2 81938 2.44087E-5 40969 1 NA
3-15751247-T-C c.1347-4A>G splice_region ANKRD28 3 81892 3.66336E-5 40946 0 NA
3-15752768-A-G p.Asp432Asp synonymous ANKRD28 1 81996 1.21957E-5 40998 0 NA
3-15752769-T-C p.Asp432Gly missense ANKRD28 1 82016 1.21927E-5 41008 0 NA
3-15752772-A-G p.Ile431Thr missense ANKRD28 1 81998 1.21954E-5 40999 0 NA
3-15752776-C-A p.Asp430Tyr missense ANKRD28 1 81990 1.21966E-5 40995 0 NA
3-15752785-C-A c.1283-4G>T splice_region ANKRD28 8 81826 9.77684E-5 40913 0 5.09684E-4
3-15753641-A-G c.1282+6T>C splice_region ANKRD28 43292 81472 0.531373 40736 12256 0.575349
3-15753648-T-C p.Ser427Ser splice_region+synonymous ANKRD28 2 82450 2.42571E-5 41225 0 1.61322E-5
3-15753649-G-A p.Ser427Leu missense+splice_region ANKRD28 1 82450 1.21286E-5 41225 0 3.18532E-5
3-15753653-AAAG-A p.Leu425del conservative_inframe_deletion ANKRD28 4 82494 4.84884E-5 41247 0 NA
3-15753665-TG-CC p.CysArg421TrpGly missense ANKRD28 1 82516 1.21189E-5 41258 0 NA
3-15753665-T-C p.Arg422Gly missense ANKRD28 1 82516 1.21189E-5 41258 0 NA
3-15753666-G-C p.Cys421Trp missense ANKRD28 1 82506 1.21203E-5 41253 0 NA
3-15753676-G-A p.Ser418Leu missense ANKRD28 2 82508 2.42401E-5 41254 0 NA
3-15753718-T-C p.His404Arg missense ANKRD28 3 82400 3.64078E-5 41200 0 3.18431E-5
3-15753727-C-T p.Arg401His missense+splice_region ANKRD28 3 82348 3.64308E-5 41174 0 1.27445E-4
3-15753729-C-CTTTGCAGTGTCAGCACCACTTGTAATAAGAGTGTTGATCAGCAG c.1200-1_1200insCTGCTGATCAACACTCTTATTACAAGTGGTGCTGACACTGCAAA splice_acceptor ANKRD28 1 82338 1.21451E-5 41169 0 NA
3-15755032-A-C c.1199+2T>G splice_donor ANKRD28 1 81948 1.22029E-5 40974 0 NA
3-15755055-G-A p.Thr393Ile missense ANKRD28 2 82028 2.43819E-5 41014 0 1.27397E-4
3-15755069-G-T p.Ile388Ile synonymous ANKRD28 1 82040 1.21892E-5 41020 0 NA
3-15755075-C-A p.Leu386Leu synonymous ANKRD28 1 82034 1.21901E-5 41017 0 4.06633E-6
3-15755087-A-G p.Tyr382Tyr synonymous ANKRD28 1 82016 1.21927E-5 41008 0 NA
3-15755091-C-T p.Arg381Gln missense ANKRD28 1 82004 1.21945E-5 41002 0 1.27389E-4
3-15755092-G-A p.Arg381Trp missense ANKRD28 1 82008 1.21939E-5 41004 0 3.18593E-5
3-15755098-C-T p.Ala379Thr missense ANKRD28 18 81986 2.1955E-4 40993 0 3.64673E-4
3-15755119-C-G p.Gly372Arg missense ANKRD28 1 81916 1.22076E-5 40958 0 NA
3-15755120-A-G p.Asn371Asn synonymous ANKRD28 1 81906 1.22091E-5 40953 0 NA
3-15755137-C-T p.Asp366Asn missense ANKRD28 1 81706 1.2239E-5 40853 0 1.24925E-5
3-15755138-G-A p.Ile365Ile synonymous ANKRD28 1 81696 1.22405E-5 40848 0 4.45831E-4
3-15755143-C-T p.Val364Ile missense ANKRD28 1 81580 1.22579E-5 40790 0 3.1841E-5
3-15755148-C-CCA c.1085-1_1085insTG splice_acceptor ANKRD28 1 81480 1.2273E-5 40740 0 NA
