Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
19-4183396-T-G c.-231T>G 5_prime_UTR_premature_start_codon_gain ANKRD24 1 65934 1.51667E-5 32967 0 NA
19-4183423-G-A c.-204G>A 5_prime_UTR_premature_start_codon_gain ANKRD24 4 64480 6.20347E-5 32240 0 2.22902E-4
19-4183435-A-G c.-192A>G 5_prime_UTR_premature_start_codon_gain ANKRD24 2 63436 3.15278E-5 31718 0 3.18593E-5
19-4183465-A-T c.-162A>T 5_prime_UTR_premature_start_codon_gain ANKRD24 5 60996 8.19726E-5 30498 0 NA
19-4183472-C-G c.-155C>G splice_region ANKRD24 3 61008 4.91739E-5 30504 0 9.55779E-5
19-4186260-TCTTGCTCTAGGGGCCAGGACTG-T c.-152-10_-141delCTTGCTCTAGGGGCCAGGACTG splice_acceptor ANKRD24 1 59884 1.6699E-5 29942 0 NA
19-4186264-G-T c.-152-7G>T splice_region ANKRD24 1 61154 1.63522E-5 30577 0 3.18776E-5
19-4186287-G-T c.-136G>T 5_prime_UTR_premature_start_codon_gain ANKRD24 1 68540 1.459E-5 34270 0 6.37674E-5
19-4186325-C-T c.-98C>T 5_prime_UTR_premature_start_codon_gain ANKRD24 2 77314 2.58685E-5 38657 0 NA
19-4186335-C-T c.-88C>T 5_prime_UTR_premature_start_codon_gain ANKRD24 1 78524 1.2735E-5 39262 0 NA
19-4186350-G-C c.-73G>C 5_prime_UTR_premature_start_codon_gain ANKRD24 167 80048 0.00208625 40024 3 0.00450048
19-4186423-A-G p.Met1? start_lost ANKRD24 1 81656 1.22465E-5 40828 0 9.39903E-6
19-4186429-A-T p.Thr3Ser missense ANKRD24 1 81662 1.22456E-5 40831 0 NA
19-4186431-T-A p.Thr3Thr synonymous ANKRD24 4 81674 4.89752E-5 40837 0 4.25931E-5
19-4186439-C-A p.Ala6Glu missense ANKRD24 1 81724 1.22363E-5 40862 0 NA
19-4186440-G-A p.Ala6Ala synonymous ANKRD24 8 81708 9.79096E-5 40854 0 8.40195E-5
19-4186446-T-G p.Phe8Leu missense ANKRD24 1 81740 1.22339E-5 40870 0 NA
19-4186460-T-C c.36+2T>C splice_donor ANKRD24 1 81716 1.22375E-5 40858 0 4.66932E-6
19-4198144-C-T p.Pro3Leu missense ANKRD24 1 8164 1.22489E-4 4082 0 NA
19-4198145-G-T p.Pro3Pro synonymous ANKRD24 1 8190 1.221E-4 4095 0 0.00420168
19-4198154-C-T p.Cys6Cys synonymous ANKRD24 3067 8270 0.370859 4135 644 0.53258
19-4198169-C-T p.Ala11Ala synonymous ANKRD24 1219 8552 0.14254 4276 112 0.26825
19-4198170-G-C p.Gly12Arg missense ANKRD24 29 8780 0.00330296 4390 0 0.0114675
19-4198186-G-A p.Arg17His missense ANKRD24 94 8998 0.0104468 4499 8 0.0400933
19-4198220-G-C p.Arg28Ser missense ANKRD24 3 7942 3.77739E-4 3971 0 2.98329E-4
19-4198223-C-T p.Gly29Gly synonymous ANKRD24 1 7818 1.2791E-4 3909 0 NA
19-4198292-TGGGGGAGGGGGCTGGCGAGGAGGGCAA-T p.Trp57_Gly65del conservative_inframe_deletion ANKRD24 1 6208 1.61082E-4 3104 0 NA
19-4198331-C-T p.Gly65Gly synonymous ANKRD24 2 5328 3.75375E-4 2664 0 4.03291E-5
19-4198338-A-AGGGAGGGCGGGACCGGGC p.Glu69_Arg74dup disruptive_inframe_insertion ANKRD24 84 5330 0.0157598 2665 0 0.0452628
19-4198342-AGGGCGGGACCGGGCGGGC-A p.Thr72_Gly77del conservative_inframe_deletion ANKRD24 1 5292 1.88964E-4 2646 0 NA
19-4198342-A-AGGGGGCGGCACCAGGGAGGGCGGGACCGGGCGGGC p.Gly71fs frameshift ANKRD24 1 5292 1.88964E-4 2646 0 NA
19-4198351-CCGGG-C p.Gly77fs frameshift ANKRD24 1 5272 1.89681E-4 2636 0 1.24275E-4
19-4198360-C-G p.Ala75Gly missense ANKRD24 1 5204 1.9216E-4 2602 0 1.80115E-4
19-4198429-C-T p.Pro98Leu missense ANKRD24 1 13804 7.24428E-5 6902 0 3.20677E-5
19-4198434-G-GGCC p.Arg102dup disruptive_inframe_insertion ANKRD24 1 13838 7.22648E-5 6919 0 0.00289017
19-4198435-G-T p.Gly100Val missense ANKRD24 1 13844 7.22335E-5 6922 0 9.6234E-5
19-4198438-G-A p.Arg101His missense ANKRD24 1 13868 7.21085E-5 6934 0 3.20677E-5
19-4198446-C-T p.Leu104Phe missense ANKRD24 1 14272 7.00673E-5 7136 0 1.59939E-4
19-4198457-C-T p.Pro107Pro synonymous ANKRD24 1 14612 6.84369E-5 7306 0 NA
19-4198457-C-G p.Pro107Pro synonymous ANKRD24 1 14612 6.84369E-5 7306 0 NA
19-4198461-G-GCACC p.Pro111fs frameshift ANKRD24 1 14616 6.84182E-5 7308 0 NA
19-4198463-G-A p.Ala109Ala synonymous ANKRD24 2229 14304 0.155831 7152 219 0.306443
19-4198463-G-GC p.Ala112fs frameshift ANKRD24 1 14578 6.85965E-5 7289 0 1.44739E-5
19-4198464-C-A p.Pro110Thr missense ANKRD24 124 14670 0.00845262 7335 2 0.0283665
19-4198465-C-CCCCCGCG p.Asp117fs frameshift ANKRD24 2 14738 1.35704E-4 7369 0 7.07154E-5
19-4198465-C-CGCG p.Pro110_Pro111insArg disruptive_inframe_insertion ANKRD24 1 14738 6.78518E-5 7369 0 NA
19-4198478-C-T p.Arg114Arg synonymous ANKRD24 1 14790 6.76133E-5 7395 0 NA
19-4198484-G-A p.Pro116Pro synonymous ANKRD24 233 14764 0.0157816 7382 11 0.0396881
19-4198484-G-C p.Pro116Pro synonymous ANKRD24 15 14814 0.00101256 7407 0 0.00169362
19-4199676-G-A c.37-4G>A splice_region ANKRD24 8 53052 1.50795E-4 26526 0 NA
19-4199678-A-C c.37-2A>C splice_acceptor ANKRD24 1 53422 1.87189E-5 26711 0 8.08918E-6
19-4199683-C-T p.Arg14Trp missense ANKRD24 1 53886 1.85577E-5 26943 0 7.92946E-6
19-4199688-C-G p.Leu15Leu synonymous ANKRD24 2 54886 3.64392E-5 27443 0 7.5425E-6
19-4199693-C-G p.Pro17Arg missense ANKRD24 1 55536 1.80063E-5 27768 0 9.09256E-5
19-4199700-C-T p.Asp19Asp synonymous ANKRD24 2 56292 3.5529E-5 28146 0 7.39098E-6
19-4199721-C-T p.Cys26Cys synonymous ANKRD24 4 57840 6.91563E-5 28920 1 1.03736E-4
19-4199735-T-C p.Ile31Thr missense ANKRD24 8 59444 1.3458E-4 29722 0 1.25676E-4
19-4199739-G-A p.Pro32Pro synonymous ANKRD24 1 59560 1.67898E-5 29780 0 9.07112E-5
19-4199744-C-T p.Pro34Leu missense ANKRD24 2 60478 3.30699E-5 30239 0 NA
19-4199744-C-A p.Pro34Gln missense ANKRD24 2 60478 3.30699E-5 30239 0 NA
19-4199745-G-A p.Pro34Pro synonymous ANKRD24 1 60294 1.65854E-5 30147 0 9.55779E-5
19-4199761-C-T p.Arg40Cys missense ANKRD24 5 61110 8.18197E-5 30555 0 3.18695E-5
19-4199762-G-A p.Arg40His missense ANKRD24 3 61186 4.90308E-5 30593 0 2.2355E-5
19-4199866-C-T c.394-6C>T splice_region ANKRD24 3 77276 3.88219E-5 38638 0 3.93113E-5
19-4199869-C-A c.394-3C>A splice_region ANKRD24 1 77554 1.28942E-5 38777 0 5.55519E-6
19-4199896-G-A p.Glu140Lys missense ANKRD24 5 79956 6.25344E-5 39978 0 5.54687E-6
19-4199907-A-T p.Leu143Leu synonymous ANKRD24 4 80560 4.96524E-5 40280 0 7.55059E-5
19-4199913-C-T p.Ala145Ala synonymous ANKRD24 1 80870 1.23655E-5 40435 0 5.49233E-6
19-4199914-G-A p.Val146Met missense ANKRD24 3 80916 3.70755E-5 40458 0 3.18674E-5
19-4199916-G-A p.Val146Val synonymous ANKRD24 1 80994 1.23466E-5 40497 0 1.65572E-5
19-4199923-A-G p.Asn149Asp missense ANKRD24 52 81124 6.40994E-4 40562 0 0.00255102
19-4199925-C-T p.Asn149Asn synonymous ANKRD24 1 81104 1.23298E-5 40552 0 3.80575E-5
19-4199926-G-A p.Asp150Asn missense ANKRD24 2 81124 2.46536E-5 40562 0 3.78472E-5
19-4199930-C-T p.Ala151Val missense ANKRD24 1 81178 1.23186E-5 40589 0 NA
19-4199943-C-T p.Ala155Ala synonymous ANKRD24 20 81286 2.46045E-4 40643 0 0.00152284
19-4199944-G-A p.Ala156Thr missense ANKRD24 717 81268 0.00882266 40634 12 0.0166741
19-4199949-C-T p.Leu157Leu synonymous ANKRD24 2 81340 2.45881E-5 40670 0 8.03665E-5
19-4199953-G-A p.Ala159Thr missense ANKRD24 1 81324 1.22965E-5 40662 0 3.18674E-5
19-4199956-C-T p.Arg160Cys missense ANKRD24 2 81364 2.45809E-5 40682 0 3.18837E-5
19-4199957-G-T p.Arg160Leu missense ANKRD24 1 81370 1.22895E-5 40685 0 4.09165E-5
19-4199958-C-T p.Arg160Arg synonymous ANKRD24 1 81396 1.22856E-5 40698 0 NA
19-4199968-G-C p.Val164Leu missense ANKRD24 1 81406 1.22841E-5 40703 0 5.80423E-6
19-4199969-T-C p.Val164Ala missense ANKRD24 3 81358 3.68741E-5 40679 0 1.9129E-4
19-4199970-G-A p.Val164Val synonymous ANKRD24 1 81360 1.22911E-5 40680 0 NA
19-4199975-C-T p.Thr166Met missense ANKRD24 1 81360 1.22911E-5 40680 0 4.03063E-5
19-4199976-G-A p.Thr166Thr synonymous ANKRD24 3 81354 3.68759E-5 40677 0 4.00898E-5
19-4199989-G-A p.Glu171Lys missense ANKRD24 2 81380 2.45761E-5 40690 0 NA
19-4200001-G-A p.Ala175Thr missense+splice_region ANKRD24 1 81390 1.22865E-5 40695 0 1.11972E-5
19-4200002-C-T p.Ala175Val missense+splice_region ANKRD24 3 81388 3.68605E-5 40694 0 3.91267E-5
