Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
2-97490595-A-G n.800T>C splice_region ANKRD23 2 67104 2.98045E-5 33552 0 6.37146E-5
2-97490597-C-T n.799-1G>A splice_acceptor ANKRD23 1 67418 1.48328E-5 33709 0 NA
2-97498244-C-T n.798+6G>A splice_region ANKRD23 1 81996 1.21957E-5 40998 0 NA
2-97498244-C-G n.798+6G>C splice_region ANKRD23 3 81996 3.65871E-5 40998 0 1.64978E-5
2-97498374-G-A n.674C>T splice_region ANKRD23 1 82042 1.21889E-5 41021 0 NA
2-97498382-G-T n.672-6C>A splice_region ANKRD23 1 82032 1.21904E-5 41016 0 NA
2-97499045-C-T n.671+3G>A splice_region ANKRD23 1 53774 1.85963E-5 26887 0 NA
2-97499281-TA-T n.442-5delT splice_region ANKRD23 1 3998 2.50125E-4 1999 0 0.00181678
2-97499281-T-TA n.442-5dupT splice_region ANKRD23 3 4022 7.45898E-4 2011 0 0.00154619
2-97503824-AG-A c.*1051delC splice_region ANKRD23 3 17112 1.75316E-4 8556 0 2.22916E-4
2-97504236-C-G c.*1050G>C splice_region ANKRD23 1 68118 1.46804E-5 34059 0 NA
2-97504469-G-A n.2040C>T splice_region ANKRD23 1 27550 3.62976E-5 13775 0 3.18634E-5
2-97505297-T-G p.Thr303Pro missense ANKRD23 133 47488 0.00280071 23744 6 0.0308062
2-97505299-C-T p.Arg302His missense ANKRD23 12 47852 2.50773E-4 23926 0 0.00253263
2-97505300-G-A p.Arg302Cys missense ANKRD23 11 48390 2.2732E-4 24195 0 0.00272579
2-97505302-GGA-TGC p.HisPro300GlnHis missense ANKRD23 4 48838 8.19034E-5 24419 0 NA
2-97505302-G-A p.Pro301Leu missense ANKRD23 2 48838 4.09517E-5 24419 0 7.70152E-4
2-97505304-A-T p.His300Gln missense ANKRD23 1 48718 2.05263E-5 24359 0 8.285E-5
2-97505305-T-G p.His300Pro missense ANKRD23 2 48886 4.09115E-5 24443 0 NA
2-97505312-C-A p.Val298Leu missense ANKRD23 1 50188 1.99251E-5 25094 0 NA
2-97505323-A-T p.Leu294Gln missense ANKRD23 1 52482 1.90542E-5 26241 0 NA
2-97505328-C-T p.Glu292Glu synonymous ANKRD23 2 53222 3.75784E-5 26611 0 NA
2-97505332-C-G p.Arg291Pro missense ANKRD23 2 53778 3.71899E-5 26889 0 NA
2-97505332-C-T p.Arg291Gln missense ANKRD23 1 53778 1.8595E-5 26889 0 5.01454E-5
2-97505340-G-A p.Arg288Arg synonymous ANKRD23 1 54856 1.82295E-5 27428 0 4.28339E-5
2-97505350-TCTCGAGCCAG-T p.Leu282fs frameshift ANKRD23 1 57372 1.74301E-5 28686 0 NA
2-97505351-C-G p.Asp285His missense ANKRD23 5 57726 8.66161E-5 28863 0 2.11625E-4
2-97505351-C-T p.Asp285Asn missense ANKRD23 1 57726 1.73232E-5 28863 0 7.29586E-6
2-97505354-G-A p.Arg284* stop_gained ANKRD23 1 57730 1.7322E-5 28865 0 1.4354E-5
2-97505361-C-T p.Gln281Gln synonymous ANKRD23 1 59202 1.68913E-5 29601 0 6.92147E-6
