Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
19-33089058-C-T p.Arg1049Gln missense ANKRD27 10 82566 1.21115E-4 41283 0 5.03525E-4
19-33089059-G-A p.Arg1049Trp missense ANKRD27 1 82606 1.21057E-5 41303 0 3.18532E-5
19-33089067-C-CTA p.Ser1046fs frameshift ANKRD27 1 82706 1.2091E-5 41353 0 1.19381E-5
19-33089077-G-A p.Gln1043* stop_gained ANKRD27 1 82786 1.20793E-5 41393 0 NA
19-33089077-G-T p.Gln1043Lys missense ANKRD27 1 82786 1.20793E-5 41393 0 NA
19-33089081-A-T p.Thr1041Thr synonymous ANKRD27 1 82806 1.20764E-5 41403 0 3.18715E-5
19-33089081-A-G p.Thr1041Thr synonymous ANKRD27 1 82806 1.20764E-5 41403 0 NA
19-33089087-G-A p.Leu1039Leu synonymous ANKRD27 2 82824 2.41476E-5 41412 0 NA
19-33089100-G-A p.Ala1035Val missense ANKRD27 1 82856 1.20691E-5 41428 0 NA
19-33089106-G-C p.Pro1033Arg missense ANKRD27 2 82830 2.41458E-5 41415 0 1.98918E-5
19-33089106-G-A p.Pro1033Leu missense ANKRD27 1 82830 1.20729E-5 41415 0 NA
19-33089119-C-T p.Val1029Met missense ANKRD27 4 82740 4.83442E-5 41370 0 9.5645E-5
19-33089120-G-A p.Val1028Val synonymous ANKRD27 1 82756 1.20837E-5 41378 0 1.07197E-4
19-33089133-A-ACCGTGTGTCTCCGCAGCAT p.Val1024fs frameshift ANKRD27 1 82936 1.20575E-5 41468 0 3.97681E-6
19-33089135-C-T p.Thr1023Thr synonymous ANKRD27 6 82950 7.23327E-5 41475 0 7.95387E-6
19-33089136-G-A p.Thr1023Met missense ANKRD27 2 82954 2.41097E-5 41477 0 3.29647E-5
19-33089138-G-A p.His1022His synonymous ANKRD27 1 82986 1.20502E-5 41493 0 NA
19-33089140-G-A p.His1022Tyr missense ANKRD27 1 83012 1.20465E-5 41506 0 NA
19-33089145-C-T p.Arg1020Gln missense ANKRD27 1 83034 1.20433E-5 41517 0 7.15922E-5
19-33089146-G-A p.Arg1020Trp missense ANKRD27 1 83014 1.20462E-5 41507 0 1.64818E-5
19-33089154-C-A p.Arg1017Leu missense ANKRD27 1 83084 1.2036E-5 41542 0 NA
19-33089154-CGTCTGTGTCCAGGGCCA-C p.Gly1012fs frameshift ANKRD27 1 83084 1.2036E-5 41542 0 NA
19-33089155-G-A p.Arg1017Trp missense ANKRD27 18 83084 2.16648E-4 41542 0 6.6896E-4
19-33089158-T-G p.Arg1016Arg synonymous ANKRD27 3 83130 3.60881E-5 41565 0 1.27413E-4
19-33089161-G-A p.His1015Tyr missense ANKRD27 2 83122 2.4061E-5 41561 0 8.239E-6
19-33089165-A-G p.Pro1013Pro synonymous ANKRD27 1 83130 1.20294E-5 41565 0 8.23886E-6
19-33089166-G-A p.Pro1013Leu missense ANKRD27 2 83122 2.4061E-5 41561 0 1.64772E-5
19-33089169-C-A p.Gly1012Val missense ANKRD27 1 83136 1.20285E-5 41568 0 NA
19-33089188-G-T p.Pro1006Thr missense ANKRD27 1 83194 1.20201E-5 41597 0 3.98375E-6
19-33089193-T-C p.Glu1004Gly missense ANKRD27 6 83226 7.20929E-5 41613 0 4.38296E-5
19-33089202-T-G p.Asp1001Ala missense ANKRD27 1 83236 1.2014E-5 41618 0 NA
19-33089207-G-A p.Asn999Asn synonymous ANKRD27 1 83252 1.20117E-5 41626 0 NA
19-33089209-T-A p.Asn999Tyr missense ANKRD27 33 83254 3.96377E-4 41627 0 0.0020141
19-33089213-T-G p.Lys997Asn missense ANKRD27 2 83270 2.40183E-5 41635 0 NA
19-33089214-T-C p.Lys997Arg missense ANKRD27 1 83282 1.20074E-5 41641 0 NA
19-33089221-C-G p.Ala995Pro missense ANKRD27 1 83278 1.2008E-5 41639 0 3.1835E-5
19-33089226-T-A p.His993Leu missense ANKRD27 1 83284 1.20071E-5 41642 0 8.23778E-6
19-33089227-G-A p.His993Tyr missense ANKRD27 1 83280 1.20077E-5 41640 0 NA
19-33089229-G-C p.Ser992Cys missense ANKRD27 2 83276 2.40165E-5 41638 0 3.99514E-6
19-33089230-A-C p.Ser992Ala missense ANKRD27 2 83274 2.40171E-5 41637 0 8.23818E-6
19-33089234-A-G n.439T>C splice_region ANKRD27 1 83270 1.20091E-5 41635 0 NA
19-33089237-C-G p.Gln989His missense ANKRD27 1 83272 1.20088E-5 41636 0 7.99565E-6
19-33089246-C-A p.Leu986Leu synonymous ANKRD27 1 83266 1.20097E-5 41633 0 3.18471E-5
19-33089249-G-C p.Asn985Lys missense ANKRD27 1 83260 1.20106E-5 41630 0 NA
19-33089252-A-T p.Asn984Lys missense ANKRD27 139 83254 0.00166959 41627 2 0.00455559
19-33089259-C-A p.Arg982Ile missense ANKRD27 1 83232 1.20146E-5 41616 0 NA
19-33089260-TCA-T p.Leu981fs frameshift ANKRD27 11 83224 1.32173E-4 41612 1 0.00604839
19-33089267-G-A p.Val979Val synonymous ANKRD27 1 83214 1.20172E-5 41607 0 NA
19-33089271-C-T p.Ser978Asn missense ANKRD27 7 83196 8.41387E-5 41598 0 2.4051E-5
19-33089273-T-C p.Gln977Gln synonymous ANKRD27 1 83188 1.2021E-5 41594 0 8.01642E-6
19-33089281-C-G p.Gly975Arg missense ANKRD27 1 83120 1.20308E-5 41560 0 8.24674E-6
19-33090606-T-C c.2919+4A>G splice_region ANKRD27 3 83262 3.60308E-5 41631 0 2.00942E-5
19-33090627-C-T p.Glu968Lys missense ANKRD27 3 83318 3.60066E-5 41659 0 1.64951E-5
19-33090628-G-A p.Thr967Thr synonymous ANKRD27 11 83324 1.32015E-4 41662 0 1.89675E-4
19-33090640-G-A p.Val963Val synonymous ANKRD27 2 83332 2.40004E-5 41666 0 3.99294E-6
19-33090654-T-C p.Arg959Gly missense ANKRD27 1 83324 1.20013E-5 41662 0 6.25E-4
19-33090670-T-G p.Ser953Ser synonymous ANKRD27 1 83348 1.19979E-5 41674 0 NA
19-33090676-C-CT p.Thr952fs frameshift ANKRD27 2 83348 2.39958E-5 41674 1 NA
19-33090680-C-G p.Gly950Ala missense+splice_region ANKRD27 1 83350 1.19976E-5 41675 0 3.1839E-5
19-33090685-A-G c.2847-3T>C splice_region ANKRD27 2 83330 2.4001E-5 41665 0 6.36659E-5
19-33090686-A-G c.2847-4T>C splice_region ANKRD27 1 83334 1.19999E-5 41667 0 NA
19-33090871-T-C c.2846+7A>G splice_region ANKRD27 1 83164 1.20244E-5 41582 0 NA
19-33090872-A-G c.2846+6T>C splice_region ANKRD27 2 83168 2.40477E-5 41584 0 1.81133E-5
19-33090875-CACTT-C p.Lys949fs frameshift ANKRD27 3 83176 3.60681E-5 41588 0 5.40921E-5
19-33090877-C-T c.2846+1G>A splice_donor ANKRD27 3 83196 3.60594E-5 41598 0 NA
19-33090889-A-G p.Ala945Ala synonymous ANKRD27 3 83226 3.60464E-5 41613 0 1.77129E-5
19-33090891-C-G p.Ala945Pro missense ANKRD27 3 83228 3.60456E-5 41614 0 3.99818E-6
19-33090893-G-A p.Ser944Leu missense ANKRD27 3 83228 3.60456E-5 41614 0 3.1835E-5
19-33090901-A-G p.Phe941Phe synonymous ANKRD27 4 83222 4.80642E-5 41611 0 NA
19-33090904-G-A p.Tyr940Tyr synonymous ANKRD27 1 83214 1.20172E-5 41607 0 8.73271E-6
19-33090913-T-C p.Arg937Arg synonymous ANKRD27 2 83208 2.40361E-5 41604 0 NA
19-33090937-A-G p.Asp929Asp synonymous ANKRD27 1 83166 1.20241E-5 41583 0 NA
19-33090955-C-CCATTTTTT p.Trp923fs frameshift ANKRD27 2 83074 2.40749E-5 41537 0 NA
19-33090960-TAGATAAAA-T c.2768-12_2768-5delTTTTATCT splice_region ANKRD27 1 83014 1.20462E-5 41507 0 3.1837E-5
19-33090962-G-A c.2768-6C>T splice_region ANKRD27 1 82950 1.20555E-5 41475 0 4.03969E-6
19-33090964-T-A c.2768-8A>T splice_region ANKRD27 1 82916 1.20604E-5 41458 0 NA
19-33092914-C-T c.2767+7G>A splice_region ANKRD27 1 82964 1.20534E-5 41482 0 NA
19-33092939-C-T p.Val917Ile missense ANKRD27 1 83196 1.20198E-5 41598 0 NA