19-4200003-G-A c.524+1G>A splice_donor ANKRD24 4 81406 4.91364E-5 40703 0 5.5986E-6
19-4200074-C-T c.525-6C>T splice_region ANKRD24 1 81614 1.22528E-5 40807 0 NA
19-4200091-C-T p.Ala179Val missense ANKRD24 4 81642 4.89944E-5 40821 0 1.64273E-4
19-4200092-G-A p.Ala179Ala synonymous ANKRD24 5 81646 6.124E-5 40823 0 8.59806E-4
19-4200097-T-C p.Met181Thr missense ANKRD24 1 81622 1.22516E-5 40811 0 NA
19-4200098-G-A p.Met181Ile missense ANKRD24 103 81640 0.00126164 40820 0 0.00236532
19-4200099-C-T p.Arg182Trp missense ANKRD24 2 81642 2.44972E-5 40821 0 0.00504541
19-4200100-G-A p.Arg182Gln missense ANKRD24 1 81648 1.22477E-5 40824 0 3.97667E-5
19-4200106-C-T p.Ala184Val missense ANKRD24 4 81608 4.90148E-5 40804 0 1.27689E-4
19-4200107-G-A p.Ala184Ala synonymous ANKRD24 1 81626 1.2251E-5 40813 0 6.84346E-5
19-4200108-G-A p.Ala185Thr missense ANKRD24 2 81632 2.45002E-5 40816 0 1.59612E-4
19-4200111-A-G p.Ser186Gly missense ANKRD24 3 81624 3.67539E-5 40812 0 3.23217E-5
19-4200113-C-T p.Ser186Ser synonymous ANKRD24 22 81632 2.69502E-4 40816 0 5.74346E-4
19-4200113-C-A p.Ser186Arg missense ANKRD24 1 81632 1.22501E-5 40816 0 NA
19-4200120-G-C p.Glu189Gln missense ANKRD24 1 81652 1.22471E-5 40826 0 NA
19-4200133-C-G p.Ala193Gly missense ANKRD24 1 81584 1.22573E-5 40792 0 NA
19-4200137-TGGCAGCAATGTCATGAGCGCGGACGGGGCAGGTAC-T p.Gly195fs frameshift ANKRD24 1 81610 1.22534E-5 40805 0 NA
19-4200152-G-T p.Met199Ile missense ANKRD24 1 81530 1.22654E-5 40765 0 NA
19-4200155-C-T p.Ser200Ser synonymous ANKRD24 4 81446 4.91123E-5 40723 0 6.46463E-5
19-4200156-G-A p.Ala201Thr missense ANKRD24 29542 76560 0.385867 38280 5232 0.461019
19-4200156-GCG-ACA p.Ala201Thr missense ANKRD24 2 81446 2.45561E-5 40723 0 NA
19-4200157-C-T p.Ala201Val missense ANKRD24 14 81438 1.7191E-4 40719 0 0.00151515
19-4200159-GA-TT p.Asp202Phe missense ANKRD24 2 81446 2.45561E-5 40723 0 NA
19-4200161-C-T p.Asp202Asp synonymous ANKRD24 3 81404 3.68532E-5 40702 0 3.19203E-5
19-4200164-G-A p.Gly203Gly synonymous ANKRD24 9 81400 1.10565E-4 40700 0 2.55232E-4
19-4200176-C-T c.613+8C>T splice_region ANKRD24 1 81166 1.23204E-5 40583 0 3.34919E-5
19-4202022-G-C c.614-1G>C splice_acceptor ANKRD24 1 82436 1.21306E-5 41218 0 4.01262E-6
19-4202026-A-G p.Tyr206Cys missense ANKRD24 1 82436 1.21306E-5 41218 0 4.01258E-6
19-4202032-C-A p.Ala208Asp missense ANKRD24 1 82462 1.21268E-5 41231 0 NA
19-4202033-C-T p.Ala208Ala synonymous ANKRD24 2 82466 2.42524E-5 41233 0 6.41967E-5
19-4202035-T-C p.Leu209Pro missense ANKRD24 2 82472 2.42507E-5 41236 0 1.60492E-5
19-4202040-C-T p.Leu211Leu synonymous ANKRD24 1 82474 1.2125E-5 41237 0 NA
19-4202045-C-T p.Ala212Ala synonymous ANKRD24 1 82476 1.21247E-5 41238 0 3.31246E-5
19-4202046-G-A p.Ala213Thr missense ANKRD24 4 82478 4.84978E-5 41239 0 6.25E-4
19-4202054-C-T p.Tyr215Tyr synonymous ANKRD24 1 82476 1.21247E-5 41238 0 3.18857E-5
19-4202055-G-A p.Gly216Arg missense ANKRD24 6 82474 7.27502E-5 41237 0 1.595E-4
19-4202070-T-A p.Leu221Met missense ANKRD24 1 82478 1.21244E-5 41239 0 NA
19-4202071-T-C p.Leu221Ser missense ANKRD24 3 82478 3.63733E-5 41239 0 1.6562E-5
19-4202081-A-G p.Leu224Leu synonymous ANKRD24 1 82420 1.2133E-5 41210 0 1.6562E-5
19-4202084-G-A p.Leu225Leu synonymous ANKRD24 1 82438 1.21303E-5 41219 0 NA
19-4202093-T-A c.678+6T>A splice_region ANKRD24 2 82394 2.42736E-5 41197 0 NA
19-4202860-C-T c.679-6C>T splice_region ANKRD24 5 81650 6.1237E-5 40825 0 8.94828E-5
19-4202868-T-C p.Ala227Ala splice_region+synonymous ANKRD24 2 81668 2.44894E-5 40834 0 3.1904E-5
19-4202869-T-C p.Ser228Pro missense ANKRD24 1 81656 1.22465E-5 40828 0 4.70872E-6
19-4202874-C-A p.Cys229* stop_gained ANKRD24 1 81660 1.22459E-5 40830 0 2.76381E-5
19-4202874-C-T p.Cys229Cys synonymous ANKRD24 2 81660 2.44918E-5 40830 0 3.19203E-5
19-4202875-G-A p.Val230Met missense ANKRD24 8 81650 9.79792E-5 40825 0 1.17306E-4
19-4202875-G-C p.Val230Leu missense ANKRD24 1 81650 1.22474E-5 40825 0 NA
19-4202886-C-T p.Val233Val synonymous ANKRD24 1 81592 1.22561E-5 40796 0 2.69804E-5
19-4202896-A-C p.Ser237Arg missense ANKRD24 1 81574 1.22588E-5 40787 0 NA
19-4202898-C-T p.Ser237Ser synonymous ANKRD24 1 81526 1.2266E-5 40763 0 1.14574E-4
19-4202899-G-A p.Gly238Arg missense ANKRD24 1 81508 1.22687E-5 40754 0 5.76402E-5
19-4202928-G-A c.736+5G>A splice_region ANKRD24 1 81040 1.23396E-5 40520 0 3.90717E-5
19-4207099-TTG-T c.406-5_406-4delTG splice_region ANKRD24 8 39626 2.01888E-4 19813 0 0.00311993
19-4207100-TG-T c.406-4delG splice_region ANKRD24 46 35236 0.00130548 17618 0 0.0643737
19-4207100-T-G c.406-5T>G splice_region ANKRD24 4 35400 1.12994E-4 17700 0 1.16822E-4
19-4207100-TGTA-T c.406-4_406-2delGTA splice_acceptor ANKRD24 1 35402 2.8247E-5 17701 0 NA
19-4207101-G-T c.406-4G>T splice_region ANKRD24 63 24304 0.00259217 12152 0 0.174568
19-4207101-GTA-TTT c.406-4_406-2delGTAinsTTT splice_acceptor ANKRD24 10 24420 4.095E-4 12210 0 NA
19-4207101-GTAG-TTTT c.406-4_406-1delGTAGinsTTTT splice_acceptor ANKRD24 1 24442 4.09132E-5 12221 0 NA
19-4207102-T-G c.406-3T>G splice_region ANKRD24 2 30106 6.64319E-5 15053 0 6.75037E-5
19-4207102-T-TTTG c.406-3_406-2insTTG splice_acceptor ANKRD24 4 30100 1.3289E-4 15050 1 0.00229885
19-4207102-TA-T c.406-2delA splice_acceptor ANKRD24 1 30106 3.3216E-5 15053 0 NA
19-4207103-A-T c.406-2A>T splice_acceptor ANKRD24 30 26718 0.00112284 13359 0 0.0224453
19-4207104-G-T c.406-1G>T splice_acceptor ANKRD24 5 32120 1.55666E-4 16060 0 1.30183E-4
19-4207106-G-A p.Arg136Lys missense+splice_region ANKRD24 1 36610 2.73149E-5 18305 0 1.67493E-5
19-4207116-C-T p.Leu139Leu synonymous ANKRD24 1 48668 2.05474E-5 24334 0 NA
19-4207117-A-C p.Thr140Pro missense ANKRD24 1 49904 2.00385E-5 24952 0 NA
19-4207125-G-A p.Leu142Leu synonymous ANKRD24 1 55280 1.80897E-5 27640 0 2.53216E-5
19-4207239-C-T p.Ala246Val missense+splice_region ANKRD24 4 81654 4.89872E-5 40827 0 6.25E-4
19-4207240-G-C p.Arg145Pro missense+splice_region ANKRD24 4 81720 4.89476E-5 40860 0 0.00100705
19-4207251-G-A p.Cys250Tyr missense ANKRD24 21 81950 2.56254E-4 40975 1 0.00352467
19-4207252-T-A p.Cys250* stop_gained ANKRD24 1 81960 1.22011E-5 40980 0 NA
19-4207260-G-A p.Cys253Tyr missense ANKRD24 1 82034 1.21901E-5 41017 0 NA
19-4207293-T-C p.Ter163Glnext*? stop_lost ANKRD24 290 82254 0.00352566 41127 2 0.00556302
19-4207294-AAACCCCCAAGATCGGGT-A p.Asn265_Arg269del splice_donor ANKRD24 1 82254 1.21575E-5 41127 0 NA
19-4207297-C-T p.Asn265Asn synonymous ANKRD24 3 82278 3.64618E-5 41139 0 NA
19-4207298-C-T p.Pro266Ser missense ANKRD24 1 82286 1.21527E-5 41143 0 NA
19-4207307-C-T p.Arg269Trp missense+splice_region ANKRD24 1 82304 1.21501E-5 41152 0 NA
19-4207308-G-A p.Arg269Gln missense+splice_region ANKRD24 2 82306 2.42996E-5 41153 0 1.20392E-5
19-4207308-G-T p.Arg269Leu missense+splice_region ANKRD24 2 82306 2.42996E-5 41153 0 1.66384E-5
19-4207495-C-T c.808-3C>T splice_region ANKRD24 1 82306 1.21498E-5 41153 0 NA
19-4207503-C-T p.Gly271Gly synonymous ANKRD24 3 82336 3.64361E-5 41168 0 1.60532E-5
19-4207504-G-A p.Ala272Thr missense ANKRD24 19 82348 2.30728E-4 41174 0 6.25E-4
19-4207512-C-T p.Pro274Pro synonymous ANKRD24 4 82454 4.85119E-5 41227 0 4.01284E-6
19-4207519-A-G p.Ile277Val missense ANKRD24 1 82490 1.21227E-5 41245 0 NA
19-4207521-AGC-A p.Ala278fs frameshift ANKRD24 4 82512 4.84778E-5 41256 0 NA
19-4207529-A-T p.Gln280Leu missense ANKRD24 1 82580 1.21095E-5 41290 0 3.18817E-5
19-4207541-C-T p.Thr284Ile missense ANKRD24 1 82574 1.21103E-5 41287 0 NA
19-4207548-G-C p.Leu286Leu synonymous ANKRD24 3 82612 3.63143E-5 41306 0 NA
19-4207552-C-T p.Arg288Cys missense ANKRD24 1 82620 1.21036E-5 41310 0 8.28322E-6
19-4207553-G-A p.Arg288His missense ANKRD24 2 82602 2.42125E-5 41301 0 1.2425E-4
19-4207569-A-G p.Gln293Gln synonymous ANKRD24 1 82572 1.21106E-5 41286 0 8.02826E-6