2-97505368-G-C p.Pro279Arg missense ANKRD23 6 59852 1.00247E-4 29926 0 0.00141418
2-97505371-G-T p.Thr278Asn missense ANKRD23 1 60364 1.65662E-5 30182 0 6.51839E-6
2-97505376-G-A p.Ser276Ser synonymous ANKRD23 1 60834 1.64382E-5 30417 0 2.71223E-5
2-97505380-GCCTGGGAGCAACGGTGTGGGTCAGTCCCTTGCAGGCGCTCCACCCGCCCTCGGGTCAGGAGCCAGGGCTGCGCCCACACTCA-G p.Ala275fs frameshift ANKRD23 4 61328 6.52231E-5 30664 0 NA
2-97505385-G-A c.823-4C>T splice_region ANKRD23 1 61952 1.61415E-5 30976 0 2.42495E-5
2-97505386-G-T c.823-5C>A splice_region ANKRD23 1 61978 1.61348E-5 30989 0 2.40096E-5
2-97505454-CCA-C c.822+8_822+9delTG splice_region ANKRD23 2 65200 3.06748E-5 32600 0 9.68092E-6
2-97505462-A-G c.822+2T>C splice_donor ANKRD23 1 65912 1.51717E-5 32956 0 NA
2-97505466-C-A p.Ala274Ser missense+splice_region ANKRD23 2 66128 3.02444E-5 33064 0 2.75437E-5
2-97505467-G-A p.Asn273Asn synonymous ANKRD23 2 66408 3.01169E-5 33204 0 8.16827E-6
2-97505472-G-A p.Arg272Trp missense ANKRD23 1 66868 1.49548E-5 33434 0 NA
2-97505477-C-G p.Gly270Ala missense ANKRD23 1 68374 1.46254E-5 34187 0 2.23044E-4
2-97505491-A-G p.Tyr265Tyr synonymous ANKRD23 1 71012 1.40821E-5 35506 0 NA
2-97505492-T-C p.Tyr265Cys missense ANKRD23 1 71198 1.40453E-5 35599 0 1.21432E-5
2-97505497-C-T p.Leu263Leu synonymous ANKRD23 1 72058 1.38777E-5 36029 0 8.76056E-6
2-97505510-A-G p.Met259Thr missense ANKRD23 2 74250 2.6936E-5 37125 0 6.37471E-5
2-97505511-T-C p.Met259Val missense ANKRD23 3 74380 4.03334E-5 37190 0 1.20951E-5
2-97505522-C-A p.Ser255Ile missense ANKRD23 1 75500 1.3245E-5 37750 0 3.18573E-5
2-97505527-G-A p.His253His synonymous ANKRD23 3 75864 3.95444E-5 37932 0 1.94935E-4
2-97505529-G-A p.His253Tyr missense ANKRD23 1 76018 1.31548E-5 38009 0 NA
2-97505536-G-A p.Ala250Ala synonymous ANKRD23 3 76276 3.93309E-5 38138 0 3.18939E-5
2-97505542-G-A p.His248His synonymous ANKRD23 1 76876 1.3008E-5 38438 0 4.04544E-6
2-97505545-C-CAG p.His248fs frameshift ANKRD23 21 77090 2.72409E-4 38545 1 5.03525E-4
2-97505561-TC-T p.Glu242fs frameshift ANKRD23 8 77704 1.02955E-4 38852 0 1.67656E-4
2-97505563-C-CTTATCCTG c.724-2_724-1insCAGGATAA splice_acceptor ANKRD23 1 77812 1.28515E-5 38906 0 NA
2-97505563-C-T c.724-1G>A splice_acceptor ANKRD23 2 77812 2.5703E-5 38906 0 4.06762E-6
2-97505564-T-TTATCCTGTGCGTTCAG c.724-3_724-2insCTGAACGCACAGGATA splice_region ANKRD23 1 77780 1.28568E-5 38890 0 NA
2-97505564-T-TTATCCTGTGCGTTCAGGTGGGCGCCACACTC c.724-3_724-2insGAGTGTGGCGCCCACCTGAACGCACAGGATA splice_region ANKRD23 1 77780 1.28568E-5 38890 0 NA