3-15755148-C-CCACT c.1085-1_1085insAGTG splice_acceptor ANKRD28 1 81478 1.22733E-5 40739 0 NA
3-15755153-A-G c.1085-5T>C splice_region ANKRD28 1 81360 1.22911E-5 40680 0 NA
3-15755154-A-G c.1085-6T>C splice_region ANKRD28 1 81364 1.22904E-5 40682 0 NA
3-15756077-C-T c.1084+8G>A splice_region ANKRD28 1 80802 1.23759E-5 40401 0 4.99578E-5
3-15756090-T-C p.Gln360Arg missense ANKRD28 1 81666 1.2245E-5 40833 0 9.48002E-6
3-15756092-G-A p.Ile359Ile synonymous ANKRD28 1 81820 1.2222E-5 40910 0 1.74618E-5
3-15756094-T-C p.Ile359Val missense ANKRD28 1 81774 1.22288E-5 40887 0 NA
3-15756097-T-C p.Ile358Val missense ANKRD28 2 81838 2.44385E-5 40919 0 4.3281E-5
3-15756110-G-C p.Ser353Ser synonymous ANKRD28 2 82066 2.43706E-5 41033 0 NA
3-15756122-G-A p.His349His synonymous ANKRD28 1 82050 1.21877E-5 41025 0 0.0020141
3-15756130-C-G p.Ala347Pro missense ANKRD28 1 82114 1.21782E-5 41057 0 NA
3-15756136-T-C p.Met345Val missense ANKRD28 1 82084 1.21826E-5 41042 0 NA
3-15756146-G-A p.Thr341Thr synonymous ANKRD28 1 81966 1.22002E-5 40983 0 NA
3-15756147-G-C p.Thr341Ser missense ANKRD28 1 81980 1.21981E-5 40990 0 NA
3-15756165-T-TG c.1006-3_1006-2insC splice_region ANKRD28 52 81666 6.3674E-4 40833 0 0.00379523
3-15756165-TG-T c.1006-3delC splice_region ANKRD28 7 81748 8.5629E-5 40874 0 3.03788E-4
3-15756167-G-C c.1006-4C>G splice_region ANKRD28 15 81774 1.83432E-4 40887 0 5.78592E-4
3-15756167-G-A c.1006-4C>T splice_region ANKRD28 1 81774 1.22288E-5 40887 0 9.27902E-6
3-15756168-G-T c.1006-5C>A splice_region ANKRD28 40 81746 4.89321E-4 40873 0 0.00125
3-15756168-G-C c.1006-5C>G splice_region ANKRD28 2 81748 2.44654E-5 40874 0 4.66427E-5
3-15762414-T-A c.1005+8A>T splice_region ANKRD28 1 82448 1.21289E-5 41224 0 NA
3-15762418-T-C c.1005+4A>G splice_region ANKRD28 1 82480 1.21242E-5 41240 0 NA
3-15762429-T-C p.Asn333Ser missense ANKRD28 1 82548 1.21142E-5 41274 0 8.06387E-6
3-15762436-C-T p.Asp331Asn missense ANKRD28 3 82592 3.63231E-5 41296 0 6.37146E-5
3-15762437-G-A p.Ala330Ala synonymous ANKRD28 12 82580 1.45314E-4 41290 0 0.003125
3-15762441-C-T p.Gly329Glu missense ANKRD28 1 82606 1.21057E-5 41303 0 NA
3-15762444-T-C p.Asn328Ser missense ANKRD28 4 82608 4.84215E-5 41304 0 3.61818E-5
3-15762444-T-A p.Asn328Ile missense ANKRD28 2 82608 2.42107E-5 41304 0 8.30454E-6
3-15762452-T-C p.Leu325Leu synonymous ANKRD28 1 82626 1.21027E-5 41313 0 2.48851E-5
3-15762470-T-A p.Ala319Ala synonymous ANKRD28 1 82640 1.21007E-5 41320 0 3.18471E-5
3-15762481-T-C p.Thr316Ala missense ANKRD28 2 82646 2.41996E-5 41323 0 NA
3-15762505-G-A p.Pro308Ser missense ANKRD28 3 82626 3.63082E-5 41313 0 1.65695E-5