19-4207578-C-T p.Ala296Ala synonymous ANKRD24 15 82556 1.81695E-4 41278 0 2.23143E-4
19-4207578-C-A p.Ala296Ala synonymous ANKRD24 1 82556 1.2113E-5 41278 0 NA
19-4207579-G-A p.Ala297Thr missense ANKRD24 1 82552 1.21136E-5 41276 0 2.00747E-5
19-4207580-C-T p.Ala297Val missense ANKRD24 7 82536 8.48115E-5 41268 0 2.00724E-5
19-4207581-G-A p.Ala297Ala synonymous ANKRD24 1 82552 1.21136E-5 41276 0 6.37389E-5
19-4207584-C-G p.Asn298Lys missense ANKRD24 1 82530 1.21168E-5 41265 0 NA
19-4207584-C-T p.Asn298Asn synonymous ANKRD24 1 82530 1.21168E-5 41265 0 1.20436E-5
19-4207585-G-A p.Asp299Asn missense ANKRD24 401 82518 0.00485955 41259 7 0.0115005
19-4207591-G-A p.Asp301Asn missense ANKRD24 1 82482 1.21239E-5 41241 0 4.01465E-6
19-4207598-A-G p.Gln303Arg missense ANKRD24 1 82452 1.21283E-5 41226 0 0.00100705
19-4207603-A-G p.Arg305Gly missense+splice_region ANKRD24 1 82404 1.21353E-5 41202 0 NA
19-4207607-G-A c.914+3G>A splice_region ANKRD24 3 82388 3.64131E-5 41194 0 3.18573E-5
19-4207781-G-A p.Thr306Thr synonymous ANKRD24 1 81750 1.22324E-5 40875 0 NA
19-4207784-C-T p.Ala307Ala synonymous ANKRD24 1 81778 1.22282E-5 40889 0 NA
19-4207790-G-A p.Met309Ile missense ANKRD24 1 81748 1.22327E-5 40874 0 4.89524E-6
19-4207796-C-T p.Ala311Ala synonymous ANKRD24 1 81698 1.22402E-5 40849 0 NA
19-4207802-G-A p.Glu313Glu synonymous ANKRD24 1 81722 1.22366E-5 40861 0 NA
19-4207814-C-T p.Pro317Pro synonymous ANKRD24 3 81720 3.67107E-5 40860 0 9.55901E-5
19-4207815-G-A p.Glu318Lys missense ANKRD24 2 81704 2.44786E-5 40852 0 1.59144E-5
19-4207835-G-A p.Leu324Leu synonymous ANKRD24 33 81632 4.04253E-4 40816 1 8.28606E-4
19-4207841-C-T p.Gly326Gly synonymous ANKRD24 2 81550 2.45248E-5 40775 0 1.60241E-5
19-4207842-G-A p.Gly327Arg missense ANKRD24 2 81564 2.45206E-5 40782 0 3.18857E-5
19-4207843-G-A p.Gly327Glu missense ANKRD24 1 81554 1.22618E-5 40777 0 3.18735E-5
19-4207844-A-G p.Gly327Gly synonymous ANKRD24 1 81542 1.22636E-5 40771 0 NA
19-4207852-C-T p.Pro330Leu missense ANKRD24 1942 81476 0.0238352 40738 71 0.0454087
19-4207853-G-A p.Pro330Pro synonymous ANKRD24 2 81528 2.45314E-5 40764 0 3.24538E-5
19-4207862-C-T p.Thr333Thr synonymous ANKRD24 2 81492 2.45423E-5 40746 0 3.27557E-5
19-4207867-C-T p.Ala335Val missense ANKRD24 3 81444 3.68351E-5 40722 0 1.53177E-5
19-4207868-G-T p.Ala335Ala synonymous ANKRD24 3 81430 3.68415E-5 40715 0 3.30764E-5
19-4207868-G-A p.Ala335Ala synonymous ANKRD24 4 81430 4.91219E-5 40715 0 3.63841E-4
19-4207880-C-T p.Asp339Asp synonymous ANKRD24 3 81432 3.68406E-5 40716 0 3.37952E-5
19-4207882-C-T p.Ala340Val missense ANKRD24 1 81380 1.2288E-5 40690 0 3.39605E-5
19-4207883-G-A p.Ala340Ala synonymous ANKRD24 2 81400 2.457E-5 40700 0 3.4236E-5
19-4207888-A-G p.His342Arg missense ANKRD24 3 81436 3.68387E-5 40718 0 1.70259E-5
19-4207895-C-T p.Gly344Gly synonymous ANKRD24 3 81346 3.68795E-5 40673 0 0.0020202
19-4207896-G-A p.Ala345Thr missense ANKRD24 3 81328 3.68877E-5 40664 0 4.69647E-4
19-4207903-C-T p.Ala347Val missense ANKRD24 6 81308 7.37935E-5 40654 0 5.30073E-5
19-4207904-G-A p.Ala347Ala synonymous ANKRD24 6 81320 7.37826E-5 40660 0 0.00252525
19-4207906-G-T p.Gly348Val missense ANKRD24 1 81314 1.2298E-5 40657 0 1.04359E-5
19-4207918-T-C p.Ile352Thr missense ANKRD24 1 81218 1.23125E-5 40609 0 NA
19-4207935-G-C p.Glu358Gln missense ANKRD24 1 80958 1.23521E-5 40479 0 1.9699E-5
19-4207939-C-T p.Ala359Val missense ANKRD24 1 80822 1.23729E-5 40411 0 0.00151822
19-4207940-G-A p.Ala359Ala synonymous ANKRD24 13224 80318 0.164646 40159 1236 0.283291
19-4207947-C-T p.Arg362Cys missense ANKRD24 5 80500 6.21118E-5 40250 0 5.48795E-5
19-4207948-G-A p.Arg362His missense ANKRD24 5 80408 6.21829E-5 40204 0 5.47405E-5
19-4207957-C-A p.Pro365Gln missense ANKRD24 9 80402 1.11938E-4 40201 0 0.00253293
19-4207958-A-G p.Pro365Pro synonymous ANKRD24 1 80296 1.24539E-5 40148 0 0.0070922
19-4207964-C-T p.Ser367Ser splice_region+synonymous ANKRD24 1977 80138 0.0246699 40069 77 0.0492386
19-4208753-C-G c.1103-8C>G splice_region ANKRD24 1 82112 1.21785E-5 41056 0 NA
19-4208756-C-T c.1103-5C>T splice_region ANKRD24 2 82120 2.43546E-5 41060 0 8.09828E-6
19-4208758-C-G c.1103-3C>G splice_region ANKRD24 1 82134 1.21752E-5 41067 0 NA
19-4208776-A-G p.Asp373Gly missense ANKRD24 2 82146 2.43469E-5 41073 0 4.03151E-6
19-4208779-C-T p.Ser374Leu missense ANKRD24 1 82152 1.21726E-5 41076 0 1.79649E-5
19-4208781-G-T p.Gly375Cys missense ANKRD24 2 82146 2.43469E-5 41073 0 NA
19-4208783-C-T p.Gly375Gly synonymous ANKRD24 1 82134 1.21752E-5 41067 0 4.03252E-6
19-4208788-C-T p.Ala377Val missense ANKRD24 1561 82060 0.0190227 41030 23 0.01875
19-4208789-G-A p.Ala377Ala synonymous ANKRD24 32 82144 3.8956E-4 41072 1 4.78072E-4
19-4208988-G-A n.24+5G>A splice_region ANKRD24 1 31616 3.16296E-5 15808 0 NA
19-4210057-C-T p.Asn381Asn splice_region+synonymous ANKRD24 71 81878 8.67144E-4 40939 0 0.00169145
19-4210061-A-G p.Met383Val missense ANKRD24 2 81902 2.44194E-5 40951 0 1.16023E-5
19-4210062-T-C p.Met383Thr missense ANKRD24 1 81934 1.22049E-5 40967 0 2.45928E-5
19-4210082-G-A p.Gly390Arg missense ANKRD24 1 82066 1.21853E-5 41033 0 5.03525E-4
19-4210084-G-A p.Gly390Gly synonymous ANKRD24 54 82052 6.58119E-4 41026 0 3.42209E-4
19-4210086-C-T p.Ala391Val missense ANKRD24 15 82060 1.82793E-4 41030 0 6.25782E-4
19-4210088-C-A p.Pro392Thr missense ANKRD24 2 82068 2.437E-5 41034 0 0.00100705
19-4210088-CCC-ACG p.Pro392Thr missense ANKRD24 25 82068 3.04625E-4 41034 0 NA
19-4210090-C-G p.Pro392Pro synonymous ANKRD24 2 82068 2.437E-5 41034 0 6.38284E-4
19-4210098-G-A p.Arg395Gln missense ANKRD24 3 82078 3.65506E-5 41039 0 3.19081E-5
19-4210098-G-C p.Arg395Pro missense ANKRD24 1 82078 1.21835E-5 41039 0 6.58039E-5
19-4210104-C-T p.Ala397Val missense ANKRD24 3 81980 3.65943E-5 40990 0 6.25E-4
19-4210105-G-A p.Ala397Ala synonymous ANKRD24 1 81960 1.22011E-5 40980 0 2.05966E-5
19-4210111-A-T p.Pro399Pro synonymous ANKRD24 2 81884 2.44248E-5 40942 0 NA
19-4210117-C-T p.Pro401Pro synonymous ANKRD24 1 82068 1.2185E-5 41034 0 6.37714E-5
19-4210128-C-T p.Pro405Leu missense ANKRD24 1 82036 1.21898E-5 41018 0 NA
19-4210134-C-T p.Pro407Leu missense+splice_region ANKRD24 22 81976 2.68371E-4 40988 0 3.82458E-4
19-4210135-G-A p.Pro407Pro splice_region+synonymous ANKRD24 155 81976 0.0018908 40988 0 0.00359182
19-4210138-G-A c.1221+3G>A splice_region ANKRD24 1 81958 1.22014E-5 40979 0 NA
19-4210142-G-A c.1221+7G>A splice_region ANKRD24 2 81940 2.44081E-5 40970 0 NA
19-4210263-A-G p.Asp408Gly missense+splice_region ANKRD24 1 81396 1.22856E-5 40698 0 NA
19-4210279-T-C p.Tyr413Tyr synonymous ANKRD24 1 81352 1.22923E-5 40676 0 3.19203E-5
19-4210280-G-A p.Glu414Lys missense ANKRD24 10 81342 1.22938E-4 40671 0 1.0694E-4
19-4210285-G-C p.Glu415Asp missense ANKRD24 1 81342 1.22938E-5 40671 0 NA
19-4210288-C-T p.Ile416Ile synonymous ANKRD24 4 81250 4.92308E-5 40625 0 1.914E-4
19-4210294-G-A p.Arg418Arg synonymous ANKRD24 1 81246 1.23083E-5 40623 0 NA
19-4210298-C-T p.Arg420Trp missense ANKRD24 1 81160 1.23213E-5 40580 0 4.87962E-6
19-4210313-C-T p.Arg425Cys missense ANKRD24 2 81050 2.46761E-5 40525 0 5.10199E-6
19-4210313-C-A p.Arg425Ser missense ANKRD24 2 81050 2.46761E-5 40525 0 3.18776E-5
19-4210314-G-A p.Arg425His missense ANKRD24 4 81014 4.93742E-5 40507 0 5.62525E-5
19-4210319-C-T p.Leu427Leu synonymous ANKRD24 1 81076 1.23341E-5 40538 0 5.16262E-6
19-4210321-G-A p.Leu427Leu synonymous ANKRD24 5 81058 6.16842E-5 40529 0 5.62841E-5
19-4210323-A-C p.Gln428Pro missense ANKRD24 1 81068 1.23353E-5 40534 0 NA
19-4210331-C-T p.Arg431Trp missense ANKRD24 32 81006 3.95032E-4 40503 0 0.00489111
19-4210332-G-A p.Arg431Gln missense ANKRD24 1 81040 1.23396E-5 40520 0 NA
19-4210333-G-A p.Arg431Arg synonymous ANKRD24 5 81050 6.16903E-5 40525 0 9.55597E-5
19-4210341-A-C p.Glu434Ala missense ANKRD24 1 81050 1.23381E-5 40525 0 NA
