Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
4-73941949-C-A p.Ter2353Leuext*? stop_lost ANKRD17 1 82690 1.20934E-5 41345 0 NA
4-73941979-A-C p.Met2343Arg missense ANKRD17 1 82770 1.20817E-5 41385 0 NA
4-73941995-G-C p.Pro2338Ala missense ANKRD17 95 82460 0.00115207 41230 0 9.39595E-4
4-73941995-G-T p.Pro2338Thr missense ANKRD17 8 82466 9.70097E-5 41233 0 2.53945E-5
4-73942670-T-C p.Asn2329Ser missense ANKRD17 1 83262 1.20103E-5 41631 0 NA
4-73942673-T-C p.Asn2328Ser missense ANKRD17 1 83266 1.20097E-5 41633 0 8.27897E-6
4-73942677-C-T p.Glu2327Lys missense ANKRD17 1 83268 1.20094E-5 41634 0 NA
4-73942678-C-T p.Thr2326Thr synonymous ANKRD17 13535 82974 0.163123 41487 1211 0.213998
4-73942680-T-G p.Thr2326Pro missense ANKRD17 8 83266 9.60776E-5 41633 0 1.6509E-5
4-73942684-G-A p.Ser2324Ser synonymous ANKRD17 5 83280 6.00384E-5 41640 0 7.42586E-5
4-73942695-T-G p.Met2321Leu missense ANKRD17 1 83290 1.20062E-5 41645 0 NA
4-73942699-T-C p.Ile2319Met missense ANKRD17 3 83290 3.60187E-5 41645 0 8.24362E-6
4-73942702-C-A p.Leu2318Leu synonymous ANKRD17 45 83298 5.40229E-4 41649 0 0.00121042
4-73942717-A-G p.Pro2313Pro synonymous ANKRD17 1 83312 1.20031E-5 41656 0 1.64826E-5
4-73942717-A-C p.Pro2313Pro synonymous ANKRD17 1 83312 1.20031E-5 41656 0 8.24131E-6
4-73942731-G-T p.His2309Asn missense ANKRD17 1 83296 1.20054E-5 41648 0 3.98403E-6
4-73942736-C-T p.Gly2307Asp missense ANKRD17 1 83282 1.20074E-5 41641 0 NA
4-73942746-T-G p.Ile2304Leu missense ANKRD17 2 83266 2.40194E-5 41633 0 8.24525E-6
4-73942756-A-G p.Ala2300Ala synonymous ANKRD17 16 83234 1.92229E-4 41617 0 0.0020141
4-73942761-C-T p.Gly2299Ser missense ANKRD17 4 83218 4.80665E-5 41609 0 3.9902E-5
4-73942768-G-T p.Ile2296Ile synonymous ANKRD17 1 83192 1.20204E-5 41596 0 3.18654E-5
4-73942773-G-A p.Pro2295Ser missense ANKRD17 1 83180 1.20221E-5 41590 0 NA
4-73942791-T-C p.Met2289Val missense ANKRD17 6 83038 7.22561E-5 41519 0 9.5584E-5
4-73942794-C-T p.Ala2288Thr missense ANKRD17 1 83020 1.20453E-5 41510 0 6.69983E-5
4-73942798-C-T p.Gly2286Gly synonymous ANKRD17 1 82978 1.20514E-5 41489 0 3.18695E-5
4-73942814-G-A p.Pro2281Leu missense ANKRD17 1 82488 1.2123E-5 41244 0 NA
4-73942818-T-G p.Met2280Leu missense ANKRD17 1 82332 1.21459E-5 41166 0 NA
4-73943091-A-G p.Met2272Thr missense ANKRD17 1 83172 1.20233E-5 41586 0 NA
4-73943097-C-G p.Gly2270Ala missense ANKRD17 1 83186 1.20213E-5 41593 0 NA
4-73943124-C-G p.Gly2261Ala missense ANKRD17 43 83262 5.16442E-4 41631 1 0.00375