2-97505564-T-TTATCCTGTGCGTTCAGGTGG c.724-3_724-2insCCACCTGAACGCACAGGATA splice_region ANKRD23 1 77780 1.28568E-5 38890 0 NA
2-97505570-G-A c.724-8C>T splice_region ANKRD23 2 77848 2.56911E-5 38924 0 3.18756E-5
2-97505734-C-T p.Lys241Lys splice_region+synonymous ANKRD23 3 80932 3.70682E-5 40466 0 NA
2-97505736-T-G p.Lys241Gln missense+splice_region ANKRD23 1 80888 1.23628E-5 40444 0 NA
2-97505738-T-C p.Asp240Gly missense ANKRD23 1 80914 1.23588E-5 40457 0 NA
2-97505739-C-T p.Asp240Asn missense ANKRD23 1 80956 1.23524E-5 40478 0 NA
2-97505745-C-T p.Ala238Thr missense ANKRD23 11 80906 1.3596E-4 40453 0 1.43021E-4
2-97505766-C-T p.Glu231Lys missense ANKRD23 2 80874 2.47298E-5 40437 0 NA
2-97505766-C-A p.Glu231* stop_gained ANKRD23 2 80874 2.47298E-5 40437 0 4.61382E-5
2-97505770-G-A p.Leu229Leu synonymous ANKRD23 1 80910 1.23594E-5 40455 0 NA
2-97505772-G-A p.Leu229Phe missense ANKRD23 1 80898 1.23612E-5 40449 0 NA
2-97505787-C-T p.Asp224Asn missense ANKRD23 2 80722 2.47764E-5 40361 0 4.6292E-5
2-97505788-G-A p.Pro223Pro synonymous ANKRD23 6 80722 7.43292E-5 40361 0 0.0020429
2-97505790-G-A p.Pro223Ser missense ANKRD23 3 80722 3.71646E-5 40361 0 5.10725E-4
2-97505795-C-T p.Arg221Gln missense ANKRD23 1 80684 1.2394E-5 40342 0 5.91289E-6
2-97505797-G-A n.856C>T splice_region ANKRD23 1 80750 1.23839E-5 40375 0 NA
2-97505801-C-T p.Arg219His missense ANKRD23 1 80734 1.23864E-5 40367 0 0.00255885
2-97505811-C-G p.Val216Leu missense ANKRD23 2 80852 2.47366E-5 40426 0 NA
2-97505816-A-G p.Leu214Pro missense ANKRD23 4 80842 4.94792E-5 40421 0 NA
2-97505816-AG-A p.Leu214fs frameshift ANKRD23 2 80842 2.47396E-5 40421 0 3.37414E-4
2-97505819-G-A p.Pro213Leu missense ANKRD23 2 80856 2.47353E-5 40428 0 3.18532E-5
2-97505826-T-C p.Ser211Gly missense ANKRD23 1 80752 1.23836E-5 40376 0 NA
2-97505829-CGATCT-C p.Ile209_Gly210del splice_acceptor ANKRD23 15 80740 1.85782E-4 40370 1 6.37186E-5
2-97505832-TCTGAGAGCAAGTGGGGGTCAGTGCTGGGTCTGGATTGGTGAGGCCTCCCTAACCCATGGGACTACGTGCTCTCTTCTCCAGGAACAGCGTCTGCTCCCGTGTTCCCGACAGGCCCCCAAAGCACCGTGCCCCTCAC-T c.624+1_625-1del splice_acceptor ANKRD23 5 80790 6.18888E-5 40395 0 NA
2-97505834-T-TTGTCCCGGGCATTGACCCGGGCTCCCTG c.625-3_625-2insCAGGGAGCCCGGGTCAATGCCCGGGACA splice_region ANKRD23 1 80834 1.2371E-5 40417 0 NA
2-97505955-ACCGTGC-A c.624+8_624+13delGCACGG splice_region ANKRD23 2 82204 2.43297E-5 41102 0 NA
2-97505962-C-G c.624+7G>C splice_region ANKRD23 1 82356 1.21424E-5 41178 0 4.15062E-6