3-15762518-T-C p.Glu303Glu synonymous ANKRD28 9 82612 1.08943E-4 41306 0 3.18451E-5
3-15762519-T-G p.Glu303Ala missense ANKRD28 1 82600 1.21065E-5 41300 0 8.28391E-6
3-15762532-T-A p.Asn299Tyr missense ANKRD28 2 82562 2.42242E-5 41281 0 4.01542E-6
3-15762542-A-G p.Gly295Gly synonymous ANKRD28 1 82546 1.21145E-5 41273 0 NA
3-15762552-A-G p.Ile292Thr missense ANKRD28 34 82544 4.11902E-4 41272 0 0.005
3-15762553-T-A p.Ile292Leu missense ANKRD28 1 82552 1.21136E-5 41276 0 NA
3-15762553-T-C p.Ile292Val missense ANKRD28 2 82552 2.42272E-5 41276 0 1.65664E-5
3-15762563-C-T p.Val288Val synonymous ANKRD28 2 82544 2.42295E-5 41272 0 NA
3-15762573-T-C p.Asp285Gly missense ANKRD28 6 82532 7.26991E-5 41266 0 1.60641E-5
3-15762578-T-C p.Gly283Gly synonymous ANKRD28 2 82520 2.42365E-5 41260 0 NA
3-15762583-T-C p.Asn282Asp missense ANKRD28 2 82502 2.42418E-5 41251 0 4.01765E-6
3-15762585-T-C p.Tyr281Cys missense ANKRD28 1 82498 1.21215E-5 41249 0 NA
3-15762592-C-T p.Ala279Thr missense ANKRD28 3 82476 3.63742E-5 41238 0 3.18431E-5
3-15762615-T-C p.Tyr271Cys missense ANKRD28 4 82388 4.85508E-5 41194 0 1.21653E-5
3-15762618-G-A p.Ala270Val missense ANKRD28 1 82348 1.21436E-5 41174 0 8.30165E-6
3-15762620-A-G p.Asn269Asn synonymous ANKRD28 1 82350 1.21433E-5 41175 0 8.30579E-6
3-15762624-G-A p.Pro268Leu missense ANKRD28 1 82308 1.21495E-5 41154 0 NA
3-15762625-G-A p.Pro268Ser missense ANKRD28 5 82304 6.07504E-5 41152 0 2.07765E-4
3-15762634-T-TATCAACTCCAAGATCTAGAAGGTACTTGACTACGCTGATCATTCCACTAGAGGCTG c.793-1_793insCAGCCTCTAGTGGAATGATCAGCGTAGTCAAGTACCTTCTAGATCTTGGAGTTGAT splice_acceptor ANKRD28 1 82234 1.21604E-5 41117 0 NA
3-15762634-T-TATCAA c.793-1_793insTTGAT splice_acceptor ANKRD28 2 82234 2.43208E-5 41117 1 NA
3-15765882-T-C c.792+7A>G splice_region ANKRD28 2 82066 2.43706E-5 41033 0 3.45895E-4
3-15765891-C-T p.Asp264Asn missense+splice_region ANKRD28 1 82148 1.21732E-5 41074 0 NA
3-15765921-C-T p.Val254Ile missense ANKRD28 4 82230 4.8644E-5 41115 0 3.18593E-5
3-15765941-G-A p.Ala247Val missense ANKRD28 21 82282 2.5522E-4 41141 0 2.5481E-4
3-15765953-A-C p.Leu243Arg missense ANKRD28 2 82286 2.43055E-5 41143 0 NA
3-15765961-A-G p.Tyr240Tyr synonymous ANKRD28 2 82300 2.43013E-5 41150 0 8.81213E-5
3-15765965-G-C p.Ser239Cys missense ANKRD28 1 82300 1.21507E-5 41150 0 NA
3-15765967-C-CT p.Ser239fs frameshift ANKRD28 1 82292 1.21518E-5 41146 0 NA
3-15765968-T-C p.Lys238Arg missense ANKRD28 1 82296 1.21513E-5 41148 0 NA
3-15765986-A-G p.Val232Ala missense ANKRD28 1 82296 1.21513E-5 41148 0 4.62133E-6
3-15766000-C-T p.Ser227Ser synonymous ANKRD28 2 82288 2.43049E-5 41144 0 9.55962E-5