4-73943137-C-A p.Val2257Leu missense ANKRD17 2 83274 2.40171E-5 41637 0 NA
4-73943154-C-T p.Arg2251Gln missense ANKRD17 8 83280 9.60615E-5 41640 0 1.73013E-4
4-73943156-C-T p.Glu2250Glu synonymous ANKRD17 1 83276 1.20083E-5 41638 0 1.64775E-5
4-73943171-T-C p.Gln2245Gln synonymous ANKRD17 1 83284 1.20071E-5 41642 0 NA
4-73943184-C-G p.Gly2241Ala missense ANKRD17 1 83278 1.2008E-5 41639 0 7.96369E-6
4-73943189-G-T p.Asp2239Glu missense ANKRD17 2 83282 2.40148E-5 41641 0 1.19471E-5
4-73943193-G-C p.Ser2238Cys missense ANKRD17 4 83282 4.80296E-5 41641 0 3.18451E-5
4-73943198-C-T p.Pro2236Pro synonymous ANKRD17 2 83268 2.40188E-5 41634 0 2.47235E-5
4-73943199-G-A p.Pro2236Leu missense ANKRD17 1 83268 1.20094E-5 41634 0 2.47231E-5
4-73943231-G-T p.Asn2225Lys missense ANKRD17 1 83100 1.20337E-5 41550 0 NA
4-73943247-TTGTC-T p.Asp2219_Lys2220delinsGlu splice_acceptor ANKRD17 1 82368 1.21406E-5 41184 0 6.36943E-5
4-73943250-T-C p.Asp2219Gly missense+splice_region ANKRD17 1 82096 1.21809E-5 41048 0 NA
4-73943250-T-TCTTGATTGCCACCAATCCCTTCAAAGGACCAGATGCCACTATGTCCTA c.6656-1_6656insTAGGACATAGTGGCATCTGGTCCTTTGAAGGGATTGGTGGCAATCAAG splice_acceptor ANKRD17 2 82096 2.43617E-5 41048 1 NA
4-73943257-GCAAA-G c.6656-11_6656-8delTTTG splice_region ANKRD17 2 81764 2.44606E-5 40882 0 NA
4-73943258-C-T c.6656-8G>A splice_region ANKRD17 1 81640 1.22489E-5 40820 0 NA
4-73944361-T-C p.Gln2218Arg missense+splice_region ANKRD17 1 83302 1.20045E-5 41651 0 NA
4-73944375-C-T p.Gly2213Gly synonymous ANKRD17 2 83340 2.39981E-5 41670 0 NA
4-73944438-T-C p.Pro2192Pro synonymous ANKRD17 2 83368 2.399E-5 41684 0 NA
4-73944442-G-A p.Ala2191Val missense ANKRD17 1 83360 1.19962E-5 41680 0 NA
4-73944447-C-T p.Thr2189Thr synonymous ANKRD17 4 83362 4.79835E-5 41681 0 3.18756E-5
4-73944448-G-A p.Thr2189Met missense ANKRD17 2 83358 2.39929E-5 41679 0 1.19299E-5
4-73944483-C-T p.Gly2177Gly synonymous ANKRD17 1 83362 1.19959E-5 41681 0 5.03525E-4
4-73944495-T-C p.Pro2173Pro synonymous ANKRD17 1 83360 1.19962E-5 41680 0 1.98832E-5
4-73944507-G-A p.Asp2169Asp synonymous ANKRD17 1 83370 1.19947E-5 41685 0 8.23737E-6
4-73944519-A-G p.Asn2165Asn synonymous ANKRD17 5 83374 5.99707E-5 41687 0 3.50676E-4
4-73944520-T-C p.Asn2165Ser missense ANKRD17 1 83374 1.19941E-5 41687 0 NA
4-73944523-C-T p.Ser2164Asn missense ANKRD17 1 83378 1.19936E-5 41689 0 NA
4-73944528-C-T p.Lys2162Lys synonymous ANKRD17 30 83384 3.59781E-4 41692 1 1.97703E-4
4-73944536-A-C p.Ser2160Ala missense ANKRD17 1 83372 1.19944E-5 41686 0 3.97668E-6