19-33092947-T-C p.Tyr914Cys missense ANKRD27 1 83224 1.20158E-5 41612 0 8.23737E-6
19-33092952-CT-C p.Lys912fs frameshift ANKRD27 1 83256 1.20111E-5 41628 0 NA
19-33092956-C-T p.Arg911His missense ANKRD27 35 83246 4.20441E-4 41623 0 2.86642E-4
19-33092957-G-A p.Arg911Cys missense ANKRD27 3 83254 3.60343E-5 41627 0 2.47105E-5
19-33092967-A-G p.Ala907Ala synonymous ANKRD27 1 83280 1.20077E-5 41640 0 NA
19-33092977-T-G p.Asp904Ala missense ANKRD27 3 83282 3.60222E-5 41641 0 NA
19-33092984-A-G p.Ser902Pro missense ANKRD27 1 83270 1.20091E-5 41635 0 NA
19-33092984-A-C p.Ser902Ala missense ANKRD27 1 83270 1.20091E-5 41635 0 NA
19-33092985-A-C p.Ala901Ala synonymous ANKRD27 1 83276 1.20083E-5 41638 0 3.97782E-6
19-33093003-C-T p.Val895Val synonymous ANKRD27 20 83252 2.40234E-4 41626 0 0.0014168
19-33093007-T-C p.Gln894Arg missense ANKRD27 1 83248 1.20123E-5 41624 0 NA
19-33093016-T-A p.Glu891Val missense ANKRD27 2 83206 2.40367E-5 41603 0 NA
19-33093031-T-G p.Asn886Thr missense+splice_region ANKRD27 1 83090 1.20351E-5 41545 0 4.06042E-6
19-33093035-G-GTTCAGCACAGTCTACAGCCGTGCGCTGCCGCTTGTT c.2656-4_2656-3insAACAAGCGGCAGCGCACGGCTGTAGACTGTGCTGAA splice_region ANKRD27 2 83024 2.40894E-5 41512 1 NA
19-33093035-G-A c.2656-3C>T splice_region ANKRD27 1 83024 1.20447E-5 41512 0 NA
19-33095163-A-G c.2655+6T>C splice_region ANKRD27 2 82308 2.4299E-5 41154 0 4.00683E-6
19-33095168-C-A c.2655+1G>T splice_donor ANKRD27 1 82536 1.21159E-5 41268 0 NA
19-33095175-A-G p.Ala883Ala synonymous ANKRD27 1 82732 1.20872E-5 41366 0 2.48975E-5
19-33095176-G-C p.Ala883Gly missense ANKRD27 1 82750 1.20846E-5 41375 0 8.29862E-6
19-33095176-GCA-G p.Ala883fs frameshift ANKRD27 1 82750 1.20846E-5 41375 0 3.99492E-6
19-33095183-C-T p.Asp881Asn missense ANKRD27 2 82874 2.4133E-5 41437 0 0.00151057
19-33095186-C-T p.Val880Ile missense ANKRD27 2 82924 2.41185E-5 41462 0 3.98276E-6
19-33095187-A-G p.Ala879Ala synonymous ANKRD27 1 82960 1.2054E-5 41480 0 3.1835E-5
19-33095190-C-T p.Thr878Thr synonymous ANKRD27 3 82984 3.61515E-5 41492 0 3.1841E-5
19-33095191-G-A p.Thr878Met missense ANKRD27 3 83014 3.61385E-5 41507 0 1.59195E-4
19-33095194-C-T p.Arg877His missense ANKRD27 5 83028 6.02206E-5 41514 0 0.00151057
19-33095194-C-A p.Arg877Leu missense ANKRD27 2 83028 2.40883E-5 41514 0 NA
19-33095200-C-T p.Arg875Gln missense ANKRD27 12 83126 1.44359E-4 41563 0 5.03525E-4
19-33095201-G-A p.Arg875Trp missense ANKRD27 6 83126 7.21796E-5 41563 0 7.16481E-5
19-33095203-T-C p.Lys874Arg missense ANKRD27 1 83142 1.20276E-5 41571 0 1.59166E-5
19-33095208-C-T p.Leu872Leu synonymous ANKRD27 4 83146 4.81081E-5 41573 0 8.26296E-6
19-33095213-C-T p.Val871Met missense ANKRD27 1 83144 1.20273E-5 41572 0 NA
19-33095214-C-G p.Gln870His missense ANKRD27 1 83150 1.20265E-5 41575 0 NA
19-33095217-AAC-A p.Val869fs frameshift ANKRD27 1 83140 1.20279E-5 41570 0 NA
19-33095219-C-T p.Val869Ile missense ANKRD27 4 83154 4.81035E-5 41577 0 2.48004E-5
19-33095223-C-T p.Ala867Ala synonymous ANKRD27 3 83146 3.60811E-5 41573 0 3.1837E-5
19-33095224-G-A p.Ala867Val missense ANKRD27 2 83138 2.40564E-5 41569 0 1.59166E-5
19-33095225-C-G p.Ala867Pro missense ANKRD27 2 83150 2.40529E-5 41575 0 1.65379E-5
19-33095246-C-T p.Glu860Lys missense ANKRD27 1 83218 1.20166E-5 41609 0 6.36862E-5
19-33095249-C-T p.Val859Ile missense ANKRD27 3 83214 3.60516E-5 41607 0 1.98962E-5
19-33095252-C-T p.Val858Met missense ANKRD27 2 83224 2.40315E-5 41612 0 0.00100705
19-33095252-C-G p.Val858Leu missense ANKRD27 1 83224 1.20158E-5 41612 0 NA
19-33095255-A-C p.Phe857Val missense ANKRD27 1 83234 1.20143E-5 41617 0 8.32085E-6
19-33095259-G-A p.His855His synonymous ANKRD27 3 83240 3.60404E-5 41620 0 2.58532E-4
19-33095267-C-T p.Glu853Lys missense ANKRD27 1 83240 1.20135E-5 41620 0 3.98118E-6
19-33095269-A-G p.Ile852Thr missense ANKRD27 1 83236 1.2014E-5 41618 0 4.21031E-5
19-33095277-C-CTCGTGCAGCGCTGTGTTGCCCTTATT p.Ala850fs frameshift ANKRD27 9 83248 1.08111E-4 41624 0 1.10471E-4
19-33095280-G-A p.His848His synonymous ANKRD27 1 83238 1.20137E-5 41619 0 4.2738E-5
19-33095280-G-C p.His848Gln missense ANKRD27 1 83238 1.20137E-5 41619 0 NA
19-33095287-G-A p.Ala846Val missense ANKRD27 3 83258 3.60326E-5 41629 0 6.3674E-5
19-33095288-CTG-C p.Thr845fs frameshift ANKRD27 1 83242 1.20132E-5 41621 0 7.97455E-6
19-33095289-T-C p.Thr845Thr synonymous ANKRD27 19 83244 2.28245E-4 41622 0 0.00100705
19-33095296-C-T p.Gly843Asp missense ANKRD27 1 83232 1.20146E-5 41616 0 3.18431E-5
19-33095302-T-C p.Asn841Ser missense ANKRD27 1 83236 1.2014E-5 41618 0 NA
19-33095312-C-T p.Ala838Thr missense ANKRD27 1 83226 1.20155E-5 41613 0 8.96025E-6
19-33095313-G-A p.Asn837Asn synonymous ANKRD27 661 83222 0.00794261 41611 8 0.0325
19-33095324-C-A p.Ala834Ser missense ANKRD27 3 83194 3.60603E-5 41597 0 NA
19-33095328-G-A p.His832His splice_region+synonymous ANKRD27 3 83176 3.60681E-5 41588 0 6.37024E-5
19-33095333-G-GTAGCAGCAGTGCCACAAGCTCGT c.2494-4_2494-3insACGAGCTTGTGGCACTGCTGCTA splice_region ANKRD27 2 83098 2.4068E-5 41549 1 NA
19-33095333-G-A c.2494-3C>T splice_region ANKRD27 1 83098 1.2034E-5 41549 0 NA
19-33095334-G-T c.2494-4C>A splice_region ANKRD27 2 83070 2.40761E-5 41535 0 NA
19-33095335-A-G c.2494-5T>C splice_region ANKRD27 1 83058 1.20398E-5 41529 0 3.6383E-5
19-33096747-C-T p.Leu829Leu synonymous ANKRD27 1 83324 1.20013E-5 41662 0 8.57015E-6
19-33096765-G-A p.His823His synonymous ANKRD27 2 83362 2.39917E-5 41681 0 8.38195E-5
19-33096776-C-T p.Gly820Ser missense ANKRD27 2 83360 2.39923E-5 41680 0 1.98981E-5
19-33096783-G-C p.Ala817Ala synonymous ANKRD27 1 83374 1.19941E-5 41687 0 NA
19-33096785-C-T p.Ala817Thr missense ANKRD27 1 83372 1.19944E-5 41686 0 8.27404E-6
19-33096786-G-A p.Tyr816Tyr synonymous ANKRD27 13358 82944 0.161048 41472 1225 0.221551
19-33096792-G-C p.Leu814Leu synonymous ANKRD27 1 83388 1.19921E-5 41694 0 3.97706E-6
19-33096799-G-A p.Thr812Met missense ANKRD27 5 83378 5.99679E-5 41689 0 8.24525E-6
19-33096815-C-T p.Asp807Asn missense ANKRD27 1 83384 1.19927E-5 41692 0 NA
19-33096816-C-T p.Lys806Lys synonymous ANKRD27 12000 82964 0.144641 41482 931 0.207956
19-33096816-CTTCTT-C p.Lys805fs frameshift ANKRD27 1 83384 1.19927E-5 41692 0 NA
19-33096823-T-C p.Asn804Ser missense ANKRD27 2 83392 2.39831E-5 41696 0 7.95349E-6
19-33096827-G-A p.Pro803Ser missense ANKRD27 5 83388 5.99607E-5 41694 0 3.29511E-5
19-33096837-C-T p.Ser799Ser synonymous ANKRD27 3 83398 3.59721E-5 41699 0 6.3857E-5
19-33096838-G-A p.Ser799Leu missense ANKRD27 2 83398 2.39814E-5 41699 0 6.37755E-5