2-97505969-CT-C p.Lys208fs frameshift ANKRD23 1 82418 1.21333E-5 41209 0 6.36943E-5
2-97505974-C-T p.Asp207Asn missense ANKRD23 1 82424 1.21324E-5 41212 0 NA
2-97505976-C-T p.Arg206Gln missense ANKRD23 4 82434 4.85237E-5 41217 0 1.64656E-5
2-97505977-G-C p.Arg206Gly missense ANKRD23 4 82348 4.85743E-5 41174 0 8.23045E-5
2-97505977-G-A p.Arg206Trp missense ANKRD23 1 82348 1.21436E-5 41174 0 1.13569E-5
2-97505980-C-T p.Ala205Thr missense ANKRD23 1 82360 1.21418E-5 41180 0 NA
2-97505984-G-T p.Val203Val synonymous ANKRD23 1 82406 1.2135E-5 41203 0 NA
2-97505988-C-T p.Arg202Gln missense ANKRD23 6 82434 7.27855E-5 41217 0 1.14486E-4
2-97505989-G-A p.Arg202Trp missense ANKRD23 2 82446 2.42583E-5 41223 0 3.18695E-5
2-97506018-A-T p.Ile192Asn missense ANKRD23 2 82688 2.41873E-5 41344 0 4.08674E-6
2-97506021-A-G p.Val191Ala missense ANKRD23 2 82700 2.41838E-5 41350 0 3.18634E-5
2-97506035-G-A p.Arg186Arg synonymous ANKRD23 1 82660 1.20978E-5 41330 0 6.49477E-5
2-97506039-C-G p.Cys185Ser missense ANKRD23 1 82670 1.20963E-5 41335 0 NA
2-97506042-G-A p.Ala184Val missense ANKRD23 1 82642 1.21004E-5 41321 0 4.16889E-6
2-97506051-A-C p.Val181Gly missense ANKRD23 1 82594 1.21074E-5 41297 0 3.27747E-5
2-97506067-GCTGCAAAACAAAAGCACCCAAGCACTCAGCTGCTGGGATGTGAAGCTGGGCGTCGACCAGAGGCTGGGCCTTTCCCCATCCTCAC-G c.525+1_526-1delGTGAGGATGGGGAAAGGCCCAGCCTCTGGTCGACGCCCAGCTTCACATCCCAGCAGCTGAGTGCTTGGGTGCTTTTGTTTTGCAG splice_acceptor ANKRD23 5 82564 6.05591E-5 41282 0 NA
2-97506152-C-T c.525+1G>A splice_donor ANKRD23 3 82374 3.64193E-5 41187 0 6.25E-4
2-97506160-C-T p.Arg173Gln missense ANKRD23 32 82310 3.88774E-4 41155 0 0.001875
2-97506161-G-A p.Arg173* stop_gained ANKRD23 2 82242 2.43185E-5 41121 0 5.03525E-4
2-97506162-C-T p.Ala172Ala synonymous ANKRD23 1 82262 1.21563E-5 41131 0 3.18492E-5
2-97506163-G-A p.Ala172Val missense ANKRD23 1 82226 1.21616E-5 41113 0 1.10992E-4
2-97506164-C-T p.Ala172Thr missense ANKRD23 2 82246 2.43173E-5 41123 0 1.70584E-5
2-97506165-G-A p.Asp171Asp synonymous ANKRD23 1 82272 1.21548E-5 41136 0 4.78602E-5
2-97506170-C-T p.Val170Met missense ANKRD23 2 82268 2.43108E-5 41134 0 1.69753E-5
2-97506183-C-T p.Val165Val synonymous ANKRD23 7 82282 8.50733E-5 41141 1 0.00100705
2-97506198-C-G p.Val160Val synonymous ANKRD23 1 82012 1.21933E-5 41006 0 NA
2-97506200-C-T p.Val160Met missense ANKRD23 2 81992 2.43926E-5 40996 0 8.39913E-6
2-97506203-G-A p.Leu159Leu synonymous ANKRD23 1 81906 1.22091E-5 40953 0 1.27372E-4