4-73944543-C-T p.Pro2157Pro synonymous ANKRD17 4 83372 4.79777E-5 41686 0 2.3861E-5
4-73944544-G-A p.Pro2157Leu missense ANKRD17 4 83372 4.79777E-5 41686 0 1.64777E-5
4-73944544-G-C p.Pro2157Arg missense ANKRD17 1 83374 1.19941E-5 41687 0 NA
4-73944556-G-C p.Pro2153Arg missense ANKRD17 2 83370 2.39894E-5 41685 0 NA
4-73944570-T-C p.Ala2148Ala synonymous ANKRD17 1 83358 1.19964E-5 41679 0 NA
4-73944575-G-A p.Arg2147Cys missense ANKRD17 1 83358 1.19964E-5 41679 0 3.29832E-5
4-73944577-A-G p.Val2146Ala missense ANKRD17 3 83358 3.59893E-5 41679 0 NA
4-73944583-G-A p.Ser2144Leu missense ANKRD17 1 83336 1.19996E-5 41668 0 3.18552E-5
4-73944590-C-T p.Val2142Ile missense ANKRD17 1 83318 1.20022E-5 41659 0 NA
4-73944592-G-A p.Ser2141Leu missense ANKRD17 12 83312 1.44037E-4 41656 0 6.36862E-5
4-73944597-T-C p.Ala2139Ala synonymous ANKRD17 98 83284 0.0011767 41642 0 0.00251762
4-73944611-G-A c.6407-4C>T splice_region ANKRD17 1 83198 1.20195E-5 41599 0 NA
4-73950985-C-T p.Pro2129Pro synonymous ANKRD17 5 83248 6.00615E-5 41624 0 9.56267E-5
4-73950985-C-G p.Pro2129Pro synonymous ANKRD17 1 83248 1.20123E-5 41624 0 2.47251E-5
4-73951003-C-G p.Pro2123Pro synonymous ANKRD17 126 83284 0.0015129 41642 0 0.00143641
4-73951003-C-T p.Pro2123Pro synonymous ANKRD17 3 83288 3.60196E-5 41644 0 1.63079E-4
4-73951004-G-A p.Pro2123Leu missense ANKRD17 2 83286 2.40136E-5 41643 0 6.37592E-5
4-73951027-G-A p.Asn2115Asn synonymous ANKRD17 1 83338 1.19993E-5 41669 0 NA
4-73951038-C-T p.Ala2112Thr missense ANKRD17 1 83352 1.19973E-5 41676 0 4.11848E-5
4-73951041-G-A p.Pro2111Ser missense ANKRD17 1 83354 1.1997E-5 41677 0 NA
4-73951054-G-A p.Pro2106Pro synonymous ANKRD17 4 83338 4.79973E-5 41669 0 3.97687E-5
4-73951064-G-C p.Pro2103Arg missense ANKRD17 2 83344 2.39969E-5 41672 0 3.18674E-5
4-73951068-C-T p.Gly2102Arg missense ANKRD17 2 83326 2.40021E-5 41663 0 1.19302E-5
4-73951069-G-A p.Tyr2101Tyr synonymous ANKRD17 1 83332 1.20002E-5 41666 0 4.94234E-5
4-73951074-T-C p.Met2100Val missense ANKRD17 1 83340 1.1999E-5 41670 0 NA
4-73951090-G-A p.Asn2094Asn synonymous ANKRD17 5 83340 5.99952E-5 41670 0 1.6475E-5
4-73951111-A-C p.His2087Gln missense ANKRD17 18 83320 2.16035E-4 41660 0 9.55414E-5
4-73951125-G-A p.Pro2083Ser missense ANKRD17 1 83304 1.20042E-5 41652 0 NA
4-73951132-A-G p.Ser2080Ser synonymous ANKRD17 99 83286 0.00118868 41643 0 0.00306243
4-73951136-C-A p.Gly2079Val missense ANKRD17 2 83256 2.40223E-5 41628 0 3.1821E-5