19-4210349-A-G p.Lys437Glu missense ANKRD24 4 81052 4.9351E-5 40526 0 6.12033E-5
19-4210350-A-G p.Lys437Arg missense ANKRD24 1 81052 1.23378E-5 40526 0 3.09349E-5
19-4210355-C-T p.Arg439Trp missense ANKRD24 2 80992 2.46938E-5 40496 0 9.5432E-5
19-4210356-G-A p.Arg439Gln missense ANKRD24 46554 79530 0.585364 39765 13790 0.631716
19-4212466-C-T c.1330-6C>T splice_region ANKRD24 10 78134 1.27985E-4 39067 0 1.27413E-4
19-4212467-G-A c.1330-5G>A splice_region ANKRD24 2 78196 2.55768E-5 39098 0 1.37061E-4
19-4212473-C-G p.Ser444Cys missense+splice_region ANKRD24 1 78528 1.27343E-5 39264 0 NA
19-4212476-C-T p.Pro445Leu missense ANKRD24 3 78672 3.8133E-5 39336 0 2.59856E-5
19-4212477-G-A p.Pro445Pro synonymous ANKRD24 4 78784 5.07717E-5 39392 0 8.45452E-5
19-4212478-G-C p.Glu446Gln missense ANKRD24 2 78820 2.53743E-5 39410 0 6.36943E-5
19-4212486-C-T p.Ser448Ser synonymous ANKRD24 1 79024 1.26544E-5 39512 0 NA
19-4212493-C-T p.His451Tyr missense ANKRD24 265 79152 0.00334799 39576 1 0.0141271
19-4212498-C-T p.Ile452Ile synonymous ANKRD24 1 79206 1.26253E-5 39603 0 NA
19-4212501-G-T p.Leu453Leu synonymous ANKRD24 1 79224 1.26224E-5 39612 0 NA
19-4212505-A-G p.Arg455Gly missense ANKRD24 1 79108 1.26409E-5 39554 0 NA
19-4212511-G-A c.1368+1G>A splice_donor ANKRD24 1 79162 1.26323E-5 39581 0 5.83833E-6
19-4212515-G-C c.1368+5G>C splice_region ANKRD24 1 79096 1.26429E-5 39548 0 1.27437E-4
19-4212517-G-A c.1368+7G>A splice_region ANKRD24 1 79118 1.26393E-5 39559 0 NA
19-4212593-C-T c.1369-4C>T splice_region ANKRD24 1 79586 1.2565E-5 39793 0 NA
19-4212596-G-A c.1369-1G>A splice_acceptor ANKRD24 1 79612 1.25609E-5 39806 0 NA
19-4212599-G-T p.Val457Val splice_region+synonymous ANKRD24 1 79672 1.25515E-5 39836 0 NA
19-4212627-A-G p.Arg467Gly missense ANKRD24 1 80078 1.24878E-5 40039 0 NA
19-4212630-C-G p.Gln468Glu missense ANKRD24 2 80138 2.49569E-5 40069 0 0.00112867
19-4212630-CAA-C p.Gln468fs frameshift ANKRD24 2 80138 2.49569E-5 40069 0 3.18695E-5
19-4212636-GAGA-G p.Lys471del conservative_inframe_deletion ANKRD24 8 80296 9.96314E-5 40148 0 3.2132E-5
19-4212650-G-C p.Leu474Leu synonymous ANKRD24 1 80336 1.24477E-5 40168 0 NA
19-4212654-C-T p.Arg476Trp missense ANKRD24 1 80314 1.24511E-5 40157 0 1.2879E-5
19-4212655-G-A p.Arg476Gln missense ANKRD24 1 80344 1.24465E-5 40172 0 6.44023E-6
19-4212659-G-A p.Glu477Glu synonymous ANKRD24 2 80372 2.48843E-5 40186 0 NA
19-4212678-C-T p.Arg484Trp missense ANKRD24 1 80220 1.24657E-5 40110 0 9.87947E-5
19-4212697-T-C c.1467+2T>C splice_donor ANKRD24 1 79772 1.25357E-5 39886 0 1.29557E-5
19-4212698-A-G c.1467+3A>G splice_region ANKRD24 1 79756 1.25382E-5 39878 0 6.48088E-6
19-4215966-TC-T c.1468-8delC splice_region ANKRD24 1 80882 1.23637E-5 40441 0 2.57719E-5
19-4215967-C-G c.1468-8C>G splice_region ANKRD24 1 80970 1.23503E-5 40485 0 3.46308E-5
19-4215971-C-A c.1468-4C>A splice_region ANKRD24 2 81014 2.46871E-5 40507 0 6.38896E-5
19-4215971-C-G c.1468-4C>G splice_region ANKRD24 4 81014 4.93742E-5 40507 0 2.5392E-4
19-4215972-C-G c.1468-3C>G splice_region ANKRD24 1 81050 1.23381E-5 40525 0 3.1209E-5
19-4215972-C-A c.1468-3C>A splice_region ANKRD24 2 81050 2.46761E-5 40525 0 1.96269E-5
19-4215972-C-T c.1468-3C>T splice_region ANKRD24 1 81050 1.23381E-5 40525 0 NA
19-4215977-C-G p.Asn490Lys missense+splice_region ANKRD24 6 81164 7.39244E-5 40582 0 3.19489E-5
19-4215977-C-T p.Asn490Asn splice_region+synonymous ANKRD24 1 81164 1.23207E-5 40582 0 6.38978E-5
19-4215981-C-T p.Arg492Trp missense ANKRD24 1 81248 1.2308E-5 40624 0 0.0015121
19-4215981-CG-C p.Glu493fs frameshift ANKRD24 1 81248 1.2308E-5 40624 0 NA
19-4215982-G-A p.Arg492Gln missense ANKRD24 2 81324 2.4593E-5 40662 0 2.63227E-5
19-4215989-T-C p.Asn494Asn synonymous ANKRD24 697 81404 0.00856223 40702 6 0.0159234
19-4215992-T-G p.Thr495Thr synonymous ANKRD24 1 81482 1.22726E-5 40741 0 NA
19-4215992-T-C p.Thr495Thr synonymous ANKRD24 1 81482 1.22726E-5 40741 0 6.25E-4
19-4216009-C-G p.Thr501Ser missense ANKRD24 1 81612 1.22531E-5 40806 0 NA
19-4216014-C-A p.Gln503Lys missense ANKRD24 3 81630 3.67512E-5 40815 0 NA
19-4216020-G-A p.Glu505Lys missense ANKRD24 2 81604 2.45086E-5 40802 0 2.03351E-5
19-4216032-C-T p.Leu509Leu synonymous ANKRD24 1 81558 1.22612E-5 40779 0 NA
19-4216034-G-A p.Leu509Leu synonymous ANKRD24 1 81526 1.2266E-5 40763 0 4.50714E-6
19-4216037-T-C p.Pro510Pro synonymous ANKRD24 3 81520 3.68008E-5 40760 0 4.13873E-5
19-4216038-G-A p.Asp511Asn missense ANKRD24 3 81524 3.6799E-5 40762 0 6.37959E-5
19-4216041-C-T p.Leu512Phe missense ANKRD24 1 81504 1.22693E-5 40752 0 4.19692E-5
19-4216045-C-T p.Pro513Leu missense+splice_region ANKRD24 1 81504 1.22693E-5 40752 0 2.16188E-5
19-4216052-GCCC-G c.1540+6_1540+8delCCC splice_region ANKRD24 1 81396 1.22856E-5 40698 0 4.79221E-6
19-4216285-C-T p.Ala515Ala synonymous ANKRD24 1 81422 1.22817E-5 40711 0 5.15305E-5
19-4216286-G-A p.Glu516Lys missense ANKRD24 4 81464 4.91014E-5 40732 0 1.26576E-5
19-4216287-A-T p.Glu516Val missense ANKRD24 2 81472 2.45483E-5 40736 0 NA
19-4216301-A-G p.Arg521Gly missense ANKRD24 2 81622 2.45032E-5 40811 0 2.4542E-5
19-4216305-A-T p.Gln522Leu missense ANKRD24 1 81652 1.22471E-5 40826 0 NA
19-4216314-C-T p.Pro525Leu missense ANKRD24 38 81688 4.65185E-4 40844 0 0.00151668
19-4216315-G-A p.Pro525Pro synonymous ANKRD24 15 81688 1.83625E-4 40844 0 0.001875
19-4216317-C-T p.Ser526Leu missense ANKRD24 8 81702 9.79168E-5 40851 0 1.35906E-4
19-4216318-G-T p.Ser526Ser synonymous ANKRD24 8599 81562 0.105429 40781 481 0.148232
19-4216318-G-A p.Ser526Ser synonymous ANKRD24 1 81708 1.22387E-5 40854 0 NA
19-4216322-C-T p.Gln528* stop_gained ANKRD24 1 81740 1.22339E-5 40870 0 NA
19-4216323-AG-A p.Glu529fs frameshift ANKRD24 1 81742 1.22336E-5 40871 0 NA
19-4216330-C-T p.His530His synonymous ANKRD24 1 81756 1.22315E-5 40878 0 NA
19-4216332-T-C p.Leu531Pro missense ANKRD24 1 81772 1.22291E-5 40886 0 3.97046E-5
19-4216333-G-A p.Leu531Leu synonymous ANKRD24 1 81768 1.22297E-5 40884 0 NA
19-4216334-G-A p.Ala532Thr missense ANKRD24 3 81766 3.66901E-5 40883 0 6.37714E-5
19-4216338-C-T p.Ser533Leu missense ANKRD24 93 81782 0.00113717 40891 1 0.00235909
19-4216339-G-A p.Ser533Ser synonymous ANKRD24 1 81788 1.22267E-5 40894 0 0.00151362
19-4216386-T-C p.Met549Thr missense ANKRD24 1 81842 1.22187E-5 40921 0 2.55102E-4
19-4216387-G-A p.Met549Ile missense ANKRD24 27 81850 3.29872E-4 40925 0 0.0010101
19-4216397-C-G p.Gln553Glu missense+splice_region ANKRD24 1 81806 1.2224E-5 40903 0 NA
19-4216401-T-C c.1659+2T>C splice_donor ANKRD24 2 81792 2.44523E-5 40896 0 NA
19-4216547-A-G p.Ile554Val missense+splice_region ANKRD24 1 81898 1.22103E-5 40949 0 8.40018E-6
19-4216549-C-T p.Ile554Ile splice_region+synonymous ANKRD24 2 81916 2.44153E-5 40958 0 NA
19-4216556-A-ATC p.Asn557fs frameshift ANKRD24 1 82018 1.21924E-5 41009 0 1.31168E-5
19-4216556-A-C p.Asn557His missense ANKRD24 1 82018 1.21924E-5 41009 0 4.14302E-6
19-4216567-G-C p.Lys560Asn missense ANKRD24 52 82122 6.33204E-4 41061 0 4.88095E-4
19-4216570-C-T n.567C>T splice_region ANKRD24 3 82106 3.65381E-5 41053 0 6.25E-4
19-4216571-G-A p.Glu562Lys missense ANKRD24 20 82142 2.43481E-4 41071 0 0.00379053
19-4216582-G-T p.Met565Ile missense ANKRD24 42 82196 5.10974E-4 41098 0 0.00100705
19-4216588-G-A p.Val567Val synonymous ANKRD24 1 82218 1.21628E-5 41109 0 1.1198E-5
19-4216602-A-G p.Glu572Gly missense ANKRD24 1 82244 1.21589E-5 41122 0 6.81632E-5
19-4216611-C-G p.Pro575Arg missense ANKRD24 1 82254 1.21575E-5 41127 0 1.18366E-5
19-4216611-C-T p.Pro575Leu missense ANKRD24 2 82254 2.43149E-5 41127 0 8.21038E-6
19-4216616-G-C p.Ala577Pro missense ANKRD24 1 82240 1.21595E-5 41120 0 NA
19-4216619-C-T p.Leu578Phe missense ANKRD24 1 82254 1.21575E-5 41127 0 NA