2-97506206-G-A p.Gln158* stop_gained ANKRD23 1 81820 1.2222E-5 40910 0 1.68039E-5
2-97506210-G-A p.His156His synonymous ANKRD23 43 81702 5.26303E-4 40851 0 0.00149662
2-97506218-T-G p.Lys154Gln missense ANKRD23 13 81444 1.59619E-4 40722 0 4.14145E-4
2-97506228-C-T p.Trp150* stop_gained ANKRD23 6 80872 7.41913E-5 40436 0 6.37146E-5
2-97506239-C-T p.Ala147Thr missense ANKRD23 5 80196 6.23473E-5 40098 0 6.79706E-5
2-97506244-C-T p.Arg145His missense ANKRD23 2 79806 2.50608E-5 39903 0 NA
2-97506245-GGT-AGG p.HisArg144ProCys missense ANKRD23 1 79804 1.25307E-5 39902 0 NA
2-97506520-C-G c.426+4G>C splice_region ANKRD23 3 82694 3.62783E-5 41347 0 8.25723E-6
2-97506522-A-G c.426+2T>C splice_donor ANKRD23 1 82734 1.20869E-5 41367 0 NA
2-97506529-C-A p.Asp141Tyr missense ANKRD23 3 82864 3.62039E-5 41432 0 8.25178E-6
2-97506547-C-T p.Gly135Arg missense ANKRD23 2 83034 2.40865E-5 41517 0 8.24484E-6
2-97506550-C-T p.Gly134Arg missense ANKRD23 8 83038 9.63414E-5 41519 0 6.25E-4
2-97506556-T-C p.Thr132Ala missense ANKRD23 1 83104 1.20331E-5 41552 0 3.97687E-6
2-97506570-A-G p.Ile127Thr missense ANKRD23 3 83162 3.60742E-5 41581 0 2.06036E-4
2-97506573-A-G p.Leu126Pro missense ANKRD23 4 83158 4.81012E-5 41579 0 4.94454E-5
2-97506576-T-C p.Tyr125Cys missense ANKRD23 1 83148 1.20267E-5 41574 0 3.18634E-5
2-97506605-G-A p.Phe115Phe synonymous ANKRD23 1 83106 1.20328E-5 41553 0 3.18492E-5
2-97506608-C-T p.Met114Ile missense ANKRD23 1 83114 1.20317E-5 41557 0 8.2428E-6
2-97506615-A-G p.Leu112Pro missense ANKRD23 1 83086 1.20357E-5 41543 0 3.18512E-5
2-97506634-GGGCCTGGGACTGCGGCT-G p.Pro101_Gln106del splice_acceptor ANKRD23 3 82960 3.6162E-5 41480 0 NA
2-97506655-T-TG c.301-7_301-6insC splice_region ANKRD23 3 82612 3.63143E-5 41306 0 NA
2-97506656-C-A c.301-7G>T splice_region ANKRD23 3 82608 3.63161E-5 41304 0 NA
2-97506656-C-G c.301-7G>C splice_region ANKRD23 1 82608 1.21054E-5 41304 0 1.65837E-5
2-97507802-C-G p.Val99Leu missense ANKRD23 1 82758 1.20834E-5 41379 0 3.18431E-5
2-97507803-C-A p.Leu98Leu synonymous ANKRD23 8 82780 9.66417E-5 41390 0 1.40181E-4
2-97507811-C-G p.Glu96Gln missense ANKRD23 3 82970 3.61576E-5 41485 0 9.55231E-5
2-97507813-G-C p.Pro95Arg missense ANKRD23 4 83010 4.8187E-5 41505 0 NA
2-97507814-G-T p.Pro95Thr missense ANKRD23 3 83012 3.61394E-5 41506 0 0.0015121
2-97507820-TG-T p.Arg93fs frameshift ANKRD23 5 83054 6.02018E-5 41527 0 3.18654E-5
2-97507820-T-TG p.Arg93fs frameshift ANKRD23 10 83048 1.20412E-4 41524 0 1.31852E-4