19-33096849-A-G p.Cys795Cys synonymous ANKRD27 2 83396 2.3982E-5 41698 0 1.59241E-5
19-33096851-A-T p.Cys795Ser missense ANKRD27 3 83394 3.59738E-5 41697 0 8.2375E-6
19-33098535-C-T c.2373+6G>A splice_region ANKRD27 6 80080 7.49251E-5 40040 0 1.24919E-4
19-33098536-C-T c.2373+5G>A splice_region ANKRD27 3 80102 3.74522E-5 40051 0 4.07977E-6
19-33098537-G-A c.2373+4C>T splice_region ANKRD27 2 80160 2.49501E-5 40080 0 5.13853E-5
19-33098541-C-G p.Gln791His missense+splice_region ANKRD27 2 80366 2.48861E-5 40183 0 NA
19-33098542-T-C p.Gln791Arg missense+splice_region ANKRD27 1 80408 1.24366E-5 40204 0 9.98183E-6
19-33098554-T-C p.Gln787Arg missense ANKRD27 1 80822 1.23729E-5 40411 0 NA
19-33098558-G-A p.Gln786* stop_gained ANKRD27 1 80964 1.23512E-5 40482 0 3.18613E-5
19-33098563-G-C p.Ala784Gly missense ANKRD27 2 81058 2.46737E-5 40529 0 NA
19-33098574-C-T p.Pro780Pro synonymous ANKRD27 1 81234 1.23101E-5 40617 0 8.11293E-6
19-33098575-G-A p.Pro780Leu missense ANKRD27 6 81332 7.37717E-5 40666 0 9.31012E-5
19-33098579-C-T p.Val779Ile missense ANKRD27 1 81400 1.2285E-5 40700 0 3.19E-5
19-33098580-G-A p.Ala778Ala synonymous ANKRD27 3 81444 3.68351E-5 40722 0 3.18939E-5
19-33098584-T-C p.Gln777Arg missense ANKRD27 2 81546 2.4526E-5 40773 0 NA
19-33098586-G-A p.Asp776Asp synonymous ANKRD27 87 81570 0.00106657 40785 0 0.00226345
19-33098589-T-C p.Ala775Ala synonymous ANKRD27 1 81596 1.22555E-5 40798 0 NA
19-33098591-C-T p.Ala775Thr missense ANKRD27 5 81548 6.13136E-5 40774 0 1.0077E-4
19-33098593-T-A p.Asn774Ile missense ANKRD27 2 81606 2.4508E-5 40803 0 NA
19-33098600-C-G p.Ala772Pro missense ANKRD27 1 81682 1.22426E-5 40841 0 9.0848E-6
19-33098607-G-A p.Asn769Asn synonymous ANKRD27 2 81750 2.44648E-5 40875 0 1.09242E-4
19-33098607-G-T p.Asn769Lys missense ANKRD27 1 81750 1.22324E-5 40875 0 NA
19-33098608-T-C p.Asn769Ser missense ANKRD27 1 81762 1.22306E-5 40881 0 NA
19-33098609-T-C p.Asn769Asp missense ANKRD27 2 81766 2.446E-5 40883 0 3.18979E-5
19-33098610-G-C p.Ala768Ala synonymous ANKRD27 1 81760 1.22309E-5 40880 0 NA
19-33098615-C-T p.Gly767Arg missense ANKRD27 2 81794 2.44517E-5 40897 0 6.25E-4
19-33098616-G-A p.His766His synonymous ANKRD27 6 81760 7.33855E-5 40880 0 3.18959E-5
19-33098619-C-A p.Lys765Asn missense ANKRD27 9 81782 1.10049E-4 40891 0 3.50832E-4
19-33098627-G-T p.Leu763Met missense ANKRD27 1 81804 1.22243E-5 40902 0 4.04586E-6
19-33098632-G-C p.Pro761Arg missense ANKRD27 37500 81158 0.462062 40579 9575 0.438436
19-33098632-GG-CA p.Pro761Cys missense ANKRD27 2 81802 2.44493E-5 40901 0 NA
19-33098632-G-A p.Pro761Leu missense ANKRD27 1 81802 1.22246E-5 40901 0 NA
19-33098632-G-T p.Pro761His missense ANKRD27 2 81802 2.44493E-5 40901 0 8.76363E-6
19-33098640-G-A p.Asp758Asp synonymous ANKRD27 3 81750 3.66972E-5 40875 0 NA
19-33098642-C-T p.Asp758Asn missense ANKRD27 1 81746 1.2233E-5 40873 0 3.19E-5
19-33098643-C-T p.Ala757Ala synonymous ANKRD27 93 81750 0.00113761 40875 0 7.9184E-4
19-33098644-G-A p.Ala757Val missense ANKRD27 14 81736 1.71283E-4 40868 0 3.18939E-5
19-33098647-C-T p.Arg756Gln missense ANKRD27 1 81696 1.22405E-5 40848 0 1.21823E-5
19-33098648-G-A p.Arg756Trp missense ANKRD27 14 81710 1.71338E-4 40855 0 0.0014209
19-33098651-C-T p.Gly755Ser missense ANKRD27 2 81704 2.44786E-5 40852 0 2.75416E-5
19-33098652-G-A p.His754His synonymous ANKRD27 3 81712 3.67143E-5 40856 0 1.46306E-4
19-33098653-T-C p.His754Arg missense ANKRD27 8 81682 9.79408E-5 40841 0 3.82848E-4
19-33098653-T-A p.His754Leu missense ANKRD27 1 81682 1.22426E-5 40841 0 NA
19-33098659-G-A p.Ala752Val missense ANKRD27 1 81744 1.22333E-5 40872 0 3.18898E-5
19-33098660-C-T p.Ala752Thr missense ANKRD27 2 81700 2.44798E-5 40850 0 1.2181E-5
19-33098660-C-G p.Ala752Pro missense ANKRD27 3 81700 3.67197E-5 40850 0 NA
19-33098660-C-A p.Ala752Ser missense ANKRD27 7 81700 8.56793E-5 40850 0 0.0010142
19-33098663-C-T p.Ala751Thr missense ANKRD27 1 81704 1.22393E-5 40852 0 5.06586E-4
19-33098664-G-A p.Val750Val synonymous ANKRD27 2 81728 2.44714E-5 40864 0 5.06586E-4
19-33098668-T-C p.His749Arg missense ANKRD27 1 81726 1.2236E-5 40863 0 NA
19-33098672-G-A p.Leu748Leu synonymous ANKRD27 4 81680 4.89716E-5 40840 0 4.0662E-6
19-33098673-C-T p.Pro747Pro synonymous ANKRD27 1 81642 1.22486E-5 40821 0 9.5706E-5
19-33098674-G-A p.Pro747Leu missense ANKRD27 6 81708 7.34322E-5 40854 0 1.27584E-4
19-33098674-G-C p.Pro747Arg missense ANKRD27 1 81708 1.22387E-5 40854 0 NA
19-33098677-G-A p.Ser746Phe missense ANKRD27 1 81660 1.22459E-5 40830 0 4.07017E-6
19-33098678-A-C p.Ser746Ala missense ANKRD27 2 81608 2.45074E-5 40804 0 1.59541E-4
19-33098684-C-T p.Gly744Ser missense ANKRD27 1 81500 1.22699E-5 40750 0 5.07099E-4
19-33098685-G-A p.Asp743Asp synonymous ANKRD27 2 81492 2.45423E-5 40746 0 1.27665E-4
19-33098689-T-C p.Gln742Arg missense ANKRD27 2 81486 2.45441E-5 40743 0 4.10772E-6
19-33098692-C-T p.Ser741Asn missense ANKRD27 23 81414 2.82507E-4 40707 0 0.0025
19-33098700-G-A p.Asn738Asn synonymous ANKRD27 1 81210 1.23138E-5 40605 0 6.25E-4
19-33098702-T-A p.Asn738Tyr missense ANKRD27 1 81110 1.23289E-5 40555 0 NA
19-33098712-C-T p.Gly734Gly synonymous ANKRD27 1 81168 1.23201E-5 40584 0 NA
19-33098715-A-G p.Ser733Ser synonymous ANKRD27 39 81022 4.81351E-4 40511 0 0.00375
19-33098729-T-C p.Lys729Glu missense ANKRD27 12 80088 1.49835E-4 40044 0 0.0133333
19-33098730-C-T p.Ala728Ala synonymous ANKRD27 3 80488 3.72726E-5 40244 0 3.18695E-5
19-33098731-G-A p.Ala728Val missense ANKRD27 1 80212 1.2467E-5 40106 0 NA
19-33098733-C-A p.Leu727Leu synonymous ANKRD27 1 81262 1.23059E-5 40631 0 NA
19-33106576-G-A p.Ala721Ala synonymous ANKRD27 2 83398 2.39814E-5 41699 0 8.23669E-6
19-33106600-C-T p.Pro713Pro synonymous ANKRD27 921 83384 0.0110453 41692 23 0.0182484
19-33106601-G-A p.Pro713Leu missense ANKRD27 3 83400 3.59712E-5 41700 0 6.25E-4
19-33106607-C-G p.Cys711Ser missense ANKRD27 1 83400 1.19904E-5 41700 0 3.1835E-5
19-33106614-C-T p.Glu709Lys missense ANKRD27 1 83392 1.19916E-5 41696 0 6.76014E-5
19-33106615-G-A p.Pro708Pro synonymous ANKRD27 10 83386 1.19924E-4 41693 0 6.25E-4
19-33106618-G-A p.Asp707Asp synonymous ANKRD27 10 83382 1.1993E-4 41691 0 9.55353E-5
19-33106618-G-T p.Asp707Glu missense ANKRD27 4 83382 4.7972E-5 41691 0 1.91071E-4
19-33106621-C-T p.Ala706Ala synonymous ANKRD27 51134 82142 0.622507 41071 16247 0.608258
19-33106622-G-A p.Ala706Val missense ANKRD27 1 83384 1.19927E-5 41692 0 5.03525E-4
19-33106628-C-A p.Ser704Ile missense ANKRD27 1 83396 1.1991E-5 41698 0 NA