3-15766001-G-A p.Ser227Leu missense ANKRD28 9 82288 1.09372E-4 41144 0 8.63521E-5
3-15766017-C-T p.Val222Met missense ANKRD28 1 82272 1.21548E-5 41136 0 NA
3-15766018-T-G p.Val221Val synonymous ANKRD28 1 82270 1.21551E-5 41135 0 NA
3-15766019-AC-GA p.Val221Ser missense ANKRD28 2 82262 2.43126E-5 41131 0 NA
3-15766020-C-T p.Val221Ile missense ANKRD28 2 82268 2.43108E-5 41134 0 2.36989E-5
3-15766032-C-CCA c.650-2_650-1insTG splice_acceptor ANKRD28 4 82218 4.86511E-5 41109 2 NA
3-15766036-A-G c.650-5T>C splice_region ANKRD28 1 82214 1.21634E-5 41107 0 NA
3-15776909-G-A c.649+8C>T splice_region ANKRD28 446 81888 0.00544646 40944 4 0.00388765
3-15776910-T-C c.649+7A>G splice_region ANKRD28 1 81954 1.2202E-5 40977 0 6.44064E-6
3-15776913-A-C c.649+4T>G splice_region ANKRD28 1 82032 1.21904E-5 41016 0 6.25148E-6
3-15776919-A-G p.Met216Thr missense+splice_region ANKRD28 1 82220 1.21625E-5 41110 0 NA
3-15776943-C-T p.Arg208His missense ANKRD28 1 82408 1.21347E-5 41204 0 5.05561E-4
3-15776944-G-A p.Arg208Cys missense ANKRD28 1 82412 1.21342E-5 41206 0 4.05186E-5
3-15776949-T-C p.Asp206Gly missense ANKRD28 1 82446 1.21292E-5 41223 0 NA
3-15776969-A-C p.Ile199Met missense ANKRD28 1 82422 1.21327E-5 41211 0 3.99233E-5
3-15777001-C-T p.Val189Ile missense ANKRD28 1 82228 1.21613E-5 41114 0 3.18492E-5
3-15777002-C-T p.Met188Ile missense+splice_region ANKRD28 1 82220 1.21625E-5 41110 0 6.22952E-6
3-15777003-A-G p.Met188Thr missense+splice_region ANKRD28 1 82184 1.21678E-5 41092 0 NA
3-15777006-T-TCACCATGTCCACTGAAAGCTGCATGATGTAATGCAGTCCTCCCTGCTC c.562-3_562-2insGAGCAGGGAGGACTGCATTACATCATGCAGCTTTCAGTGGACATGGTG splice_region ANKRD28 2 82154 2.43445E-5 41077 1 NA
3-15778542-C-T p.Glu187Lys missense+splice_region ANKRD28 1 82682 1.20945E-5 41341 0 NA
3-15778544-C-A p.Gly186Val missense ANKRD28 4 82690 4.83734E-5 41345 0 3.18431E-4
3-15778546-A-C p.His185Gln missense ANKRD28 1 82686 1.20939E-5 41343 0 NA
3-15778588-T-G p.Arg171Arg synonymous ANKRD28 3 82744 3.62564E-5 41372 0 NA
3-15778596-A-C p.Ser169Ala missense ANKRD28 2 82760 2.41663E-5 41380 0 NA
3-15778599-C-T p.Val168Ile missense ANKRD28 7 82766 8.45758E-5 41383 0 0.003125
3-15778623-C-A p.Val160Leu missense ANKRD28 2 82788 2.41581E-5 41394 0 4.012E-6
3-15778628-G-C p.Ala158Gly missense ANKRD28 1 82786 1.20793E-5 41393 0 NA
3-15778632-C-T p.Glu157Lys missense ANKRD28 1 82792 1.20785E-5 41396 0 NA
3-15778663-T-A p.Ile146Ile synonymous ANKRD28 1 82776 1.20808E-5 41388 0 4.01236E-6
3-15778675-G-C p.Thr142Thr synonymous ANKRD28 1 82778 1.20805E-5 41389 0 NA
3-15778681-C-A p.Trp140Cys missense ANKRD28 1 82768 1.2082E-5 41384 0 NA