19-4216634-C-T p.Arg583Trp missense ANKRD24 1 82242 1.21592E-5 41121 0 1.68101E-5
19-4216639-C-G p.Ala584Ala synonymous ANKRD24 1 82234 1.21604E-5 41117 0 NA
19-4216640-G-A p.Glu585Lys missense ANKRD24 23 82226 2.79717E-4 41113 0 1.09272E-4
19-4216646-G-C p.Asp587His missense ANKRD24 7 82224 8.51333E-5 41112 1 3.27775E-4
19-4216646-G-A p.Asp587Asn missense ANKRD24 1 82226 1.21616E-5 41113 0 8.64738E-6
19-4216655-C-T p.Arg590Cys missense ANKRD24 43 82166 5.23331E-4 41083 0 0.00156101
19-4216656-G-A p.Arg590His missense ANKRD24 1 82166 1.21705E-5 41083 0 6.37186E-5
19-4216666-C-T p.His593His synonymous ANKRD24 4 82076 4.87353E-5 41038 0 0.00125
19-4216681-G-C p.Gln598His missense ANKRD24 1 81982 1.21978E-5 40991 0 NA
19-4216703-C-T p.Arg606* stop_gained ANKRD24 1 81796 1.22255E-5 40898 0 5.19686E-6
19-4216710-T-A p.Val608Asp missense ANKRD24 1 81716 1.22375E-5 40858 0 5.26521E-6
19-4216712-C-T p.Pro609Ser missense ANKRD24 1 81734 1.22348E-5 40867 0 3.18573E-5
19-4216722-AG-A p.Ala614fs frameshift ANKRD24 1 81718 1.22372E-5 40859 0 3.18512E-5
19-4216726-G-A p.Gly613Gly synonymous ANKRD24 17 81734 2.07992E-4 40867 0 0.00162508
19-4216735-T-TG p.Glu618fs frameshift ANKRD24 1 81740 1.22339E-5 40870 0 NA
19-4216737-G-A p.Gly617Glu missense ANKRD24 4 81724 4.89452E-5 40862 0 NA
19-4216739-G-A p.Glu618Lys missense ANKRD24 2 81730 2.44708E-5 40865 0 1.03451E-5
19-4216761-C-T p.Thr625Met missense ANKRD24 10 81608 1.22537E-4 40804 0 1.11537E-4
19-4216762-G-A p.Thr625Thr synonymous ANKRD24 1 81600 1.22549E-5 40800 0 4.40859E-5
19-4216764-C-T p.Ala626Val missense ANKRD24 1 81568 1.22597E-5 40784 0 2.15787E-5
19-4216764-C-A p.Ala626Asp missense ANKRD24 2 81568 2.45194E-5 40784 0 NA
19-4216766-A-C p.Thr627Pro missense ANKRD24 2 81576 2.4517E-5 40788 0 0.00125
19-4216766-A-T p.Thr627Ser missense ANKRD24 1 81576 1.22585E-5 40788 0 NA
19-4216774-C-T p.Asn629Asn synonymous ANKRD24 16 81534 1.96237E-4 40767 0 0.0020141
19-4216775-G-A p.Gly630Arg missense ANKRD24 2 81496 2.45411E-5 40748 0 1.97457E-5
19-4216777-G-A p.Gly630Gly synonymous ANKRD24 2 81510 2.45369E-5 40755 0 9.10763E-6
19-4216787-A-G p.Met634Val missense ANKRD24 5 81456 6.13828E-5 40728 0 1.76604E-5
19-4216793-C-T p.Leu636Leu synonymous ANKRD24 1 81344 1.22935E-5 40672 0 3.18552E-5
19-4216800-G-T p.Gly638Val missense ANKRD24 2 81236 2.46196E-5 40618 0 3.27429E-5
19-4216808-G-C p.Ala641Pro missense ANKRD24 2 81002 2.46907E-5 40501 0 1.8554E-4
19-4216820-A-G p.Lys645Glu missense ANKRD24 1 80960 1.23518E-5 40480 0 1.27364E-4
19-4216828-C-T p.Asn647Asn synonymous ANKRD24 22 80828 2.72183E-4 40414 0 4.05038E-4
19-4216829-G-A p.Gly648Arg missense ANKRD24 645 80804 0.00798228 40402 18 0.016758
19-4216834-C-T p.Ala649Ala synonymous ANKRD24 7 80670 8.67733E-5 40335 0 2.97133E-4
19-4216835-G-A p.Glu650Lys missense ANKRD24 9 80652 1.11591E-4 40326 0 1.59752E-4
19-4216839-C-G p.Thr651Ser missense ANKRD24 2 80606 2.4812E-5 40303 0 NA
19-4216841-A-G p.Ile652Val missense ANKRD24 1 80634 1.24017E-5 40317 0 1.19155E-5
19-4216850-G-A p.Glu655Lys missense ANKRD24 1 80536 1.24168E-5 40268 0 3.18593E-5
19-4216852-G-A p.Glu655Glu synonymous ANKRD24 1 80528 1.2418E-5 40264 0 4.12759E-6
19-4216853-G-C p.Ala656Pro missense ANKRD24 1 80498 1.24227E-5 40249 0 8.25893E-6
19-4216854-C-T p.Ala656Val missense ANKRD24 1 80468 1.24273E-5 40234 0 3.18492E-5
19-4216859-G-A p.Gly658Arg missense ANKRD24 2 80478 2.48515E-5 40239 0 3.35999E-5
19-4216864-T-C p.Asp659Asp synonymous ANKRD24 1 80444 1.2431E-5 40222 0 NA
19-4216877-G-T p.Ala664Ser missense ANKRD24 12 80458 1.49146E-4 40229 0 0.00100908
19-4216881-G-C p.Arg665Thr missense ANKRD24 2 80520 2.48385E-5 40260 0 NA
19-4216890-A-AAGCTGAGGCCACGGGAGCCGAGGCCACGGG p.Thr682_Gly683insGlyAlaGluAlaThrGlyAlaGluAlaThr disruptive_inframe_insertion ANKRD24 5 80600 6.20347E-5 40300 0 6.37308E-5
19-4216891-A-G p.Glu668Glu synonymous ANKRD24 2 80606 2.4812E-5 40303 0 2.09754E-5
19-4216894-T-TGAGGCCACGGGAGCC p.Ala679_Glu680insGluAlaThrGlyAla disruptive_inframe_insertion ANKRD24 2 80604 2.48127E-5 40302 0 1.04694E-5
19-4216894-TGAGGCCACGGGAGCC-T p.Glu675_Ala679del disruptive_inframe_deletion ANKRD24 19 80604 2.3572E-4 40302 0 2.93145E-4
19-4216894-T-C p.Ala669Ala synonymous ANKRD24 2 80604 2.48127E-5 40302 0 1.23902E-5
19-4216895-G-A p.Glu670Lys missense ANKRD24 1 80608 1.24057E-5 40304 0 NA
19-4216896-A-C p.Glu670Ala missense ANKRD24 1 80612 1.24051E-5 40306 0 1.2751E-4
19-4216902-C-T p.Thr672Met missense ANKRD24 15 80572 1.86169E-4 40286 0 1.76345E-4
19-4216903-GGGAGCCGAGGCCACGGGAGCTGAGGCCACA-G p.Glu675_Ala684del conservative_inframe_deletion ANKRD24 2 80636 2.48028E-5 40318 0 2.86898E-4
19-4216909-CG-C p.Glu675fs frameshift ANKRD24 9 80692 1.11535E-4 40346 0 3.31958E-5
19-4216909-C-CAA p.Glu675fs frameshift ANKRD24 3 80690 3.71793E-5 40345 0 6.63917E-5
19-4216909-CGAGGCCACGGGAGCT-C p.Gly678_Thr682del disruptive_inframe_deletion ANKRD24 4 80692 4.95712E-5 40346 0 6.16092E-5
19-4216910-G-A p.Glu675Lys missense ANKRD24 57856 80290 0.720588 40145 21011 0.751297
19-4216910-G-GGCCACGGGAGCTGAGGCCACGGGAGCCA p.Glu675fs frameshift ANKRD24 2 80728 2.47746E-5 40364 0 6.39264E-5
19-4216910-G-GAGGCCACGGGAGCCA p.Ala679_Glu680insLysAlaThrGlyAla disruptive_inframe_insertion ANKRD24 1 80726 1.23876E-5 40363 0 1.12024E-4
19-4216911-AGGCCACGGGAGCTG-A p.Ala676fs frameshift ANKRD24 9 80736 1.11474E-4 40368 0 3.67654E-5
19-4216912-G-T p.Glu675Asp missense ANKRD24 1 80756 1.2383E-5 40378 0 NA
19-4216917-C-T p.Thr677Met missense ANKRD24 3 80768 3.71434E-5 40384 0 6.25782E-4
19-4216918-GGGAGCTGAGGCCACA-G p.Glu680_Ala684del disruptive_inframe_deletion ANKRD24 2 80812 2.47488E-5 40406 0 9.56877E-5
19-4216918-G-A p.Thr677Thr synonymous ANKRD24 2 80812 2.47488E-5 40406 0 6.37918E-5
19-4216924-T-C p.Ala679Ala synonymous ANKRD24 26 80860 3.21543E-4 40430 0 6.71184E-4
19-4216925-G-A p.Glu680Lys missense ANKRD24 1 80884 1.23634E-5 40442 0 9.21914E-6
19-4216930-C-T p.Ala681Ala synonymous ANKRD24 5 80918 6.17909E-5 40459 0 NA
19-4216931-A-G p.Thr682Ala missense ANKRD24 430 80906 0.00531481 40453 7 0.0114825
19-4216933-A-G p.Thr682Thr synonymous ANKRD24 14 80948 1.72951E-4 40474 0 5.7867E-5
19-4216936-A-G p.Gly683Gly synonymous ANKRD24 2 80934 2.47115E-5 40467 0 4.12575E-6
19-4216939-CA-TG p.AlaLys684AlaGlu missense ANKRD24 1 81000 1.23457E-5 40500 0 NA
19-4216941-A-G p.Lys685Arg missense ANKRD24 3 81024 3.70261E-5 40512 0 3.18634E-5
19-4216942-G-A p.Lys685Lys synonymous ANKRD24 1 81034 1.23405E-5 40517 0 NA
19-4216944-T-C p.Val686Ala missense ANKRD24 7 81000 8.64198E-5 40500 0 3.30101E-5
19-4216949-GAAAC-G p.Thr689fs frameshift ANKRD24 2 81072 2.46694E-5 40536 0 3.18492E-5
19-4216952-A-C p.Thr689Pro missense ANKRD24 2 81128 2.46524E-5 40564 0 9.16658E-6
19-4216955-A-G p.Lys690Glu missense ANKRD24 2 81160 2.46427E-5 40580 0 1.22941E-5
19-4216979-G-A p.Glu698Lys missense ANKRD24 2 81376 2.45773E-5 40688 0 8.9633E-6
19-4216981-A-C p.Glu698Asp missense ANKRD24 2 81416 2.45652E-5 40708 0 5.04032E-4
19-4216984-G-A p.Met699Ile missense ANKRD24 3 81442 3.6836E-5 40721 0 4.05755E-6
19-4216987-G-T p.Glu700Asp missense ANKRD24 4 81482 4.90906E-5 40741 0 NA
19-4216994-G-C p.Glu703Gln missense ANKRD24 2 81486 2.45441E-5 40743 0 NA
19-4217000-G-A p.Glu705Lys missense ANKRD24 1 81522 1.22666E-5 40761 0 3.18471E-5
19-4217001-A-C p.Glu705Ala missense ANKRD24 11 81522 1.34933E-4 40761 0 1.38978E-4
19-4217003-G-A p.Ala706Thr missense ANKRD24 1 81514 1.22678E-5 40757 0 NA
19-4217006-A-G p.Asn707Asp missense ANKRD24 11 81568 1.34857E-4 40784 0 1.27462E-4
19-4217017-T-G p.Thr710Thr synonymous ANKRD24 1 81470 1.22745E-5 40735 0 NA
19-4217026-A-G p.Thr713Thr synonymous ANKRD24 1 81362 1.22908E-5 40681 0 NA
19-4217043-A-G p.Asp719Gly missense ANKRD24 1 81008 1.23445E-5 40504 0 NA
19-4217046-C-A p.Thr720Lys missense ANKRD24 21 80906 2.5956E-4 40453 0 1.91131E-4