4-73951144-C-A p.Ser2076Ser synonymous ANKRD17 3 83202 3.60568E-5 41601 0 9.56816E-5
4-73951145-G-A p.Ser2076Leu missense ANKRD17 1 83210 1.20178E-5 41605 0 8.24688E-6
4-73951148-T-G p.Asp2075Ala missense ANKRD17 1 83206 1.20184E-5 41603 0 NA
4-73951154-T-C p.Asn2073Ser missense ANKRD17 1 83180 1.20221E-5 41590 0 8.253E-6
4-73951155-T-C p.Asn2073Asp missense ANKRD17 1 83164 1.20244E-5 41582 0 3.9795E-6
4-73951157-A-G p.Val2072Ala missense ANKRD17 2 83158 2.40506E-5 41579 0 NA
4-73951167-T-C c.6209-4A>G splice_region ANKRD17 1 83066 1.20386E-5 41533 0 1.19463E-5
4-73951169-A-G c.6209-6T>C splice_region ANKRD17 1 83038 1.20427E-5 41519 0 NA
4-73956393-T-C p.Ser2067Gly missense ANKRD17 1 83102 1.20334E-5 41551 0 3.18431E-5
4-73956398-G-C p.Ala2065Gly missense ANKRD17 1 83106 1.20328E-5 41553 0 NA
4-73956412-T-C p.Pro2060Pro synonymous ANKRD17 1 83162 1.20247E-5 41581 0 3.98346E-6
4-73956451-A-T p.His2047Gln missense ANKRD17 3 83198 3.60586E-5 41599 0 1.19358E-5
4-73956466-A-G p.Asn2042Asn synonymous ANKRD17 5 83216 6.00846E-5 41608 0 2.47247E-5
4-73956484-T-C p.Lys2036Lys synonymous ANKRD17 1 83216 1.20169E-5 41608 0 NA
4-73956498-T-C p.Met2032Val missense ANKRD17 9 83234 1.08129E-4 41617 0 9.55414E-5
4-73956500-G-C p.Ser2031Cys missense ANKRD17 1 83240 1.20135E-5 41620 0 NA
4-73956507-G-T p.Pro2029Thr missense ANKRD17 35 83240 4.20471E-4 41620 0 1.07091E-4
4-73956530-G-C p.Ser2021Cys missense ANKRD17 1 83214 1.20172E-5 41607 0 NA
4-73956554-G-A p.Ser2013Phe missense ANKRD17 1 83180 1.20221E-5 41590 0 3.1839E-5
4-73956562-G-A p.Ser2010Ser synonymous ANKRD17 1 83172 1.20233E-5 41586 0 NA
4-73956572-A-T p.Phe2007Tyr missense ANKRD17 3 83166 3.60724E-5 41583 0 3.1841E-5
4-73956583-A-G p.Phe2003Phe synonymous ANKRD17 1 83134 1.20288E-5 41567 0 3.18324E-5
4-73956586-G-A p.Pro2002Pro synonymous ANKRD17 3 83130 3.60881E-5 41565 0 NA
4-73956587-G-A p.Pro2002Leu missense ANKRD17 2 83124 2.40604E-5 41562 0 NA
4-73956590-C-T p.Gly2001Glu missense ANKRD17 1 83128 1.20296E-5 41564 0 2.47125E-5
4-73956606-C-T p.Ala1996Thr missense ANKRD17 2 83126 2.40599E-5 41563 0 NA
4-73956623-A-C p.Ile1990Ser missense ANKRD17 1 83150 1.20265E-5 41575 0 NA
4-73956626-G-C p.Pro1989Arg missense ANKRD17 1 83156 1.20256E-5 41578 0 NA
4-73956641-T-C p.His1984Arg missense ANKRD17 1 83180 1.20221E-5 41590 0 NA
4-73956646-T-C p.Ser1982Ser synonymous ANKRD17 2 83176 2.40454E-5 41588 0 7.95684E-6
4-73956649-A-G p.Asn1981Asn synonymous ANKRD17 2 83184 2.40431E-5 41592 0 3.1841E-5