19-33106633-A-G p.Thr702Thr synonymous ANKRD27 37 83398 4.43656E-4 41699 0 5.03525E-4
19-33106642-C-T p.Ala699Ala synonymous ANKRD27 14 83388 1.6789E-4 41694 0 4.33562E-4
19-33106642-C-G p.Ala699Ala synonymous ANKRD27 1 83388 1.19921E-5 41694 0 3.97763E-6
19-33106644-C-T p.Ala699Thr missense ANKRD27 1 83386 1.19924E-5 41693 0 NA
19-33106648-C-A p.Glu697Asp missense ANKRD27 2 83380 2.39866E-5 41690 0 8.24375E-6
19-33106671-C-G p.Glu690Gln missense ANKRD27 1 83368 1.1995E-5 41684 0 NA
19-33106673-A-G p.Leu689Ser missense ANKRD27 1 83368 1.1995E-5 41684 0 NA
19-33106682-C-T p.Arg686His missense ANKRD27 7 83354 8.39792E-5 41677 0 6.37389E-5
19-33106683-G-A p.Arg686Cys missense ANKRD27 3 83350 3.59928E-5 41675 0 3.3129E-5
19-33106686-C-CCATTTCTAGATCTCCATCAGCAA c.2053-1_2053insTTGCTGATGGAGATCTAGAAATG splice_acceptor ANKRD27 1 83340 1.1999E-5 41670 0 NA
19-33106686-C-A p.Val685Leu missense+splice_region ANKRD27 3 83340 3.59971E-5 41670 0 8.2905E-6
19-33106694-T-G c.2053-8A>C splice_region ANKRD27 1 83300 1.20048E-5 41650 0 1.66301E-5
19-33108517-A-T p.Val677Asp missense ANKRD27 3 64462 4.6539E-5 32231 0 4.19808E-5
19-33110166-C-T p.Glu669Glu splice_region+synonymous ANKRD27 1 81604 1.22543E-5 40802 0 NA
19-33110167-TC-AG p.Glu669Leu missense+splice_region ANKRD27 1 81618 1.22522E-5 40809 0 NA
19-33110177-CCTT-C p.Lys665del conservative_inframe_deletion ANKRD27 1 81952 1.22023E-5 40976 0 NA
19-33110184-G-A p.Thr663Thr synonymous ANKRD27 3 82142 3.65221E-5 41071 0 6.37146E-5
19-33110193-C-T p.Gln660Gln synonymous ANKRD27 1 82344 1.21442E-5 41172 0 NA
19-33110203-C-G p.Ser657Thr missense ANKRD27 1 82352 1.2143E-5 41176 0 NA
19-33110204-T-C p.Ser657Gly missense ANKRD27 42528 80544 0.52801 40272 11523 0.533391
19-33110204-TG-CA p.AlaSer656AlaGly missense ANKRD27 2 82380 2.42777E-5 41190 0 NA
19-33110204-TGG-CTA p.AlaSer656ValGly missense ANKRD27 1 82380 1.21389E-5 41190 0 NA
19-33110205-G-A p.Ala656Ala synonymous ANKRD27 2 82390 2.42748E-5 41195 0 0.003125
19-33110217-G-A p.Ser652Ser synonymous ANKRD27 1 82558 1.21127E-5 41279 0 7.95957E-6
19-33110227-G-A p.Ser649Phe missense ANKRD27 1 82616 1.21042E-5 41308 0 5.03525E-4
19-33110249-T-TG p.Ile642fs frameshift ANKRD27 1 82642 1.21004E-5 41321 0 4.12025E-5
19-33110259-G-A p.Ser638Ser synonymous ANKRD27 593 82548 0.0071837 41274 11 0.0141146
19-33110260-G-A p.Ser638Phe missense ANKRD27 5 82580 6.05473E-5 41290 0 1.91156E-4
19-33110263-C-A p.Arg637Leu missense ANKRD27 7 82520 8.48279E-5 41260 0 2.7918E-5
19-33110264-G-A p.Arg637Cys missense ANKRD27 13 82560 1.57461E-4 41280 0 9.06678E-5
19-33110268-C-A p.Pro635Pro synonymous ANKRD27 2 82594 2.42148E-5 41297 0 NA
19-33110269-G-A p.Pro635Leu missense ANKRD27 1 82650 1.20992E-5 41325 0 6.25E-4
19-33110284-GCCTGCAGCCAAGGAGCCCCAACGAGAGAGAGGACAGGACACAAGGACACGTGAGGACCAGAGAAGGCGCCCTTGGTCTCCAAGGTAACCTGACCTGCTCAGCCCGGCTGACTTA-G p.Ala630fs frameshift ANKRD27 5 82720 6.04449E-5 41360 0 NA
19-33110284-G-A p.Ala630Val missense+splice_region ANKRD27 1 82722 1.20887E-5 41361 0 NA
19-33110285-C-A p.Ala630Ser missense+splice_region ANKRD27 3 82714 3.62696E-5 41357 0 8.24416E-6
19-33110289-C-G c.1888-4G>C splice_region ANKRD27 5 82734 6.04346E-5 41367 0 9.55779E-5
19-33110396-T-G c.1887+4A>C splice_region ANKRD27 19 83146 2.28514E-4 41573 0 8.35455E-5
19-33110402-C-T p.Glu629Lys missense+splice_region ANKRD27 9 83160 1.08225E-4 41580 0 6.37389E-5
19-33110403-G-A p.Ser628Ser synonymous ANKRD27 3 83176 3.60681E-5 41588 0 6.37227E-5
19-33110404-G-A p.Ser628Phe missense ANKRD27 62 83168 7.45479E-4 41584 0 6.69088E-4
19-33110407-G-A p.Ser627Leu missense ANKRD27 7 83162 8.41731E-5 41581 0 7.16082E-5
19-33110408-A-T p.Ser627Thr missense ANKRD27 4 83170 4.80943E-5 41585 0 2.78452E-5
19-33110424-G-A p.Phe621Phe synonymous ANKRD27 5 83150 6.01323E-5 41575 0 4.95597E-5
19-33110428-G-C p.Ser620Cys missense ANKRD27 1 83136 1.20285E-5 41568 0 NA
19-33110429-A-T p.Ser620Thr missense ANKRD27 1 83138 1.20282E-5 41569 0 NA
19-33110436-A-G p.Tyr617Tyr synonymous ANKRD27 1 83070 1.2038E-5 41535 0 NA
19-33110455-A-G p.Leu611Pro missense ANKRD27 1 82872 1.20668E-5 41436 0 NA
19-33110456-G-C p.Leu611Val missense ANKRD27 1 82852 1.20697E-5 41426 0 NA
19-33110462-A-AG c.1828-4_1828-3insC splice_region ANKRD27 3 82694 3.62783E-5 41347 0 8.3706E-5
19-33113331-T-C p.Ser608Ser synonymous ANKRD27 1 82604 1.2106E-5 41302 0 NA
19-33113335-T-A p.Asn607Ile missense ANKRD27 1 82674 1.20957E-5 41337 0 1.19848E-5
19-33113344-C-A p.Cys604Phe missense ANKRD27 1 82818 1.20747E-5 41409 0 3.98928E-6
19-33113344-C-T p.Cys604Tyr missense ANKRD27 4 82818 4.82987E-5 41409 0 0.0025
19-33113355-C-T p.Thr600Thr synonymous ANKRD27 3 83002 3.61437E-5 41501 0 5.03525E-4
19-33113355-C-A p.Thr600Thr synonymous ANKRD27 3 83002 3.61437E-5 41501 0 NA
19-33113356-G-A p.Thr600Met missense ANKRD27 4 83046 4.81661E-5 41523 0 2.47129E-5
19-33113381-C-T p.Glu592Lys missense ANKRD27 2 83216 2.40338E-5 41608 0 8.23778E-6
19-33113382-G-A p.Thr591Thr synonymous ANKRD27 3 83220 3.6049E-5 41610 0 2.07119E-4
19-33113388-C-T p.Ala589Ala synonymous ANKRD27 1 83256 1.20111E-5 41628 0 5.76644E-5
19-33113389-G-A p.Ala589Val missense ANKRD27 17 83232 2.04248E-4 41616 0 2.88322E-4
19-33113393-C-T p.Gly588Arg missense ANKRD27 1 83272 1.20088E-5 41636 0 1.59218E-5
19-33113394-G-A p.Asn587Asn synonymous ANKRD27 20 83288 2.40131E-4 41644 0 6.80592E-4
19-33113426-A-G p.Tyr577His missense ANKRD27 1 83350 1.19976E-5 41675 0 NA
19-33113428-C-A p.Gly576Val missense ANKRD27 1 83342 1.19988E-5 41671 0 3.97674E-6
19-33113434-C-T p.Arg574His missense ANKRD27 10 83336 1.19996E-4 41668 0 1.27486E-4
19-33113437-G-A p.Ala573Val missense ANKRD27 1 83340 1.1999E-5 41670 0 3.295E-5
19-33113446-T-C p.His570Arg missense ANKRD27 1 83352 1.19973E-5 41676 0 8.23737E-6
19-33113447-G-A p.His570Tyr missense ANKRD27 2 83358 2.39929E-5 41679 0 7.9533E-6
19-33113451-AG-A p.Pro568fs frameshift ANKRD27 1 83356 1.19967E-5 41678 0 8.23737E-6
19-33113453-G-C p.Pro568Ala missense ANKRD27 1 83356 1.19967E-5 41678 0 8.23764E-6
19-33113477-T-C p.Ile560Val missense ANKRD27 1 83332 1.20002E-5 41666 0 3.18715E-5
19-33113483-G-A p.Leu558Phe missense ANKRD27 1 83330 1.20005E-5 41665 0 7.95355E-6
19-33113487-G-A p.Cys556Cys synonymous ANKRD27 3 83308 3.60109E-5 41654 0 NA
19-33113496-C-T p.Val553Val synonymous ANKRD27 4 83290 4.8025E-5 41645 0 3.18674E-5
19-33113498-C-T p.Val553Met missense ANKRD27 4 83266 4.80388E-5 41633 0 5.03525E-4
19-33113503-T-C p.Tyr551Cys missense ANKRD27 1 83216 1.20169E-5 41608 0 NA