2-97507820-T-C p.Arg93Gly missense ANKRD23 1 83056 1.20401E-5 41528 0 NA
2-97507827-G-GA p.Arg93fs frameshift ANKRD23 3 83134 3.60863E-5 41567 0 6.37105E-5
2-97507827-G-A p.Val90Val synonymous ANKRD23 4 83134 4.81151E-5 41567 0 3.97624E-6
2-97507833-G-A p.His88His synonymous ANKRD23 1 83204 1.20187E-5 41602 0 8.23696E-6
2-97507843-C-T p.Arg85Gln missense ANKRD23 3 83280 3.60231E-5 41640 0 3.29468E-5
2-97507844-G-A p.Arg85* stop_gained ANKRD23 2 83296 2.40108E-5 41648 0 8.23669E-6
2-97507852-C-T p.Arg82Gln missense ANKRD23 1 83324 1.20013E-5 41662 0 NA
2-97507853-G-A p.Arg82Trp missense ANKRD23 4 83314 4.80111E-5 41657 0 4.77152E-5
2-97507858-T-A p.Gln80Leu missense ANKRD23 7 83334 8.39993E-5 41667 0 1.15314E-4
2-97507863-C-T p.Leu78Leu synonymous ANKRD23 1 83336 1.19996E-5 41668 0 NA
2-97507867-T-C p.Asn77Ser missense ANKRD23 1 83340 1.1999E-5 41670 0 NA
2-97507874-A-G p.Leu75Leu synonymous ANKRD23 1 83350 1.19976E-5 41675 0 3.18674E-5
2-97507877-C-G p.Asp74His missense ANKRD23 1 83352 1.19973E-5 41676 0 NA
2-97507877-C-T p.Asp74Asn missense ANKRD23 1 83352 1.19973E-5 41676 0 NA
2-97507892-G-A p.Leu69Leu synonymous ANKRD23 1 83300 1.20048E-5 41650 0 3.97633E-6
2-97507906-C-T p.Ser64Asn missense ANKRD23 3 83238 3.60412E-5 41619 0 0.00100705
2-97507907-T-G p.Ser64Arg missense ANKRD23 141 83232 0.00169406 41616 0 0.00232543
2-97507912-A-C p.Phe62Cys missense ANKRD23 7 83200 8.41346E-5 41600 0 1.27405E-4
2-97507913-A-G p.Phe62Leu missense ANKRD23 1 83194 1.20201E-5 41597 0 NA
2-97507914-TC-T p.Arg61fs frameshift ANKRD23 6 83186 7.21275E-5 41593 0 7.95355E-5
2-97507915-C-G p.Arg61Thr missense ANKRD23 1 83184 1.20215E-5 41592 0 3.977E-6
2-97507922-G-GTTT c.175-1_175insAAA splice_acceptor ANKRD23 2 83108 2.40651E-5 41554 0 NA
2-97507930-A-G c.175-8T>C splice_region ANKRD23 1 83030 1.20438E-5 41515 0 NA
2-97508094-T-C c.174+8A>G splice_region ANKRD23 3 77420 3.87497E-5 38710 0 0.00161616
2-97508096-T-C c.174+6A>G splice_region ANKRD23 10 78830 1.26855E-4 39415 0 1.43194E-4
2-97508098-T-C c.174+4A>G splice_region ANKRD23 4 79984 5.001E-5 39992 0 2.51921E-5
2-97508102-TTTC-T p.Lys58del disruptive_inframe_deletion ANKRD23 9 80674 1.1156E-4 40337 0 2.71998E-4
2-97508103-T-C p.Lys58Arg missense+splice_region ANKRD23 1 80796 1.23769E-5 40398 0 NA
2-97508109-TTCTTC-T p.Lys55fs frameshift ANKRD23 2 81310 2.45972E-5 40655 0 NA
2-97508111-C-T p.Lys55Lys synonymous ANKRD23 3 81442 3.6836E-5 40721 0 4.04829E-6
2-97508114-C-T p.Glu54Glu synonymous ANKRD23 1 81660 1.22459E-5 40830 0 8.44466E-6