19-4217051-ACCACGGGAGTGGAGG-A p.Thr723_Ala727del disruptive_inframe_deletion ANKRD24 1 80726 1.23876E-5 40363 0 8.37058E-6
19-4217055-C-T p.Thr723Met missense ANKRD24 2 80564 2.4825E-5 40282 0 1.17176E-4
19-4217056-G-A p.Thr723Thr synonymous ANKRD24 1453 80494 0.018051 40247 88 0.041579
19-4217058-G-A p.Gly724Glu missense ANKRD24 380 80546 0.0047178 40273 7 0.0112782
19-4217058-G-C p.Gly724Ala missense ANKRD24 1 80564 1.24125E-5 40282 0 4.03317E-6
19-4217059-AGTGGAGGCCATGGGG-A p.Met728_Ala732del disruptive_inframe_deletion ANKRD24 3 80494 3.72699E-5 40247 0 7.66308E-5
19-4217066-G-A p.Ala727Thr missense ANKRD24 3 80214 3.74E-5 40107 0 4.03525E-6
19-4217071-G-A p.Met728Ile missense ANKRD24 1 80190 1.24704E-5 40095 0 2.51324E-5
19-4217080-G-A p.Glu731Glu synonymous ANKRD24 6 79968 7.503E-5 39984 0 1.27535E-4
19-4217081-G-T p.Ala732Ser missense ANKRD24 2 79856 2.50451E-5 39928 0 NA
19-4217082-C-T p.Ala732Val missense ANKRD24 1 79822 1.25279E-5 39911 0 NA
19-4217087-AAAAC-A p.Thr735fs frameshift ANKRD24 1 80004 1.24994E-5 40002 0 1.21059E-5
19-4217093-A-G p.Lys736Glu missense ANKRD24 2 80090 2.49719E-5 40045 0 4.03457E-6
19-4217096-G-A p.Ala737Thr missense ANKRD24 41 80030 5.12308E-4 40015 0 0.00151057
19-4217099-G-A p.Glu738Lys missense ANKRD24 2 80118 2.49632E-5 40059 0 1.61407E-5
19-4217102-G-C p.Glu739Gln missense ANKRD24 5 80122 6.24048E-5 40061 0 8.06972E-6
19-4217102-G-A p.Glu739Lys missense ANKRD24 1 80124 1.24807E-5 40062 0 NA
19-4217108-G-A p.Glu741Lys missense ANKRD24 1 80266 1.24586E-5 40133 0 8.06881E-6
19-4217115-A-G p.Gln743Arg missense ANKRD24 1 80420 1.24347E-5 40210 0 1.71002E-5
19-4217122-C-G p.Tyr745* stop_gained ANKRD24 3 80442 3.7294E-5 40221 0 NA
19-4217122-C-T p.Tyr745Tyr synonymous ANKRD24 1 80442 1.24313E-5 40221 0 8.60837E-6
19-4217123-G-A p.Gly746Arg missense ANKRD24 17 80556 2.11033E-4 40278 0 1.46461E-4
19-4217140-A-G p.Gln751Gln synonymous ANKRD24 1 80846 1.23692E-5 40423 0 NA
19-4217147-C-A p.Pro754Thr missense ANKRD24 1 80890 1.23625E-5 40445 0 8.88131E-6
19-4217152-A-G p.Pro755Pro synonymous ANKRD24 1 81032 1.23408E-5 40516 0 NA
19-4217161-G-A p.Gly758Gly synonymous ANKRD24 1 81084 1.23329E-5 40542 0 4.06914E-5
19-4217171-A-G p.Met762Val missense ANKRD24 3 81176 3.69567E-5 40588 0 1.59612E-4
19-4217174-G-C p.Glu763Gln missense ANKRD24 2 81144 2.46475E-5 40572 0 9.10515E-6
19-4217178-C-T p.Ala764Val missense ANKRD24 2 81030 2.46822E-5 40515 0 NA
19-4217178-C-G p.Ala764Gly missense ANKRD24 3 81030 3.70233E-5 40515 0 3.18674E-5
19-4217181-C-T p.Thr765Met missense ANKRD24 1 81050 1.23381E-5 40525 0 9.23805E-6
19-4217182-G-A p.Thr765Thr synonymous ANKRD24 3 81128 3.69786E-5 40564 0 9.56145E-5
19-4217184-G-C p.Gly766Ala missense ANKRD24 1 81034 1.23405E-5 40517 0 9.24214E-6
19-4217207-T-G p.Ser774Ala missense ANKRD24 70949 75906 0.934696 37953 33199 0.965
19-4217207-T-A p.Ser774Thr missense ANKRD24 2 81186 2.46348E-5 40593 0 NA
19-4217220-G-C p.Ser778Thr missense ANKRD24 77 81230 9.47926E-4 40615 1 4.5595E-4
19-4217221-T-G p.Ser778Arg missense ANKRD24 1 81266 1.23053E-5 40633 0 3.01696E-5
19-4217224-C-T p.Ala779Ala synonymous ANKRD24 1 81284 1.23025E-5 40642 0 1.54569E-5
19-4217225-A-G p.Thr780Ala missense ANKRD24 1 81276 1.23038E-5 40638 0 4.48254E-6
19-4217237-A-C p.Asn784His missense ANKRD24 1 81316 1.22977E-5 40658 0 NA
19-4217256-C-T p.Thr790Met missense ANKRD24 4 81334 4.91799E-5 40667 0 0.0020202
19-4217258-G-A p.Val791Ile missense ANKRD24 1 81318 1.22974E-5 40659 0 5.47226E-6
19-4217263-G-A p.Pro792Pro synonymous ANKRD24 1 81310 1.22986E-5 40655 0 7.50205E-5
19-4217266-G-GA p.Ile794fs frameshift ANKRD24 1 81308 1.22989E-5 40654 0 3.74195E-5
19-4217266-G-C p.Gly793Gly synonymous ANKRD24 2 81308 2.45978E-5 40654 0 NA
19-4217268-T-C p.Ile794Thr missense ANKRD24 2 81338 2.45888E-5 40669 0 NA
19-4217269-C-A p.Ile794Ile synonymous ANKRD24 9 81360 1.10619E-4 40680 0 0.0020284
19-4217271-C-T p.Ser795Phe missense ANKRD24 1 81342 1.22938E-5 40671 0 3.97931E-5
19-4217275-T-C p.Ala796Ala synonymous ANKRD24 2 81316 2.45954E-5 40658 0 6.06789E-6
19-4217280-C-G p.Pro798Arg missense ANKRD24 1 81316 1.22977E-5 40658 0 6.14658E-6
19-4217299-C-T p.Ala804Ala synonymous ANKRD24 6 81214 7.38789E-5 40607 0 2.54366E-5
19-4217310-C-T p.Ser808Leu missense ANKRD24 1 81166 1.23204E-5 40583 0 3.18674E-5
19-4217311-G-A p.Ser808Ser synonymous ANKRD24 1 81134 1.23253E-5 40567 0 0.00209424
19-4217353-G-T p.Leu822Phe missense ANKRD24 3 80532 3.72523E-5 40266 0 5.73329E-5
19-4217362-T-C p.Ala825Ala synonymous ANKRD24 5 80214 6.23333E-5 40107 0 5.9609E-5
19-4217366-C-T p.Arg827Trp missense ANKRD24 3 80058 3.74728E-5 40029 0 1.27453E-4
19-4217372-C-T p.Arg829Trp missense ANKRD24 1 79842 1.25247E-5 39921 0 6.69568E-6
19-4217379-G-A p.Arg831Gln missense ANKRD24 1 79738 1.25411E-5 39869 0 1.33973E-5
19-4217379-GGGAGGCAGCTGCGGAGCT-G p.Ala834_Ala839del disruptive_inframe_deletion ANKRD24 1 79738 1.25411E-5 39869 0 6.3589E-5
19-4217388-C-G p.Ala834Gly missense ANKRD24 3 79328 3.78177E-5 39664 0 6.73074E-6
19-4217404-G-C p.Ala839Ala synonymous ANKRD24 2 78584 2.54505E-5 39292 0 6.81004E-6
19-4217411-G-A p.Gly842Arg missense ANKRD24 1 78220 1.27845E-5 39110 0 NA
19-4217419-CGAGGCCGCG-C p.Ala847_Ala849del disruptive_inframe_deletion ANKRD24 7 77420 9.04159E-5 38710 0 1.40645E-5
19-4217419-C-T p.Cys844Cys synonymous ANKRD24 2 77420 2.58331E-5 38710 0 1.40645E-5
19-4217426-G-C p.Ala847Pro missense ANKRD24 1 76288 1.31082E-5 38144 0 NA
19-4217427-C-T p.Ala847Val missense ANKRD24 1 76126 1.31361E-5 38063 0 2.04248E-4
19-4217428-G-A p.Ala847Ala synonymous ANKRD24 4 76098 5.25638E-5 38049 0 7.28205E-6
19-4217434-C-T p.Ala849Ala synonymous ANKRD24 1 75220 1.32943E-5 37610 0 7.91866E-6
19-4217435-G-A p.Glu850Lys missense ANKRD24 1 75142 1.33081E-5 37571 0 NA
19-4217437-G-A p.Glu850Glu synonymous ANKRD24 1 74970 1.33387E-5 37485 0 7.95925E-6
19-4217439-C-T p.Ala851Val missense ANKRD24 1 74618 1.34016E-5 37309 0 NA
19-4217440-A-G p.Ala851Ala synonymous ANKRD24 16 74528 2.14684E-4 37264 0 7.99795E-4
19-4217442-G-A p.Gly852Asp missense ANKRD24 1 74200 1.34771E-5 37100 0 NA
19-4217456-C-A p.Arg857Ser missense ANKRD24 1 71978 1.38931E-5 35989 0 NA
19-4217463-G-A p.Arg859His missense ANKRD24 1 70756 1.41331E-5 35378 0 2.64866E-5
19-4217469-C-T p.Ala861Val missense ANKRD24 2 69554 2.87546E-5 34777 0 NA
19-4217472-A-AGGGCAGCGG p.Gly863_Gly865dup disruptive_inframe_insertion ANKRD24 3 68918 4.353E-5 34459 0 1.78616E-5
19-4217479-CGGGGCCAGCGGGGGCGGT-C p.Ala866_Gly871del disruptive_inframe_deletion ANKRD24 1 67396 1.48377E-5 33698 0 NA
19-4217479-C-T p.Ser864Ser synonymous ANKRD24 1 67396 1.48377E-5 33698 0 4.94291E-5
19-4217481-G-A p.Gly865Glu missense ANKRD24 1 67248 1.48703E-5 33624 0 NA
19-4217483-GC-G p.Ser867fs frameshift ANKRD24 1 66820 1.49656E-5 33410 0 3.21337E-5
19-4217486-A-AGCGGGG p.Gly869_Gly870dup disruptive_inframe_insertion ANKRD24 4 66404 6.02373E-5 33202 0 6.43583E-5
19-4217488-C-T p.Ser867Ser synonymous ANKRD24 1 65692 1.52226E-5 32846 0 2.84673E-5
19-4217491-G-GGGCGGT p.Gly871_Gly872dup disruptive_inframe_insertion ANKRD24 1 65196 1.53384E-5 32598 0 NA
19-4217494-C-T p.Gly869Gly synonymous ANKRD24 2 64272 3.11178E-5 32136 0 3.46428E-5
19-4217495-G-A p.Gly870Ser missense ANKRD24 1 63958 1.56353E-5 31979 0 6.86766E-5
19-4217497-T-G p.Gly870Gly synonymous ANKRD24 1 63566 1.57317E-5 31783 0 NA
19-4217498-G-A p.Gly871Ser missense ANKRD24 3 63288 4.74024E-5 31644 0 NA
19-4217510-A-T p.Thr875Ser missense ANKRD24 10582 58282 0.181565 29141 825 0.296053
19-4217520-G-A p.Arg878Gln missense ANKRD24 1 57318 1.74465E-5 28659 0 NA
19-4217524-G-A p.Ala879Ala synonymous ANKRD24 2 55204 3.62293E-5 27602 0 3.23541E-5
19-4217527-C-T p.Ala880Ala synonymous ANKRD24 1 54606 1.8313E-5 27303 0 3.49E-4