3-15778694-C-T p.Arg136Gln missense ANKRD28 2 82756 2.41674E-5 41378 0 8.36554E-6
3-15778726-T-C p.Val125Val synonymous ANKRD28 5 82714 6.04493E-5 41357 0 9.18324E-5
3-15778727-A-G p.Val125Ala missense ANKRD28 3 82708 3.62722E-5 41354 0 1.85014E-5
3-15778742-T-TCACTAC c.361-3_361-2insGTAGTG splice_region ANKRD28 2 82644 2.42002E-5 41322 1 NA
3-15793264-C-T p.Cys118Tyr missense ANKRD28 2 81974 2.4398E-5 40987 0 6.37918E-5
3-15793267-G-A p.Ser117Phe missense ANKRD28 2 82010 2.43873E-5 41005 0 NA
3-15793269-T-A p.Ala116Ala synonymous ANKRD28 1 82018 1.21924E-5 41009 0 3.18817E-5
3-15793284-T-C p.Leu111Leu synonymous ANKRD28 1 82066 1.21853E-5 41033 0 5.07099E-4
3-15793295-A-G p.Leu108Leu synonymous ANKRD28 2 82022 2.43837E-5 41011 0 9.23941E-6
3-15797978-TTTAC-T n.69+5_69+8delGTAA splice_region ANKRD28 57 23902 0.00238474 11951 0 0.0026113
3-15807731-GTTA-G c.289+7_289+9delTAA splice_region ANKRD28 1 82212 1.21637E-5 41106 0 NA
3-15807735-C-T c.289+6G>A splice_region ANKRD28 1 82304 1.21501E-5 41152 0 4.03171E-6
3-15807737-A-G c.289+4T>C splice_region ANKRD28 1 82322 1.21474E-5 41161 0 4.02745E-6
3-15807754-A-C p.Phe27Cys missense ANKRD28 4 82464 4.8506E-5 41232 0 3.18492E-5
3-15807759-C-G p.Glu91Gln missense ANKRD28 1 82496 1.21218E-5 41248 0 4.01761E-6
3-15807763-G-A p.Ser24Leu missense ANKRD28 456 82526 0.00552553 41263 2 0.010625
3-15807773-T-A p.Asp86Val missense ANKRD28 1 82572 1.21106E-5 41286 0 NA
3-15807773-T-C p.Asp86Gly missense ANKRD28 5 82572 6.05532E-5 41286 0 4.01461E-6
3-15807774-C-T p.Asp86Asn missense ANKRD28 2 82580 2.42189E-5 41290 0 1.67381E-5
3-15807790-G-A p.Pro15Leu missense ANKRD28 3 82594 3.63222E-5 41297 0 3.18735E-5
3-15807791-G-T p.Ala80Asp missense ANKRD28 1 82622 1.21033E-5 41311 0 NA
3-15807792-C-T p.Ala80Thr missense ANKRD28 2 82584 2.42178E-5 41292 0 8.37156E-6
3-15807793-G-A p.Thr14Met missense ANKRD28 451 82588 0.00546084 41294 0 0.00380279
3-15807795-G-A p.His79Tyr missense ANKRD28 2 82610 2.42101E-5 41305 0 NA
3-15807806-C-T p.Arg75Gln missense ANKRD28 3 82500 3.63636E-5 41250 0 3.18776E-5
3-15807817-G-A p.Thr6Ile missense+splice_region ANKRD28 1 82518 1.21186E-5 41259 0 NA
3-15807824-G-C c.211-5C>G splice_region ANKRD28 4 82458 4.85095E-5 41229 0 8.61861E-6
3-15836723-G-GT c.210+6_210+7insA splice_region ANKRD28 7335 80972 0.0905869 40486 372 0.0853005
3-15836763-T-C p.Ala59Ala synonymous ANKRD28 1 81502 1.22696E-5 40751 0 NA
3-15836767-C-T p.Arg58Gln missense ANKRD28 4 81490 4.90858E-5 40745 0 6.64905E-5
3-15836768-G-T p.Arg58Arg synonymous ANKRD28 2 81502 2.45393E-5 40751 0 1.66223E-5