2-97508137-C-A p.Glu47* stop_gained ANKRD23 14 82562 1.6957E-4 41281 0 9.99101E-5
2-97508137-C-T p.Glu47Lys missense ANKRD23 2 82562 2.42242E-5 41281 0 8.32584E-6
2-97508139-C-T p.Arg46Gln missense ANKRD23 556 82584 0.00673254 41292 4 0.0236657
2-97508140-G-A p.Arg46Trp missense ANKRD23 61 82558 7.38874E-4 41279 1 7.7876E-4
2-97508148-G-A p.Ala43Val missense ANKRD23 2 82860 2.41371E-5 41430 0 8.29628E-6
2-97508158-G-A p.Pro40Ser missense ANKRD23 3 82968 3.61585E-5 41484 0 1.65623E-5
2-97508165-C-A p.Arg37Ser missense ANKRD23 64 83060 7.70527E-4 41530 0 0.00124259
2-97508165-C-T p.Arg37Arg synonymous ANKRD23 1 83062 1.20392E-5 41531 0 NA
2-97508169-C-T p.Trp36* stop_gained ANKRD23 1 83120 1.20308E-5 41560 0 NA
2-97508173-C-T p.Asp35Asn missense ANKRD23 11 83168 1.32262E-4 41584 0 4.95974E-5
2-97508179-G-A p.Pro33Ser missense ANKRD23 1 83188 1.2021E-5 41594 0 3.18573E-5
2-97508181-C-A p.Trp32Leu missense ANKRD23 1 83216 1.20169E-5 41608 0 7.95798E-6
2-97508191-G-A p.Pro29Ser missense ANKRD23 2 83230 2.40298E-5 41615 0 NA
2-97508195-A-G p.Pro27Pro synonymous ANKRD23 1 83232 1.20146E-5 41616 0 NA
2-97508200-C-T p.Val26Ile missense ANKRD23 1 83246 1.20126E-5 41623 0 NA
2-97508208-C-G p.Gly23Ala missense ANKRD23 1 83236 1.2014E-5 41618 0 NA
2-97508221-C-T p.Val19Met missense ANKRD23 1 83184 1.20215E-5 41592 0 4.13729E-5
2-97508224-T-A p.Lys18* stop_gained ANKRD23 1 83190 1.20207E-5 41595 0 6.37146E-5
2-97508233-C-G p.Val15Leu missense ANKRD23 1 83128 1.20296E-5 41564 0 NA
2-97508239-C-A p.Glu13* stop_gained ANKRD23 1 83116 1.20314E-5 41558 0 1.66973E-5
2-97508242-C-T p.Gly12Arg missense ANKRD23 1 83074 1.20375E-5 41537 0 NA
2-97508249-C-A c.28-1G>T splice_acceptor ANKRD23 1 83014 1.20462E-5 41507 0 NA
2-97509716-C-T p.Ser5Asn missense ANKRD23 1 82334 1.21457E-5 41167 0 4.06095E-6
2-97509716-CTGA-C p.Ile4del disruptive_inframe_deletion ANKRD23 1 82334 1.21457E-5 41167 0 NA
2-97509750-C-A c.-21G>T 5_prime_UTR_premature_start_codon_gain ANKRD23 2 81766 2.446E-5 40883 0 1.90196E-4
2-97509750-C-T c.-21G>A 5_prime_UTR_premature_start_codon_gain ANKRD23 1 81766 1.223E-5 40883 0 8.67709E-6
2-97514183-T-TTATGCAGACTGGTCATGCCGTCGTCATCCACCACCCTGGG n.48-3_48-2insCCCAGGGTGGTGGATGACGACGGCATGACCAGTCTGCATA splice_region ANKRD23 1 82810 1.20758E-5 41405 0 NA
2-97523619-C-T n.47+6G>A splice_region ANKRD23 6 77466 7.74533E-5 38733 0 8.98083E-5
2-97523624-C-G n.47+1G>C splice_donor ANKRD23 1 77604 1.28859E-5 38802 0 1.53052E-5