4-73956679-C-T p.Ser1971Ser synonymous ANKRD17 1 83178 1.20224E-5 41589 0 3.97896E-5
4-73956680-G-A p.Ser1971Leu missense ANKRD17 2 83190 2.40414E-5 41595 0 0.001875
4-73956724-G-C p.His1956Gln missense ANKRD17 1 83266 1.20097E-5 41633 0 NA
4-73956728-T-C p.Asn1955Ser missense ANKRD17 1 83252 1.20117E-5 41626 0 8.23778E-6
4-73956734-CTG-TTA p.LeuSer1952LeuAsn missense ANKRD17 13 83252 1.56152E-4 41626 1 NA
4-73956734-C-T p.Ser1953Asn missense ANKRD17 8 83252 9.60938E-5 41626 0 0.00151057
4-73956736-G-A p.Leu1952Leu synonymous ANKRD17 32094 82944 0.386936 41472 6434 0.393639
4-73956757-T-C p.Gln1945Gln synonymous ANKRD17 77 83258 9.24836E-4 41629 0 0.00352467
4-73956761-A-G p.Val1944Ala missense ANKRD17 1 83248 1.20123E-5 41624 0 8.24158E-6
4-73956793-G-A p.Gly1933Gly synonymous ANKRD17 1 83220 1.20163E-5 41610 0 3.58286E-5
4-73956798-G-T p.His1932Asn missense ANKRD17 1 83200 1.20192E-5 41600 0 NA
4-73956805-T-G p.Pro1929Pro synonymous ANKRD17 43 83176 5.16976E-4 41588 1 0.00375
4-73956805-T-C p.Pro1929Pro synonymous ANKRD17 1 83176 1.20227E-5 41588 0 NA
4-73956811-A-T p.Ile1927Ile synonymous ANKRD17 1 83150 1.20265E-5 41575 0 3.9833E-6
4-73956824-T-C p.Glu1923Gly missense ANKRD17 1 83114 1.20317E-5 41557 0 NA
4-73956836-G-A p.Thr1919Ile missense ANKRD17 2 83100 2.40674E-5 41550 0 7.97041E-6
4-73956837-T-C p.Thr1919Ala missense ANKRD17 4 83090 4.81406E-5 41545 0 3.19061E-5
4-73956839-G-C p.Pro1918Arg missense ANKRD17 7 83100 8.42359E-5 41550 0 2.78896E-5
4-73956840-G-A p.Pro1918Ser missense ANKRD17 1 83082 1.20363E-5 41541 0 1.65046E-5
4-73956847-G-A p.Cys1915Cys synonymous ANKRD17 1 83072 1.20378E-5 41536 0 3.9833E-6
4-73956851-C-T p.Gly1914Glu missense ANKRD17 1 83106 1.20328E-5 41553 0 NA
4-73956855-T-C p.Met1913Val missense ANKRD17 1 83152 1.20262E-5 41576 0 NA
4-73956861-T-A p.Thr1911Ser missense ANKRD17 1 83176 1.20227E-5 41588 0 NA
4-73956879-T-A p.Thr1905Ser missense ANKRD17 1 83228 1.20152E-5 41614 0 NA
4-73956882-C-T p.Val1904Met missense ANKRD17 1 83238 1.20137E-5 41619 0 7.95798E-6
4-73956886-G-A p.Ala1902Ala synonymous ANKRD17 3 83264 3.603E-5 41632 0 0.00100705
4-73956888-C-T p.Ala1902Thr missense ANKRD17 1 83258 1.20109E-5 41629 0 NA
4-73956891-T-C p.Thr1901Ala missense ANKRD17 3 83262 3.60308E-5 41631 0 5.76863E-5
4-73956900-C-G p.Val1898Leu missense ANKRD17 7 83274 8.40599E-5 41637 0 3.18532E-5
4-73956901-C-T p.Ala1897Ala synonymous ANKRD17 40 83278 4.80319E-4 41639 0 0.00121073