3-15836777-C-G p.Asp55His missense ANKRD28 1 81534 1.22648E-5 40767 0 NA
3-15836786-C-T p.Gly52Arg missense ANKRD28 1 81478 1.22733E-5 40739 0 9.55962E-5
3-15836787-G-A c.-44C>T 5_prime_UTR_premature_start_codon_gain ANKRD28 2 81494 2.45417E-5 40747 0 5.04032E-4
3-15836799-T-C p.Gln47Gln synonymous ANKRD28 1 81430 1.22805E-5 40715 0 8.31103E-6
3-15836808-T-C p.Ser44Ser synonymous ANKRD28 2 81414 2.45658E-5 40707 0 1.20857E-5
3-15836819-AT-A c.127-7delA splice_region ANKRD28 3 81264 3.69167E-5 40632 0 NA
3-15837898-C-G c.126+5G>C splice_region ANKRD28 3 76348 3.92938E-5 38174 0 3.18918E-5
3-15837899-T-G c.126+4A>C splice_region ANKRD28 1 76402 1.30887E-5 38201 0 7.46503E-6
3-15837918-A-G p.Asn37Asn synonymous ANKRD28 1 76818 1.30178E-5 38409 0 7.37017E-6
3-15837928-G-C p.Pro34Arg missense ANKRD28 1 76920 1.30005E-5 38460 0 7.37061E-6
3-15837928-G-A p.Pro34Leu missense ANKRD28 1 76920 1.30005E-5 38460 0 NA
3-15837938-G-A p.His31Tyr missense ANKRD28 1 77026 1.29826E-5 38513 0 NA
3-15837944-A-G p.Ser29Pro missense ANKRD28 8 77046 1.03834E-4 38523 0 0.004375
3-15837959-G-A p.Pro24Ser missense ANKRD28 2 77122 2.59329E-5 38561 0 NA
3-15837975-T-C p.Ala18Ala synonymous ANKRD28 1 77180 1.29567E-5 38590 0 NA
3-15837979-GGA-G p.Pro17fs frameshift ANKRD28 1 77172 1.29581E-5 38586 0 7.31507E-6
3-15837988-T-C p.Asp14Gly missense ANKRD28 1 77208 1.2952E-5 38604 0 7.07214E-5
3-15837995-C-T p.Val12Ile missense ANKRD28 4 77214 5.18041E-5 38607 0 6.37267E-5
3-15837997-T-C p.Glu11Gly missense ANKRD28 2 77220 2.59E-5 38610 0 7.3155E-6
3-15838002-C-T p.Leu9Leu synonymous ANKRD28 1 77224 1.29493E-5 38612 0 NA
3-15838019-C-A p.Val4Leu missense ANKRD28 1 77124 1.29661E-5 38562 0 NA
3-15838021-C-T p.Arg3Gln missense ANKRD28 4 77064 5.19049E-5 38532 0 1.45921E-4
3-15838024-C-T p.Ser2Asn missense ANKRD28 1 77018 1.2984E-5 38509 0 NA
3-15839480-G-T n.212C>A splice_region ANKRD28 1 24258 4.12235E-5 12129 0 NA
3-15855744-T-C c.*52+3A>G splice_region ANKRD28 1 74768 1.33747E-5 37384 0 NA
3-15855802-A-G p.Asn14Asn synonymous ANKRD28 2 75630 2.64445E-5 37815 0 8.088E-6
3-15855814-G-C p.Ala10Ala splice_region+synonymous ANKRD28 1 75570 1.32328E-5 37785 0 NA
3-15900884-C-T p.Gln9Gln splice_region+synonymous ANKRD28 1 71352 1.4015E-5 35676 0 NA
3-15900885-T-C p.Gln9Arg missense+splice_region ANKRD28 1 71274 1.40304E-5 35637 0 NA
3-15900893-G-C p.Leu6Leu synonymous ANKRD28 1 71094 1.40659E-5 35547 0 NA
3-15900895-G-A p.Leu6Phe missense ANKRD28 1 70988 1.40869E-5 35494 0 NA
3-15900899-G-A p.Leu4Leu synonymous ANKRD28 2 70856 2.82263E-5 35428 0 NA
3-15900996-G-A c.-86C>T 5_prime_UTR_premature_start_codon_gain ANKRD28 1 51072 1.95802E-5 25536 0 NA