19-33113504-A-G p.Tyr551His missense ANKRD27 1 83214 1.20172E-5 41607 0 NA
19-33113506-T-C p.Tyr550Cys missense ANKRD27 2 83190 2.40414E-5 41595 0 NA
19-33113514-A-G p.Ala547Ala synonymous ANKRD27 4 83092 4.81394E-5 41546 0 3.97848E-6
19-33113523-A-G p.Cys544Cys splice_region+synonymous ANKRD27 1 82990 1.20496E-5 41495 0 6.5962E-5
19-33116773-C-T c.1629+7G>A splice_region ANKRD27 3 81136 3.6975E-5 40568 0 1.63004E-5
19-33116780-G-A p.Asp543Asp splice_region+synonymous ANKRD27 8 81278 9.84276E-5 40639 0 0.00100908
19-33116785-C-T p.Glu542Lys missense ANKRD27 1 81440 1.2279E-5 40720 0 8.68734E-6
19-33116791-C-T p.Gly540Ser missense ANKRD27 1 81550 1.22624E-5 40775 0 NA
19-33116792-G-A p.Tyr539Tyr synonymous ANKRD27 1 81602 1.22546E-5 40801 0 3.78797E-5
19-33116798-G-T p.Cys537* stop_gained ANKRD27 1 81656 1.22465E-5 40828 0 4.14879E-6
19-33116816-C-A p.Thr531Thr synonymous ANKRD27 1 81668 1.22447E-5 40834 0 NA
19-33116817-G-A p.Thr531Met missense ANKRD27 8 81726 9.78881E-5 40863 0 0.00100908
19-33116827-T-A p.Asn528Tyr missense ANKRD27 2 81698 2.44804E-5 40849 0 4.06124E-6
19-33116837-C-T p.Val524Val synonymous ANKRD27 1 81532 1.22651E-5 40766 0 2.02827E-5
19-33116842-C-G p.Glu523Gln missense ANKRD27 2 81472 2.45483E-5 40736 0 6.36902E-5
19-33116843-C-T p.Ala522Ala synonymous ANKRD27 2 81420 2.4564E-5 40710 0 1.02126E-4
19-33116844-G-A p.Ala522Val missense ANKRD27 5 81370 6.14477E-5 40685 0 5.11457E-5
19-33116845-C-A p.Ala522Ser missense ANKRD27 5 81326 6.1481E-5 40663 0 4.10164E-5
19-33116845-C-T p.Ala522Thr missense ANKRD27 2 81326 2.45924E-5 40663 0 2.05082E-5
19-33116846-G-A p.Ser521Ser synonymous ANKRD27 1 81316 1.22977E-5 40658 0 3.27129E-5
19-33116849-G-A p.Ala520Ala synonymous ANKRD27 50 81252 6.15369E-4 40626 0 0.00152866
19-33116859-TGCA-T p.Leu516del disruptive_inframe_deletion ANKRD27 2 80686 2.47874E-5 40343 0 8.14511E-4
19-33116859-T-C p.His517Arg missense ANKRD27 1 80872 1.23652E-5 40436 0 NA
19-33116870-C-T p.Leu513Leu splice_region+synonymous ANKRD27 1 80546 1.24153E-5 40273 0 NA
19-33116873-C-CG c.1537-2_1537-1insC splice_acceptor ANKRD27 4 80376 4.97661E-5 40188 1 NA
19-33116877-G-A c.1537-5C>T splice_region ANKRD27 1 80054 1.24916E-5 40027 0 3.71287E-5
19-33117623-C-T p.Val511Met missense ANKRD27 3 82570 3.63328E-5 41285 0 3.18552E-5
19-33117624-G-A p.Ser510Ser synonymous ANKRD27 7 82556 8.47909E-5 41278 0 1.63021E-4
19-33117634-C-A p.Gly507Val missense ANKRD27 1 82680 1.20948E-5 41340 0 1.29921E-5
19-33117639-C-T p.Gln505Gln synonymous ANKRD27 1 82692 1.20931E-5 41346 0 NA
19-33117651-G-A p.His501His synonymous ANKRD27 2 82734 2.41739E-5 41367 0 5.05051E-4
19-33117657-C-T p.Pro499Pro synonymous ANKRD27 41 82722 4.95636E-4 41361 1 5.05051E-4
19-33117658-G-A p.Pro499Leu missense ANKRD27 1 82760 1.20831E-5 41380 0 1.59286E-4
19-33117666-T-C p.Gly496Gly synonymous ANKRD27 52717 81836 0.644179 40918 17115 0.645536
19-33117680-T-C p.Thr492Ala missense ANKRD27 2 82664 2.41943E-5 41332 0 NA
19-33117684-A-G p.Asn490Asn synonymous ANKRD27 1 82652 1.20989E-5 41326 0 NA
19-33117695-C-T p.Ala487Thr missense ANKRD27 26 82486 3.15205E-4 41243 0 5.45402E-4
19-33117696-G-A p.Gly486Gly synonymous ANKRD27 2 82452 2.42565E-5 41226 0 0.00100806
19-33117699-C-G p.Lys485Asn missense ANKRD27 2 82474 2.42501E-5 41237 0 4.05703E-6
19-33117700-T-C p.Lys485Arg missense ANKRD27 12 82450 1.45543E-4 41225 1 6.25E-4
19-33117713-G-A p.Leu481Phe missense ANKRD27 1 82194 1.21663E-5 41097 0 1.64068E-5
19-33117717-G-A p.Ile479Ile synonymous ANKRD27 1 82074 1.21841E-5 41037 0 5.04032E-4
19-33117722-G-C p.Leu478Val missense ANKRD27 2 81936 2.44093E-5 40968 0 1.16902E-5
19-33117730-T-C p.Gln475Arg missense ANKRD27 3 81672 3.67323E-5 40836 0 4.18915E-6
19-33117735-T-C c.1421-2A>G splice_acceptor ANKRD27 2 81480 2.45459E-5 40740 0 NA
19-33117740-A-C c.1421-7T>G splice_region ANKRD27 2 81300 2.46002E-5 40650 0 NA
19-33117741-G-C c.1421-8C>G splice_region ANKRD27 1 81252 1.23074E-5 40626 0 NA
19-33118984-C-T c.1420+5G>A splice_region ANKRD27 1 83072 1.20378E-5 41536 0 1.65158E-5
19-33118985-A-G c.1420+4T>C splice_region ANKRD27 3 83088 3.61063E-5 41544 0 8.25587E-5
19-33118988-C-T c.1420+1G>A splice_donor ANKRD27 3 83132 3.60872E-5 41566 0 1.65085E-5
19-33118992-A-G p.Cys473Arg missense ANKRD27 1 83144 1.20273E-5 41572 0 3.18492E-5
19-33118992-AGACAGC-A p.Ala471_Val472del conservative_inframe_deletion ANKRD27 1 83144 1.20273E-5 41572 0 3.97931E-6
19-33118994-A-G p.Val472Ala missense ANKRD27 1 83136 1.20285E-5 41568 0 NA
19-33119013-G-A p.Pro466Ser missense ANKRD27 2 83258 2.40217E-5 41629 0 NA
19-33119018-T-C p.His464Arg missense ANKRD27 1 83272 1.20088E-5 41636 0 3.97716E-6
19-33119019-G-GC p.His464fs frameshift ANKRD27 1 83276 1.20083E-5 41638 0 3.1841E-5
19-33119019-G-T p.His464Asn missense ANKRD27 1 83276 1.20083E-5 41638 0 NA
19-33119028-C-A p.Asp461Tyr missense ANKRD27 1 83288 1.20065E-5 41644 0 8.24294E-6
19-33119028-C-T p.Asp461Asn missense ANKRD27 2 83288 2.40131E-5 41644 0 1.59081E-5
19-33119029-G-A p.Asp460Asp synonymous ANKRD27 11 83280 1.32085E-4 41640 0 6.25E-4
19-33119074-A-T c.1338-3T>A splice_region ANKRD27 2 83084 2.4072E-5 41542 0 2.48604E-5
19-33119628-C-T p.Gly446Glu missense+splice_region ANKRD27 2 83366 2.39906E-5 41683 0 NA
19-33119629-CAG-C p.Ser445fs frameshift ANKRD27 1 83362 1.19959E-5 41681 0 NA
19-33119635-C-T p.Val444Ile missense ANKRD27 9 83376 1.07945E-4 41688 0 3.18532E-5
19-33119636-G-A p.Leu443Leu synonymous ANKRD27 27 83378 3.23826E-4 41689 0 6.25E-4
19-33119643-T-C p.Glu441Gly missense ANKRD27 3 83384 3.59781E-5 41692 0 1.19302E-5
19-33119653-C-T p.Asp438Asn missense ANKRD27 26 83386 3.11803E-4 41693 0 0.00149133
19-33119676-A-G p.Met430Thr missense ANKRD27 1 83404 1.19898E-5 41702 0 1.64731E-5
19-33119686-C-T p.Val427Ile missense ANKRD27 7 83406 8.39268E-5 41703 0 4.94193E-5
19-33119687-G-T p.Thr426Thr synonymous ANKRD27 56 83404 6.71431E-4 41702 0 0.0040282
19-33119702-G-A p.Asp421Asp synonymous ANKRD27 1 83418 1.19878E-5 41709 0 3.18451E-5
19-33119715-A-G p.Leu417Pro missense ANKRD27 4 83424 4.79478E-5 41712 0 1.59057E-5
19-33119727-A-G p.Val413Ala missense ANKRD27 10 83416 1.19881E-4 41708 0 0.00107073
19-33119734-T-A p.Lys411* stop_gained ANKRD27 1 83418 1.19878E-5 41709 0 NA
19-33119742-C-T p.Gly408Asp missense ANKRD27 152 83414 0.00182224 41707 0 0.0025
19-33119747-T-C p.Ala406Ala synonymous ANKRD27 2 83414 2.39768E-5 41707 0 NA
19-33119751-A-G p.Ile405Thr missense ANKRD27 1 83414 1.19884E-5 41707 0 1.6475E-5
19-33122300-T-C c.1209+8A>G splice_region ANKRD27 2 83244 2.40258E-5 41622 0 6.36821E-5