19-4217531-G-T p.Glu882* stop_gained ANKRD24 1 54166 1.84618E-5 27083 0 NA
19-4217541-G-A p.Arg885Gln missense ANKRD24 158 51084 0.00309294 25542 1 0.0357143
19-4217548-C-T p.Asp887Asp synonymous ANKRD24 1 48642 2.05584E-5 24321 0 3.2495E-5
19-4217549-C-G p.Leu888Val missense ANKRD24 3 48482 6.18786E-5 24241 0 NA
19-4217567-C-T p.Arg894Cys missense ANKRD24 1 44866 2.22886E-5 22433 0 NA
19-4217570-C-T p.Leu895Leu synonymous ANKRD24 1 44588 2.24276E-5 22294 0 NA
19-4217571-T-A p.Leu895Gln missense ANKRD24 2 44352 4.50938E-5 22176 0 NA
19-4217576-G-C p.Glu897Gln missense ANKRD24 2426 43810 0.0553755 21905 85 0.0952381
19-4217582-G-C p.Glu899Gln missense ANKRD24 1 43028 2.32407E-5 21514 0 NA
19-4217587-G-A p.Ala900Ala synonymous ANKRD24 14194 40502 0.350452 20251 2518 0.53125
19-4217593-G-T p.Ser902Ser synonymous ANKRD24 2 40658 4.91908E-5 20329 0 NA
19-4217612-C-T p.Arg909Trp missense ANKRD24 2 37670 5.30926E-5 18835 0 6.5647E-5
19-4217614-G-A p.Arg909Arg synonymous ANKRD24 1 37728 2.65055E-5 18864 0 NA
19-4217617-C-A p.Ala910Ala synonymous ANKRD24 1 37008 2.70212E-5 18504 0 NA
19-4217621-C-G p.Arg912Gly missense ANKRD24 1 36184 2.76365E-5 18092 0 NA
19-4217621-C-T p.Arg912Trp missense ANKRD24 2 36184 5.5273E-5 18092 0 NA
19-4217623-G-C p.Arg912Arg synonymous ANKRD24 1 36004 2.77747E-5 18002 0 NA
19-4217643-C-CGCGGGGCCTGCGGGCCGA p.Arg920_Glu925dup disruptive_inframe_insertion ANKRD24 2 35000 5.71429E-5 17500 0 NA
19-4217644-G-T p.Ala919Ala synonymous ANKRD24 1 35100 2.849E-5 17550 0 NA
19-4217648-G-C p.Gly921Arg missense ANKRD24 2 35020 5.71102E-5 17510 0 6.58111E-5
19-4217655-G-C p.Arg923Pro missense ANKRD24 1 34402 2.90681E-5 17201 0 NA
19-4217663-C-T p.Leu926Leu synonymous ANKRD24 1 34352 2.91104E-5 17176 0 NA
19-4217663-C-G p.Leu926Val missense ANKRD24 1 34352 2.91104E-5 17176 0 NA
19-4217682-C-T p.Ala932Val missense ANKRD24 4 34300 1.16618E-4 17150 0 NA
19-4217700-G-A p.Arg938Gln missense ANKRD24 2 34528 5.7924E-5 17264 0 0.00275103
19-4217708-G-A p.Glu941Lys missense ANKRD24 1 34786 2.87472E-5 17393 0 NA
19-4217716-G-C p.Leu943Leu synonymous ANKRD24 36 34752 0.00103591 17376 0 0.00247052
19-4217720-G-C p.Glu945Gln missense ANKRD24 1 34732 2.87919E-5 17366 0 3.29294E-5
19-4217720-G-A p.Glu945Lys missense ANKRD24 1 34732 2.87919E-5 17366 0 3.29294E-5
19-4217725-G-T p.Gln946His missense ANKRD24 1 34698 2.88201E-5 17349 0 NA
19-4217726-C-A p.Leu947Met missense ANKRD24 1 34674 2.88401E-5 17337 0 NA
19-4217733-C-T p.Thr949Met missense ANKRD24 3 34768 8.62862E-5 17384 0 NA
19-4217734-G-A p.Thr949Thr synonymous ANKRD24 3 34814 8.61722E-5 17407 0 0.00191571
19-4217736-C-T p.Ala950Val missense ANKRD24 1 34814 2.87241E-5 17407 0 NA
19-4217746-G-A p.Thr953Thr synonymous ANKRD24 54 35288 0.00153027 17644 0 0.00806452
19-4217759-C-T p.Arg958Cys missense ANKRD24 1 35674 2.80316E-5 17837 0 NA
19-4217759-C-G p.Arg958Gly missense ANKRD24 1 35674 2.80316E-5 17837 0 NA
19-4217763-C-T p.Thr959Met missense ANKRD24 76 35686 0.00212969 17843 0 0.00616438
19-4217764-G-A p.Thr959Thr synonymous ANKRD24 5 35680 1.40135E-4 17840 0 1.32468E-4
19-4217772-C-T p.Ala962Val missense ANKRD24 1 35770 2.79564E-5 17885 0 NA
19-4217773-G-A p.Ala962Ala synonymous ANKRD24 1 35912 2.78458E-5 17956 0 3.30011E-5
19-4217780-G-A p.Gly965Ser missense ANKRD24 1 36786 2.71843E-5 18393 0 NA
19-4217784-G-A p.Arg966Gln missense ANKRD24 2 36996 5.40599E-5 18498 0 NA
19-4217789-C-T p.Arg968Trp missense ANKRD24 3 37060 8.09498E-5 18530 0 1.44134E-4
19-4217791-G-A p.Arg968Arg synonymous ANKRD24 1 37520 2.66525E-5 18760 0 NA
19-4217795-G-A p.Ala970Thr missense ANKRD24 1 37576 2.66127E-5 18788 0 6.89655E-4
19-4217827-G-A p.Ala980Ala synonymous ANKRD24 1 38962 2.5666E-5 19481 0 6.52273E-5
19-4217840-G-C p.Ala985Pro missense ANKRD24 2 39286 5.09087E-5 19643 0 1.71157E-5
19-4217841-C-T p.Ala985Val missense ANKRD24 1 39250 2.54777E-5 19625 0 1.71768E-5
19-4217843-C-T p.Arg986Trp missense ANKRD24 1 39380 2.53936E-5 19690 0 1.64279E-5
19-4217857-C-G p.Ala990Ala synonymous ANKRD24 1 39834 2.51042E-5 19917 0 NA
19-4217862-T-C p.Leu992Pro missense ANKRD24 1 40040 2.4975E-5 20020 0 NA
19-4217863-G-A p.Leu992Leu synonymous ANKRD24 2 40126 4.9843E-5 20063 0 NA
19-4217864-C-A p.Arg993Arg synonymous ANKRD24 22 40110 5.48492E-4 20055 0 0.0109409
19-4217872-C-T p.Ala995Ala synonymous ANKRD24 2 40424 4.94756E-5 20212 0 1.40323E-5
19-4217875-C-T p.Ser996Ser synonymous ANKRD24 1 40470 2.47097E-5 20235 0 1.3956E-5
19-4217885-C-A p.Arg1000Ser missense ANKRD24 1 41132 2.4312E-5 20566 0 NA
19-4217887-C-T p.Arg1000Arg synonymous ANKRD24 1 41298 2.42142E-5 20649 0 NA
19-4217887-C-G p.Arg1000Arg synonymous ANKRD24 1 41298 2.42142E-5 20649 0 NA
19-4217893-C-G p.Ser1002Ser synonymous ANKRD24 1 41646 2.40119E-5 20823 0 1.27737E-5
19-4217901-C-T p.Pro1005Leu missense ANKRD24 1 41998 2.38107E-5 20999 0 0.00127551
19-4217902-G-A p.Pro1005Pro synonymous ANKRD24 1 42116 2.37439E-5 21058 0 NA
19-4217907-CTG-C p.Glu1008fs frameshift ANKRD24 1 42506 2.35261E-5 21253 0 NA
19-4217919-G-A p.Arg1011Gln missense ANKRD24 1228 43252 0.0283918 21626 16 0.073709
19-4217929-G-C p.Glu1014Asp missense ANKRD24 1 44280 2.25836E-5 22140 0 1.03593E-5
19-4217931-A-C p.Glu1015Ala missense ANKRD24 6 44336 1.3533E-4 22168 0 2.56049E-4
19-4217931-AG-CC p.Glu1015Ala missense ANKRD24 1 44338 2.2554E-5 22169 0 NA
19-4217932-G-A p.Glu1015Glu synonymous ANKRD24 1 44470 2.24871E-5 22235 0 NA
19-4217945-C-T p.Arg1020Trp missense ANKRD24 1 45740 2.18627E-5 22870 0 1.59744E-4
19-4217947-G-A p.Arg1020Arg synonymous ANKRD24 2 46074 4.34084E-5 23037 0 NA
19-4217951-C-T p.Arg1022Trp missense ANKRD24 1 46168 2.166E-5 23084 0 NA
19-4217952-G-A p.Arg1022Gln missense ANKRD24 1 46240 2.16263E-5 23120 0 1.87822E-5
19-4217956-A-G p.Ala1023Ala synonymous ANKRD24 19187 45658 0.420233 22829 4237 0.472484
19-4217964-T-G p.Leu1026Arg missense ANKRD24 1 47924 2.08664E-5 23962 0 NA
19-4217964-T-C p.Leu1026Pro missense ANKRD24 1 47924 2.08664E-5 23962 0 NA
19-4217972-G-A p.Glu1029Lys missense ANKRD24 1 48776 2.05019E-5 24388 0 8.3282E-6
19-4217972-G-C p.Glu1029Gln missense ANKRD24 1 48776 2.05019E-5 24388 0 NA
19-4217975-G-T p.Val1030Leu missense ANKRD24 1 48948 2.04298E-5 24474 0 NA
19-4217977-G-T p.Val1030Val synonymous ANKRD24 1 49096 2.03683E-5 24548 0 NA
19-4217986-G-A p.Thr1033Thr synonymous ANKRD24 35 50044 6.99385E-4 25022 1 0.00217197
19-4217999-G-A p.Ala1038Thr missense ANKRD24 1 51560 1.93949E-5 25780 0 7.26639E-6
19-4217999-G-T p.Ala1038Ser missense ANKRD24 3 51560 5.81846E-5 25780 0 NA
19-4218008-C-T p.Arg1041Cys missense ANKRD24 2 52966 3.77601E-5 26483 0 0.00155763
19-4218011-G-A p.Ala1042Thr missense ANKRD24 2 53658 3.72731E-5 26829 0 5.1557E-5
19-4218013-G-A p.Ala1042Ala synonymous ANKRD24 9 54122 1.66291E-4 27061 0 5.58319E-4
19-4218022-G-A p.Glu1045Glu synonymous ANKRD24 1 55370 1.80603E-5 27685 0 6.23434E-6
19-4218023-C-A p.Arg1046Arg synonymous ANKRD24 4 55320 7.23066E-5 27660 0 3.12285E-5
19-4218040-C-T p.Ser1051Ser synonymous ANKRD24 22 56758 3.87611E-4 28379 0 0.00309278
19-4218041-G-A p.Val1052Met missense ANKRD24 2 57078 3.50398E-5 28539 0 8.97827E-5
19-4218051-C-G p.Ser1055Trp missense ANKRD24 6 57490 1.04366E-4 28745 0 0.00125
19-4218052-G-A p.Ser1055Ser synonymous ANKRD24 19 57634 3.29667E-4 28817 0 3.54578E-4
19-4218059-G-A p.Glu1058Lys missense ANKRD24 1 58030 1.72325E-5 29015 0 NA
19-4218065-A-C p.Ile1060Leu missense ANKRD24 1 58318 1.71474E-5 29159 0 NA
19-4218070-G-T p.Val1061Val synonymous ANKRD24 1 58444 1.71104E-5 29222 0 4.63865E-5
19-4218071-G-A p.Gly1062Ser missense ANKRD24 1 58366 1.71333E-5 29183 0 NA
19-4218076-C-T p.Thr1063Thr synonymous ANKRD24 1 58352 1.71374E-5 29176 0 NA
19-4218092-GC-G p.Gln1070fs frameshift ANKRD24 2 58110 3.44175E-5 29055 0 NA