19-33122302-T-A c.1209+6A>T splice_region ANKRD27 1 83244 1.20129E-5 41622 0 NA
19-33122310-T-C p.Lys403Glu missense+splice_region ANKRD27 1 83296 1.20054E-5 41648 0 NA
19-33122314-C-T p.Leu401Leu synonymous ANKRD27 3 83308 3.60109E-5 41654 0 3.1839E-5
19-33122316-G-A p.Leu401Leu synonymous ANKRD27 2 83308 2.40073E-5 41654 0 9.55536E-5
19-33122322-C-T p.Asp399Asn missense ANKRD27 7 83328 8.40054E-5 41664 0 1.98844E-5
19-33122323-G-A p.Thr398Thr synonymous ANKRD27 1 83330 1.20005E-5 41665 0 3.29478E-5
19-33122332-C-T p.Ser395Ser synonymous ANKRD27 4 83334 4.79996E-5 41667 0 7.15791E-5
19-33122345-G-A p.Ser391Phe missense ANKRD27 1 83348 1.19979E-5 41674 0 NA
19-33122349-G-C p.Leu390Val missense ANKRD27 1 83338 1.19993E-5 41669 0 8.23764E-6
19-33122352-A-G p.Leu389Leu synonymous ANKRD27 2 83344 2.39969E-5 41672 0 3.97655E-6
19-33122360-C-G p.Arg386Thr missense ANKRD27 2 83348 2.39958E-5 41674 0 3.18492E-5
19-33122375-AGCCT-A p.Arg380fs frameshift ANKRD27 1 83336 1.19996E-5 41668 0 NA
19-33122376-GC-G p.Arg380fs frameshift ANKRD27 2 83324 2.40027E-5 41662 0 NA
19-33122379-TGT-AGA p.AspArg379ValTrp missense ANKRD27 1 83324 1.20013E-5 41662 0 NA
19-33122379-T-A p.Arg380Trp missense ANKRD27 1 83324 1.20013E-5 41662 0 NA
19-33122381-T-A p.Asp379Val missense ANKRD27 1 83316 1.20025E-5 41658 0 NA
19-33122398-C-T p.Glu373Glu splice_region+synonymous ANKRD27 2 83248 2.40246E-5 41624 0 3.97988E-6
19-33122401-C-T c.1117-1G>A splice_acceptor ANKRD27 1 83216 1.20169E-5 41608 0 1.19423E-5
19-33122406-G-A c.1117-6C>T splice_region ANKRD27 3 83192 3.60612E-5 41596 0 6.25E-4
19-33130220-T-A p.Ser386Ser synonymous ANKRD27 2 83140 2.40558E-5 41570 0 8.32168E-6
19-33130222-A-G p.Ser386Pro missense ANKRD27 1 83146 1.2027E-5 41573 0 NA
19-33130224-G-A p.Ala385Val missense ANKRD27 2 83164 2.40489E-5 41582 0 1.9945E-5
19-33130228-A-C p.Trp384Gly missense ANKRD27 1 83190 1.20207E-5 41595 0 NA
19-33130229-C-T p.Leu383Leu synonymous ANKRD27 1 83196 1.20198E-5 41598 0 NA
19-33130238-G-C p.Gly380Gly synonymous ANKRD27 1 83244 1.20129E-5 41622 0 8.26433E-6
19-33130240-C-T p.Gly380Ser missense ANKRD27 1 83244 1.20129E-5 41622 0 6.36821E-5
19-33130241-A-G p.Pro379Pro synonymous ANKRD27 1 83252 1.20117E-5 41626 0 NA
19-33130244-G-C p.Cys378Trp missense ANKRD27 1 83268 1.20094E-5 41634 0 3.1839E-5
19-33130251-T-G p.His376Pro missense ANKRD27 1 83298 1.20051E-5 41649 0 3.97801E-6
19-33130254-G-A p.Ser375Phe missense ANKRD27 1 83312 1.20031E-5 41656 0 7.95482E-6
19-33130266-G-C p.Pro371Arg missense ANKRD27 7 83350 8.39832E-5 41675 0 2.86551E-4
19-33130267-G-T p.Pro371Thr missense ANKRD27 1 83352 1.19973E-5 41676 0 4.12045E-5
19-33130280-GC-G p.Ser366fs frameshift ANKRD27 1 83352 1.19973E-5 41676 0 2.47154E-5
19-33130288-G-C p.Gln364Glu missense ANKRD27 1 83356 1.19967E-5 41678 0 NA
19-33130290-C-T p.Arg363Gln missense ANKRD27 2 83360 2.39923E-5 41680 0 6.37064E-5
19-33130298-T-C p.Glu360Glu synonymous ANKRD27 1 83370 1.19947E-5 41685 0 8.2371E-6
19-33130313-G-A p.Phe355Phe synonymous ANKRD27 1 83366 1.19953E-5 41683 0 2.47105E-5
19-33130326-C-T p.Cys351Tyr missense ANKRD27 1 83362 1.19959E-5 41681 0 NA
19-33130343-C-G p.Lys345Asn missense ANKRD27 1 83366 1.19953E-5 41683 0 3.18431E-5
19-33130353-C-T p.Ser342Asn missense ANKRD27 1 83368 1.1995E-5 41684 0 NA
19-33130361-C-A p.Arg339Ser missense ANKRD27 1 83374 1.19941E-5 41687 0 3.98381E-6
19-33130364-G-A p.Phe338Phe synonymous ANKRD27 1 83370 1.19947E-5 41685 0 NA
19-33130372-TG-T p.Asn337fs frameshift ANKRD27 1 83364 1.19956E-5 41682 0 NA
19-33130373-G-A p.Ile335Ile synonymous ANKRD27 1 83362 1.19959E-5 41681 0 NA
19-33130374-A-G p.Ile335Thr missense ANKRD27 4 83366 4.79812E-5 41683 0 1.59622E-5
19-33130376-G-A p.Tyr334Tyr synonymous ANKRD27 52 83364 6.2377E-4 41682 0 0.00197515
19-33130394-C-A p.Trp328Cys missense+splice_region ANKRD27 1 83348 1.19979E-5 41674 0 6.36821E-5
19-33130399-T-C c.984-5A>G splice_region ANKRD27 1 83332 1.20002E-5 41666 0 NA
19-33131208-G-C c.983+5C>G splice_region ANKRD27 1 83048 1.20412E-5 41524 0 1.64932E-5
19-33131227-C-T p.Thr323Thr synonymous ANKRD27 2512 83170 0.0302032 41585 230 0.064328
19-33131244-A-G p.Tyr318His missense ANKRD27 2 83288 2.40131E-5 41644 0 6.25E-4
19-33131248-C-T p.Leu316Leu synonymous ANKRD27 1 83296 1.20054E-5 41648 0 1.64739E-5
19-33131254-T-G p.Ser314Ser synonymous ANKRD27 3 83300 3.60144E-5 41650 0 2.78388E-5
19-33131261-A-G p.Leu312Pro missense ANKRD27 1 83308 1.20036E-5 41654 0 1.59205E-4
19-33131267-T-C p.Asp310Gly missense ANKRD27 1 83306 1.20039E-5 41653 0 NA
19-33131268-C-G p.Asp310His missense ANKRD27 1 83304 1.20042E-5 41652 0 3.97684E-6
19-33131278-G-C p.Thr306Thr synonymous ANKRD27 3 83276 3.60248E-5 41638 0 6.36821E-5
19-33131279-G-T p.Thr306Asn missense ANKRD27 2 83266 2.40194E-5 41633 0 NA
19-33131288-T-C p.Asn303Ser missense ANKRD27 1 83228 1.20152E-5 41614 0 NA
19-33131295-C-A c.905-4G>T splice_region ANKRD27 169 83166 0.00203208 41583 1 0.00321615
19-33132922-G-A c.904+8C>T splice_region ANKRD27 2 82768 2.41639E-5 41384 0 1.27459E-5
19-33132923-C-A c.904+7G>T splice_region ANKRD27 5 82784 6.03981E-5 41392 0 2.11958E-5
19-33132928-A-G c.904+2T>C splice_donor ANKRD27 1 82854 1.20694E-5 41427 0 1.69973E-5
19-33132942-G-A p.Pro298Ser missense ANKRD27 3 83140 3.60837E-5 41570 0 1.34481E-4
19-33132946-C-T p.Gln296Gln synonymous ANKRD27 2 83168 2.40477E-5 41584 0 NA
19-33132947-T-C p.Gln296Arg missense ANKRD27 7 83172 8.41629E-5 41586 0 1.67473E-5
19-33132948-G-A p.Gln296* stop_gained ANKRD27 2 83196 2.40396E-5 41598 0 3.34717E-5
19-33132950-G-C p.Thr295Arg missense ANKRD27 1 83218 1.20166E-5 41609 0 4.00606E-6
19-33132955-G-A p.Leu293Leu synonymous ANKRD27 1 83238 1.20137E-5 41619 0 8.33987E-6
19-33132971-C-T p.Arg288Gln missense ANKRD27 1 83274 1.20085E-5 41637 0 5.06586E-4
19-33132972-G-A p.Arg288* stop_gained ANKRD27 2 83294 2.40113E-5 41647 0 3.19407E-5
19-33132978-A-G p.Cys286Arg missense ANKRD27 1 83314 1.20028E-5 41657 0 NA
19-33132998-G-A p.Ser279Phe missense ANKRD27 4 83344 4.79939E-5 41672 0 3.99135E-6
19-33133001-G-A p.Thr278Ile missense ANKRD27 3 83340 3.59971E-5 41670 0 NA
19-33133003-G-A p.Cys277Cys synonymous ANKRD27 1 83344 1.19985E-5 41672 0 NA
19-33133021-C-A p.Leu271Leu synonymous ANKRD27 1 83338 1.19993E-5 41669 0 1.27559E-4
19-33133025-T-C p.Glu270Gly missense ANKRD27 6 83336 7.19977E-5 41668 0 9.5645E-5
19-33133028-CTT-C p.Glu270fs frameshift ANKRD27 1 83338 1.19993E-5 41669 0 NA
19-33133037-C-T p.Arg266His missense ANKRD27 3 83312 3.60092E-5 41656 0 3.19203E-5
19-33133038-G-A p.Arg266Cys missense ANKRD27 1 83312 1.20031E-5 41656 0 6.38488E-5
19-33133038-G-C p.Arg266Gly missense ANKRD27 3 83312 3.60092E-5 41656 0 NA
19-33133055-TA-T c.783-5delT splice_region ANKRD27 1 83186 1.20213E-5 41593 0 1.72577E-5
19-33133969-C-T n.558G>A splice_region ANKRD27 76 80842 9.40105E-4 40421 0 0.00169113
19-33134037-C-T p.Pro258Pro synonymous ANKRD27 241 83220 0.00289594 41610 0 0.00654582
19-33134038-G-A p.Pro258Leu missense ANKRD27 2 83238 2.40275E-5 41619 0 5.80364E-5
19-33134050-A-G p.Ile254Thr missense ANKRD27 1 83286 1.20068E-5 41643 0 NA
19-33134059-T-C p.Gln251Arg missense ANKRD27 7 83288 8.40457E-5 41644 0 9.55718E-5
19-33134075-G-A p.Leu246Phe missense ANKRD27 5 83306 6.00197E-5 41653 0 3.9781E-6
19-33134075-G-T p.Leu246Ile missense ANKRD27 1 83306 1.20039E-5 41653 0 6.37227E-5
19-33134077-C-T p.Ser245Asn missense ANKRD27 1 83306 1.20039E-5 41653 0 4.7735E-5
19-33134091-G-A p.Asn240Asn synonymous ANKRD27 2 83322 2.40033E-5 41661 0 8.26255E-5
19-33134098-G-T p.Ala238Asp missense ANKRD27 1 83324 1.20013E-5 41662 0 NA
19-33134101-G-A p.Ala237Val missense ANKRD27 1 83330 1.20005E-5 41665 0 3.97722E-6
19-33134104-TCCTAACAACAGATTTTAACGAACCTTCAAATTTCTCAAAAAGCACAGAAGAAGGCTTCCATCTTGGGTGATAATAACTGAGAACCTA-T p.Asp236fs frameshift ANKRD27 8 83338 9.59946E-5 41669 1 NA
19-33134113-C-T c.706-8G>A splice_region ANKRD27 2 83328 2.40015E-5 41664 0 2.47672E-5
19-33134187-A-G c.705+6T>C splice_region ANKRD27 38 83300 4.56182E-4 41650 0 8.7487E-5
19-33134189-C-T c.705+4G>A splice_region ANKRD27 1 83302 1.20045E-5 41651 0 NA
19-33134207-T-C p.Met1? start_lost ANKRD27 64 83314 7.68178E-4 41657 0 3.49953E-4
19-33134216-C-G p.Val228Leu missense ANKRD27 1 83314 1.20028E-5 41657 0 7.95355E-6
19-33134227-A-C p.Ile224Ser missense ANKRD27 1 83318 1.20022E-5 41659 0 NA
19-33134229-C-T p.Leu223Leu synonymous ANKRD27 203 83312 0.00243662 41656 0 0.00704935
19-33134240-T-C p.Ile220Val missense ANKRD27 4 83300 4.80192E-5 41650 0 3.97693E-6
19-33134252-C-T p.Val216Ile missense ANKRD27 4 83284 4.80284E-5 41642 0 3.18198E-5
19-33134255-A-G p.Tyr215His missense ANKRD27 2 83294 2.40113E-5 41647 0 2.47284E-5
19-33134258-TCTGTGGAATCAACAGACCCCATTCAGGGTGTGAGCGGGCAACAGGGTGTGCCTCCCAGCCACTCCGCCCCACCCTCAC-T c.639+1_640-1delGTGAGGGTGGGGCGGAGTGGCTGGGAGGCACACCCTGTTGCCCGCTCACACCCTGAATGGGGTCTGTTGATTCCACAG splice_acceptor ANKRD27 6 83278 7.20478E-5 41639 0 NA
19-33134337-C-A p.Glu213Asp missense+splice_region ANKRD27 1 83034 1.20433E-5 41517 0 8.2409E-6
19-33134342-C-G p.Val212Leu missense ANKRD27 11 83032 1.32479E-4 41516 0 4.12031E-5
19-33134342-C-T p.Val212Met missense ANKRD27 2 83032 2.40871E-5 41516 0 NA
19-33134350-T-C p.Lys209Arg missense ANKRD27 1 83054 1.20404E-5 41527 0 1.23306E-4
19-33134354-T-A p.Met208Leu missense ANKRD27 1 83048 1.20412E-5 41524 0 3.18796E-5
19-33134354-T-C p.Met208Val missense ANKRD27 2 83048 2.40825E-5 41524 0 NA
19-33134357-G-A p.Leu207Leu synonymous ANKRD27 2 83048 2.40825E-5 41524 0 1.19329E-5
19-33134365-T-G p.Gln204Pro missense ANKRD27 18 83080 2.16659E-4 41540 0 4.46229E-4
19-33134367-G-C p.Ala203Ala synonymous ANKRD27 1 83068 1.20383E-5 41534 0 NA
19-33134373-C-T p.Gln201Gln synonymous ANKRD27 1 83094 1.20346E-5 41547 0 NA
19-33134374-T-C p.Gln201Arg missense ANKRD27 1 83106 1.20328E-5 41553 0 1.19336E-5
19-33134382-G-A p.Leu198Leu synonymous ANKRD27 2 83122 2.4061E-5 41561 0 2.4719E-5
19-33134390-TCTAGAGGGCAAGAAAAGCACAGTGAAAGGGCTTGGATTTGCATGGGGGTGCACCACAATTCTCCCTCTCAGAAGTCCTGCTGCTTAC-T c.585+1_586-1delGTAAGCAGCAGGACTTCTGAGAGGGAGAATTGTGGTGCACCCCCATGCAAATCCAAGCCCTTTCACTGTGCTTTTCTTGCCCTCTAG splice_acceptor ANKRD27 7 83172 8.41629E-5 41586 1 NA
19-33134396-G-A c.586-6C>T splice_region ANKRD27 1 83194 1.20201E-5 41597 0 NA
19-33134473-C-T c.585+5G>A splice_region ANKRD27 1 83282 1.20074E-5 41641 0 NA
19-33134477-C-T c.585+1G>A splice_donor ANKRD27 1 83282 1.20074E-5 41641 0 1.64826E-5
19-33134483-G-T p.His194Asn missense ANKRD27 15 83292 1.80089E-4 41646 0 1.91229E-4
19-33134483-G-A p.His194Tyr missense ANKRD27 1 83292 1.2006E-5 41646 0 3.97633E-6
19-33134485-G-C p.Ser193Cys missense ANKRD27 1 83286 1.20068E-5 41643 0 NA
19-33134499-C-G p.Gln188His missense ANKRD27 1 83242 1.20132E-5 41621 0 3.97643E-6
19-33134509-C-A p.Cys185Phe missense ANKRD27 1 83194 1.20201E-5 41597 0 1.64916E-5
19-33134512-T-C p.Lys184Arg missense ANKRD27 2 83198 2.4039E-5 41599 0 3.97665E-6
19-33134517-G-A p.Tyr182Tyr synonymous ANKRD27 2 83168 2.40477E-5 41584 0 NA
19-33134520-G-C c.-94C>G 5_prime_UTR_premature_start_codon_gain ANKRD27 2 83168 2.40477E-5 41584 0 1.64978E-5
19-33134522-G-A p.Leu181Phe missense ANKRD27 1 83156 1.20256E-5 41578 0 NA
19-33134529-C-A p.Ala178Ala synonymous ANKRD27 1 83092 1.20349E-5 41546 0 7.95482E-6
19-33134537-C-CTATGTGGTGACGGAGGCTCTTTCTCTCGCATTCTCGGAATGTT c.526-1_526insAACATTCCGAGAATGCGAGAGAAAGAGCCTCCGTCACCACATA splice_acceptor ANKRD27 1 83004 1.20476E-5 41502 0 NA
19-33134537-C-CTATGTGGTGACGGAGGCTCTTTCTCTCGCATT c.526-1_526insAATGCGAGAGAAAGAGCCTCCGTCACCACATA splice_acceptor ANKRD27 1 83004 1.20476E-5 41502 0 NA
19-33135224-TACTG-T c.525+3_525+6delCAGT splice_region ANKRD27 1 83106 1.20328E-5 41553 0 3.18776E-5
19-33135233-T-C p.Ile175Val missense+splice_region ANKRD27 1 83162 1.20247E-5 41581 0 NA
19-33135236-G-C p.His174Asp missense ANKRD27 1 83158 1.20253E-5 41579 0 7.9614E-6
19-33135237-G-A p.His173His synonymous ANKRD27 1 83158 1.20253E-5 41579 0 6.25E-4
19-33135241-C-T p.Arg172His missense ANKRD27 1 83176 1.20227E-5 41588 0 2.47504E-5
19-33135257-C-G p.Glu167Gln missense ANKRD27 331 83214 0.0039777 41607 2 0.00886028
19-33135260-A-G p.Cys166Arg missense ANKRD27 2 83246 2.40252E-5 41623 0 3.18715E-5
19-33135265-C-T p.Arg164Gln missense ANKRD27 14 83256 1.68156E-4 41628 0 4.12228E-5
19-33135270-T-C p.Thr162Thr synonymous ANKRD27 12 83288 1.44078E-4 41644 0 5.36954E-4
19-33135270-T-A p.Thr162Thr synonymous ANKRD27 1 83288 1.20065E-5 41644 0 NA
19-33135275-G-T p.Arg161Arg synonymous ANKRD27 2 83294 2.40113E-5 41647 0 2.78408E-5
19-33135287-C-T p.Ala157Thr missense ANKRD27 1 83320 1.20019E-5 41660 0 6.37471E-5
19-33135288-G-A c.-169C>T 5_prime_UTR_premature_start_codon_gain ANKRD27 2 83324 2.40027E-5 41662 0 3.18124E-5
19-33135290-T-C p.Ile156Val missense ANKRD27 1 83328 1.20008E-5 41664 0 3.97655E-6
19-33135291-G-A p.Asn155Asn synonymous ANKRD27 6 83328 7.20046E-5 41664 0 1.6494E-5
19-33135304-C-T p.Arg150Gln missense+splice_region ANKRD27 2 83334 2.39998E-5 41667 0 3.18512E-5