19-4218098-C-G p.Leu1071Val missense ANKRD24 3 58114 5.16227E-5 29057 0 2.93772E-4
19-4218126-G-A p.Arg1080Gln missense ANKRD24 2 57080 3.50385E-5 28540 0 NA
19-4218138-A-C p.Lys1084Thr missense ANKRD24 13 55902 2.3255E-4 27951 0 6.57462E-4
19-4218151-G-A p.Glu1088Glu synonymous ANKRD24 1 54806 1.82462E-5 27403 0 4.06265E-5
19-4218158-C-A p.Gln1091Lys missense+splice_region ANKRD24 1 54366 1.83938E-5 27183 0 1.68067E-4
19-4219587-G-A c.3274-1G>A splice_acceptor ANKRD24 1 82290 1.21521E-5 41145 0 NA
19-4219590-G-A p.Val1092Val splice_region+synonymous ANKRD24 1 82274 1.21545E-5 41137 0 NA
19-4219594-C-T p.Arg1094Cys missense ANKRD24 1 82292 1.21518E-5 41146 0 NA
19-4219595-G-A p.Arg1094His missense ANKRD24 3 82322 3.64423E-5 41161 0 3.18471E-5
19-4219601-C-A p.Ala1096Asp missense ANKRD24 1 82326 1.21468E-5 41163 0 NA
19-4219603-C-T p.Leu1097Leu synonymous ANKRD24 2 82336 2.42907E-5 41168 0 NA
19-4219621-C-T p.Arg1103* stop_gained ANKRD24 5 82284 6.07652E-5 41142 0 2.54956E-4
19-4219622-G-A p.Arg1103Gln missense ANKRD24 15 82302 1.82256E-4 41151 0 6.95142E-4
19-4219626-C-T p.His1104His synonymous ANKRD24 2 82288 2.43049E-5 41144 0 1.66564E-5
19-4219627-G-A p.Ala1105Thr missense ANKRD24 1 82298 1.2151E-5 41149 0 4.16389E-5
19-4219633-G-A p.Glu1107Lys missense ANKRD24 1 82276 1.21542E-5 41138 0 1.27453E-4
19-4219638-A-ACAGCTGGCCACAGCAGAGCAG p.Leu1117_Arg1118insAlaThrAlaGluGlnGlnLeu disruptive_inframe_insertion ANKRD24 2 82274 2.4309E-5 41137 0 NA
19-4219648-A-G p.Thr1112Ala missense ANKRD24 22 82244 2.67497E-4 41122 0 1.08497E-4
19-4219653-A-C p.Ala1113Ala synonymous ANKRD24 1 82248 1.21584E-5 41124 0 4.01774E-6
19-4219654-G-C p.Glu1114Gln missense ANKRD24 2 82248 2.43167E-5 41124 0 6.25E-4
19-4219662-GC-TA p.GlnLeu1116HisIle missense ANKRD24 17 82220 2.06762E-4 41110 0 NA
19-4219667-G-A p.Arg1118Gln missense ANKRD24 7 82140 8.52204E-5 41070 0 3.3365E-5
19-4219670-G-A p.Gly1119Glu missense ANKRD24 1 82136 1.21749E-5 41068 0 4.02191E-6
19-4219671-G-A p.Gly1119Gly synonymous ANKRD24 242 82094 0.00294784 41047 0 0.00500606
19-4219680-C-T p.Thr1122Thr synonymous ANKRD24 1 81968 1.21999E-5 40984 0 8.36274E-6
19-4219681-G-A p.Glu1123Lys missense ANKRD24 2 81932 2.44105E-5 40966 0 2.23143E-4
19-4219684-G-A p.Ala1124Thr missense ANKRD24 1 81924 1.22064E-5 40962 0 4.02901E-6
19-4219686-G-A p.Ala1124Ala synonymous ANKRD24 3 81894 3.66327E-5 40947 0 8.37647E-6
19-4219696-C-T p.Arg1128Cys missense ANKRD24 6 81684 7.34538E-5 40842 0 6.37552E-5
19-4219703-C-A p.Ala1130Asp missense ANKRD24 2 81476 2.45471E-5 40738 0 3.18695E-5
19-4219703-C-T p.Ala1130Val missense ANKRD24 2 81476 2.45471E-5 40738 0 9.56084E-5
19-4219704-C-A p.Ala1130Ala synonymous ANKRD24 2 81490 2.45429E-5 40745 0 NA
19-4219711-C-T p.Arg1133Trp missense ANKRD24 4 81292 4.92053E-5 40646 0 3.18735E-4
19-4219721-A-T p.Glu1136Val missense ANKRD24 2 81192 2.4633E-5 40596 0 3.18898E-5
19-4219722-G-A p.Glu1136Glu synonymous ANKRD24 2 81200 2.46305E-5 40600 0 6.37349E-5
19-4219723-G-A p.Ala1137Thr missense ANKRD24 57 81120 7.02663E-4 40560 0 0.00159337
19-4219728-G-T p.Leu1138Leu synonymous ANKRD24 1 81118 1.23277E-5 40559 0 9.4419E-5
19-4219731-C-A p.Asp1139Glu missense ANKRD24 2 81038 2.46798E-5 40519 0 NA
19-4219734-G-C p.Lys1140Asn missense ANKRD24 2 81014 2.46871E-5 40507 0 NA
19-4219741-G-A p.Glu1143Lys missense ANKRD24 1 80852 1.23683E-5 40426 0 NA
19-4219744-AAG-GAC p.Lys1144Asp missense ANKRD24 1 80720 1.23885E-5 40360 0 NA
19-4219751-A-G p.Lys1146Arg missense ANKRD24 1 80538 1.24165E-5 40269 0 NA
19-4219759-G-A c.3441+4G>A splice_region ANKRD24 2 80040 2.49875E-5 40020 0 NA
19-4219759-G-T c.3441+4G>T splice_region ANKRD24 26 80038 3.24846E-4 40019 0 0.00189747
19-4222660-C-T c.3442-7C>T splice_region ANKRD24 1 82220 1.21625E-5 41110 0 NA
19-4222664-C-T c.3442-3C>T splice_region ANKRD24 3 82250 3.64742E-5 41125 0 9.44787E-6
19-4222672-A-G p.Thr1149Thr synonymous ANKRD24 1 82284 1.2153E-5 41142 0 NA
19-4222679-T-C p.Ser1152Pro missense ANKRD24 1 82282 1.21533E-5 41141 0 NA
19-4222707-C-T p.Ala1161Val missense ANKRD24 2 82264 2.4312E-5 41132 0 NA
19-4222722-C-T p.Pro1166Leu missense ANKRD24 3 82202 3.64955E-5 41101 0 9.55171E-5
19-4222723-G-A p.Pro1166Pro synonymous ANKRD24 2 82212 2.43273E-5 41106 0 3.7037E-5
19-4222725-C-T p.Ala1167Val missense ANKRD24 6 82192 7.29998E-5 41096 0 4.87199E-5
19-4222726-C-T p.Ala1167Ala synonymous ANKRD24 5 82178 6.08435E-5 41089 0 1.57431E-4
19-4222727-G-A p.Ala1168Thr missense ANKRD24 197 82162 0.0023977 41081 1 0.00468183
19-4222732-C-T p.Leu1169Leu synonymous ANKRD24 3 82178 3.65061E-5 41089 0 3.18532E-5
19-4222733-G-A p.Ala1170Thr missense ANKRD24 5 82158 6.08583E-5 41079 0 5.57528E-5
19-4222741-T-A p.Pro1172Pro synonymous ANKRD24 1 82154 1.21723E-5 41077 0 6.37064E-5
19-4222742-G-C p.Glu1173Gln missense ANKRD24 3 82158 3.6515E-5 41079 0 NA
19-4222745-G-A p.Val1174Met missense ANKRD24 2 82140 2.43487E-5 41070 0 NA
19-4222756-C-T p.Leu1177Leu synonymous ANKRD24 3 82070 3.65542E-5 41035 0 NA
19-4222757-C-T p.Arg1178Cys missense ANKRD24 4 82066 4.87413E-5 41033 0 1.2747E-4
19-4222758-G-A p.Arg1178His missense ANKRD24 2 82044 2.43772E-5 41022 0 3.18593E-5
19-4222765-G-C p.Gln1180His missense ANKRD24 1 81988 1.21969E-5 40994 0 NA
19-4222766-G-A p.Val1181Met missense ANKRD24 1 81974 1.2199E-5 40987 0 4.05782E-6
19-4222778-C-T p.Gln1185* stop_gained ANKRD24 2 81768 2.44594E-5 40884 0 9.54271E-6
19-4222779-A-G p.Gln1185Arg missense ANKRD24 2 81738 2.44684E-5 40869 0 4.07222E-6
19-4222784-C-T p.Gln1187* stop_gained ANKRD24 1 81626 1.2251E-5 40813 0 1.92548E-5
19-4222789-G-A p.Leu1188Leu synonymous ANKRD24 1 81522 1.22666E-5 40761 0 6.25E-4
19-4222798-G-T c.3567+6G>T splice_region ANKRD24 1 81214 1.23131E-5 40607 0 NA
19-4224126-A-G p.Glu1190Glu splice_region+synonymous ANKRD24 2 82192 2.43333E-5 41096 0 NA
19-4224132-C-T p.Ala1192Ala synonymous ANKRD24 5 82216 6.08154E-5 41108 0 5.04032E-4
19-4224133-A-G p.Arg1193Gly missense ANKRD24 1 82210 1.2164E-5 41105 0 8.7892E-6
19-4224135-G-T p.Arg1193Ser missense ANKRD24 4 82220 4.865E-5 41110 0 3.18735E-5
19-4224147-C-T p.Ser1197Ser synonymous ANKRD24 1 82186 1.21675E-5 41093 0 6.25E-4
19-4224148-G-A p.Val1198Met missense ANKRD24 5 82180 6.08421E-5 41090 0 9.68695E-5
19-4224165-A-G p.Arg1203Arg synonymous ANKRD24 1 82148 1.21732E-5 41074 0 NA
19-4224170-ACCT-A p.Leu1207del disruptive_inframe_deletion ANKRD24 1 82118 1.21776E-5 41059 0 NA
19-4224171-C-A p.His1205Gln missense ANKRD24 2 82120 2.43546E-5 41060 0 NA
19-4224174-C-G p.Leu1206Leu synonymous ANKRD24 1 82154 1.21723E-5 41077 0 NA
19-4224177-A-G p.Leu1207Leu synonymous ANKRD24 2 82142 2.43481E-5 41071 0 3.18695E-5
19-4224181-G-T p.Ala1209Ser missense ANKRD24 1 82152 1.21726E-5 41076 0 NA
19-4224196-G-A c.3633+7G>A splice_region ANKRD24 1 82090 1.21818E-5 41045 0 NA
19-4224418-A-C c.3634-7A>C splice_region ANKRD24 4 82650 4.83969E-5 41325 0 1.59785E-4
19-4224419-C-T c.3634-6C>T splice_region ANKRD24 1 82668 1.20966E-5 41334 0 4.03757E-6
19-4224420-C-G c.3634-5C>G splice_region ANKRD24 1 82680 1.20948E-5 41340 0 NA
19-4224443-G-A p.Val1218Met missense ANKRD24 1 82726 1.20881E-5 41363 0 NA
19-4224449-C-T p.Arg1220Trp missense ANKRD24 1 82704 1.20913E-5 41352 0 5.82309E-5
19-4224450-G-A p.Arg1220Gln missense ANKRD24 3 82706 3.62731E-5 41353 0 9.56938E-5
19-4224467-C-G p.Leu1226Val missense ANKRD24 1 82594 1.21074E-5 41297 0 4.05223E-6
19-4224475-G-A p.Met1228Ile missense ANKRD24 1 82480 1.21242E-5 41240 0 NA
19-4224479-A-C p.Arg1230Arg synonymous ANKRD24 32 82396 3.88368E-4 41198 0 1.55376E-4
19-4224485-C-T p.Gln1232* stop_gained ANKRD24 2 82302 2.43007E-5 41151 0 8.06043E-5
19-4224497-C-T p.Arg1236Cys missense ANKRD24 4 81898 4.88412E-5 40949 0 1.68655E-5
19-4224498-G-A p.Arg1236His missense ANKRD24 4 81822 4.88866E-5 40911 0 5.03056E-5