19-33135305-G-A p.Arg151* stop_gained ANKRD27 1 83332 1.20002E-5 41666 0 1.64978E-5
19-33135309-G-A c.-190C>T 5_prime_UTR_premature_start_codon_gain ANKRD27 2 83350 2.39952E-5 41675 0 3.97668E-6
19-33135309-G-T p.Ser149Ser synonymous ANKRD27 1 83350 1.19976E-5 41675 0 NA
19-33135321-C-T p.Leu145Leu synonymous ANKRD27 1 83334 1.19999E-5 41667 0 NA
19-33135343-A-G p.Ile138Thr missense ANKRD27 5 83296 6.00269E-5 41648 0 5.03525E-4
19-33135370-G-T p.Pro129His missense ANKRD27 1 83150 1.20265E-5 41575 0 8.28693E-6
19-33135380-GC-AA p.GluPro124AspSer missense+splice_region ANKRD27 1 83064 1.20389E-5 41532 0 NA
19-33135390-A-G c.371-5T>C splice_region ANKRD27 3 82944 3.6169E-5 41472 0 6.37389E-5
19-33137338-AGAAAAAGGTTTTTTCTCCCAGAATACCT-A p.Glu124fs frameshift ANKRD27 4 83164 4.80977E-5 41582 0 6.05547E-5
19-33137359-G-A c.370+6C>T splice_region ANKRD27 1 83300 1.20048E-5 41650 0 8.32681E-6
19-33137367-G-A p.Ser123Leu missense+splice_region ANKRD27 3 83330 3.60014E-5 41665 0 NA
19-33137371-T-A p.Ser122Cys missense ANKRD27 1 83338 1.19993E-5 41669 0 NA
19-33137376-C-G p.Arg120Thr missense ANKRD27 4 83354 4.79881E-5 41677 0 5.04032E-4
19-33137394-G-A p.Ala114Val missense ANKRD27 1 83364 1.19956E-5 41682 0 3.18471E-5
19-33137415-CTCTCT-C p.Glu106fs frameshift ANKRD27 1 83366 1.19953E-5 41683 0 NA
19-33137439-G-A p.Thr99Ile missense ANKRD27 1 83368 1.1995E-5 41684 0 2.47606E-5
19-33137455-T-C p.Ile94Val missense ANKRD27 5 83364 5.99779E-5 41682 0 NA
19-33137461-C-T p.Val92Met missense ANKRD27 2 83366 2.39906E-5 41683 0 NA
19-33137476-C-A p.Ala87Ser missense ANKRD27 1 83352 1.19973E-5 41676 0 3.18573E-5
19-33137488-C-T p.Gly83Arg missense ANKRD27 2 83348 2.39958E-5 41674 0 NA
19-33137489-T-G p.Leu82Phe missense ANKRD27 1 83346 1.19982E-5 41673 0 3.18654E-5
19-33137490-A-T p.Leu82* stop_gained ANKRD27 1 83346 1.19982E-5 41673 0 NA
19-33137520-T-C p.Asp72Gly missense+splice_region ANKRD27 1 83280 1.20077E-5 41640 0 8.73225E-6
19-33137521-C-G p.Asp72His missense+splice_region ANKRD27 1 83270 1.20091E-5 41635 0 NA
19-33137523-T-TTTCCATTTAA c.214-3_214-2insTTAAATGGAA splice_region ANKRD27 1 83254 1.20114E-5 41627 0 NA
19-33137526-A-G c.214-5T>C splice_region ANKRD27 2 83228 2.40304E-5 41614 0 3.55051E-5
19-33137528-A-T c.214-7T>A splice_region ANKRD27 3 83220 3.6049E-5 41610 0 1.78568E-5
19-33140588-C-A p.Lys71Asn missense+splice_region ANKRD27 1 82654 1.20986E-5 41327 0 NA
19-33140591-T-C p.Gly70Gly synonymous ANKRD27 16 82692 1.93489E-4 41346 0 1.59297E-4
19-33140602-T-G p.Thr67Pro missense ANKRD27 1 82872 1.20668E-5 41436 0 3.97801E-6
19-33140612-C-T p.Glu63Glu synonymous ANKRD27 2 82980 2.41022E-5 41490 0 8.24158E-6
19-33140627-C-A p.Leu58Phe missense ANKRD27 2 83080 2.40732E-5 41540 0 8.23995E-6
19-33140639-C-T p.Glu54Glu synonymous ANKRD27 1 83102 1.20334E-5 41551 0 3.97662E-6
19-33140646-T-C p.Gln52Arg missense ANKRD27 1 83124 1.20302E-5 41562 0 NA
19-33140652-G-A p.Thr50Ile missense ANKRD27 68 83118 8.18114E-4 41559 1 0.003125
19-33140653-T-C p.Thr50Ala missense ANKRD27 1 83090 1.20351E-5 41545 0 7.95311E-6
19-33140656-A-T p.Ser49Thr missense ANKRD27 1 83096 1.20343E-5 41548 0 NA
19-33140658-T-C p.Gln48Arg missense ANKRD27 1 83066 1.20386E-5 41533 0 3.18451E-5
19-33140660-G-A p.Ile47Ile synonymous ANKRD27 2 83086 2.40714E-5 41543 0 3.18451E-5
19-33140666-G-A p.Ser45Ser synonymous ANKRD27 2 83052 2.40813E-5 41526 0 8.2409E-6
19-33140669-C-A p.Ser44Ser synonymous ANKRD27 1 83042 1.20421E-5 41521 0 NA
19-33140670-G-A p.Ser44Leu missense ANKRD27 1 83056 1.20401E-5 41528 0 4.9447E-5
19-33149813-C-T c.102+7G>A splice_region ANKRD27 8 83168 9.61908E-5 41584 0 6.36269E-5
19-33149822-T-G p.Ile34Leu missense+splice_region ANKRD27 1 83212 1.20175E-5 41606 0 8.24076E-6
19-33149825-C-T p.Gly33Ser missense ANKRD27 1 83220 1.20163E-5 41610 0 7.9526E-6
19-33149827-T-G p.His32Pro missense ANKRD27 16 83220 1.92261E-4 41610 0 1.91205E-4
19-33149848-C-T p.Cys25Tyr missense ANKRD27 1 83276 1.20083E-5 41638 0 8.35023E-5
19-33149850-C-G p.Leu24Phe missense ANKRD27 1 83286 1.20068E-5 41643 0 7.95254E-6
19-33149858-G-A p.Pro22Ser missense ANKRD27 1 83276 1.20083E-5 41638 0 NA
19-33149860-C-A p.Arg21Leu missense ANKRD27 2 83270 2.40183E-5 41635 0 1.595E-4
19-33149861-G-A p.Arg21Cys missense ANKRD27 346 83270 0.00415516 41635 2 0.0051656
19-33149863-C-T p.Cys20Tyr missense ANKRD27 2 83294 2.40113E-5 41647 0 2.78337E-5
19-33149881-T-C p.Tyr14Cys missense ANKRD27 3 83246 3.60378E-5 41623 0 8.23995E-6
19-33149886-A-G p.Pro12Pro synonymous ANKRD27 1 83268 1.20094E-5 41634 0 NA
19-33149895-C-T p.Leu9Leu synonymous ANKRD27 1 83256 1.20111E-5 41628 0 NA
19-33149904-T-C p.Glu6Glu synonymous ANKRD27 102 83172 0.00122637 41586 1 0.0021692
19-33149904-T-A p.Glu6Asp missense ANKRD27 2 83176 2.40454E-5 41588 0 8.24865E-6
19-33149913-C-G p.Leu3Leu synonymous ANKRD27 2 83144 2.40547E-5 41572 0 3.18837E-5
19-33149913-C-A p.Leu3Leu synonymous ANKRD27 1 83144 1.20273E-5 41572 0 NA
19-33149920-A-G p.Met1? start_lost ANKRD27 2 83050 2.40819E-5 41525 0 1.19318E-5
19-33149932-G-T c.-11C>A 5_prime_UTR_premature_start_codon_gain ANKRD27 1 82826 1.20735E-5 41413 0 NA
19-33149932-G-C c.-11C>G 5_prime_UTR_premature_start_codon_gain ANKRD27 1 82826 1.20735E-5 41413 0 NA
19-33149949-C-CTCTTAAAAGGCTACATCGCTTCATTCCCAGCCCA c.-29_-28insTGGGCTGGGAATGAAGCGATGTAGCCTTTTAAGA splice_region ANKRD27 3 82628 3.63073E-5 41314 1 NA
19-33149949-C-T c.-28G>A splice_region ANKRD27 2 82624 2.4206E-5 41312 0 7.18167E-5
19-33149959-A-G c.-30-8T>C splice_region ANKRD27 2 82310 2.42984E-5 41155 0 6.38203E-5
19-33166943-G-A c.-282C>T 5_prime_UTR_premature_start_codon_gain ANKRD27 1 14776 6.76773E-5 7388 0 NA
19-33167029-G-A c.-368C>T 5_prime_UTR_premature_start_codon_gain ANKRD27 1 35146 2.84527E-5 17573 0 3.18695E-5
19-33167038-G-A c.-377C>T 5_prime_UTR_premature_start_codon_gain ANKRD27 1 37148 2.69193E-5 18574 0 NA
19-33167059-G-C c.-398C>G 5_prime_UTR_premature_start_codon_gain ANKRD27 1 46948 2.13002E-5 23474 0 NA
19-33167108-C-A c.-447G>T 5_prime_UTR_premature_start_codon_gain ANKRD27 2 65726 3.04294E-5 32863 0 NA
19-33167169-G-A c.-508C>T 5_prime_UTR_premature_start_codon_gain ANKRD27 4 75792 5.2776E-5 37896 0 3.78824E-5
19-33167198-T-A c.-537A>T 5_prime_UTR_premature_start_codon_gain ANKRD27 4 77286 5.17558E-5 38643 0 7.93101E-5
19-33167236-C-A c.-575G>T 5_prime_UTR_premature_start_codon_gain ANKRD27 3 77726 3.85971E-5 38863 0 1.77189E-5
19-33167363-G-A c.-702C>T 5_prime_UTR_premature_start_codon_gain ANKRD27 2 67752 2.95194E-5 33876 0 5.61779E-6