4-73956902-G-A p.Ala1897Val missense ANKRD17 21 83284 2.52149E-4 41642 0 1.63106E-4
4-73956933-G-C p.Pro1887Ala missense ANKRD17 14 83366 1.67934E-4 41683 0 0.00100705
4-73956933-G-A p.Pro1887Ser missense ANKRD17 1 83366 1.19953E-5 41683 0 3.29516E-5
4-73956944-C-G p.Arg1883Thr missense ANKRD17 1 83370 1.19947E-5 41685 0 NA
4-73956952-C-CG p.Glu1881fs frameshift ANKRD17 1 83370 1.19947E-5 41685 0 NA
4-73956952-C-T p.Pro1880Pro synonymous ANKRD17 2 83370 2.39894E-5 41685 0 4.94234E-5
4-73956953-G-A p.Pro1880Leu missense ANKRD17 3 83376 3.59816E-5 41688 0 6.25E-4
4-73956955-G-C p.Pro1879Pro synonymous ANKRD17 1 83376 1.19939E-5 41688 0 NA
4-73956956-G-A p.Pro1879Leu missense ANKRD17 1 83370 1.19947E-5 41685 0 3.18532E-5
4-73956957-G-C p.Pro1879Ala missense ANKRD17 162 83362 0.00194333 41681 0 0.00128451
4-73956968-G-C p.Ser1875Cys missense ANKRD17 1 83372 1.19944E-5 41686 0 6.25E-4
4-73957007-C-A p.Gly1862Val missense ANKRD17 1 83398 1.19907E-5 41699 0 NA
4-73957009-C-T p.Pro1861Pro synonymous ANKRD17 3 83400 3.59712E-5 41700 0 2.47117E-5
4-73957010-G-A p.Pro1861Leu missense ANKRD17 7 83398 8.39349E-5 41699 0 1.59276E-4
4-73957015-T-C p.Gln1859Gln synonymous ANKRD17 1 83396 1.1991E-5 41698 0 4.94242E-5
4-73957047-CAGA-C p.Ser1848del conservative_inframe_deletion ANKRD17 1 83396 1.1991E-5 41698 0 3.18573E-5
4-73957067-G-A p.Pro1842Leu missense ANKRD17 5 83402 5.99506E-5 41701 0 6.37105E-5
4-73957070-G-A p.Pro1841Leu missense ANKRD17 1 83404 1.19898E-5 41702 0 3.97842E-6
4-73957072-T-A p.Arg1840Ser missense ANKRD17 12 83400 1.43885E-4 41700 0 3.18837E-4
4-73957083-T-C p.Thr1837Ala missense ANKRD17 1 83404 1.19898E-5 41702 0 8.23723E-6
4-73957096-T-C p.Pro1832Pro synonymous ANKRD17 3 83402 3.59704E-5 41701 0 1.1933E-5
4-73957101-G-T p.Pro1831Thr missense ANKRD17 2 83402 2.39802E-5 41701 0 NA
4-73957119-C-T p.Glu1825Lys missense ANKRD17 2 83394 2.39825E-5 41697 0 3.18634E-5
4-73957119-C-G p.Glu1825Gln missense ANKRD17 1 83396 1.1991E-5 41698 0 NA
4-73957121-G-A p.Ser1824Phe missense ANKRD17 1 83394 1.19913E-5 41697 0 8.23683E-6
4-73957134-C-T p.Val1820Met missense ANKRD17 2 83386 2.39848E-5 41693 0 NA
4-73957137-T-C p.Lys1819Glu missense ANKRD17 1 83374 1.19941E-5 41687 0 NA
4-73957142-G-A p.Pro1817Leu missense ANKRD17 1 83374 1.19941E-5 41687 0 NA
4-73957143-G-A p.Pro1817Ser missense ANKRD17 1 83376 1.19939E-5 41688 0 NA
4-73957150-T-C p.Ser1814Ser synonymous ANKRD17 1 83380 1.19933E-5 41690 0 3.1839E-5
4-73957153-T-A p.Gly1813Gly synonymous ANKRD17 1 83376 1.19939E-5 41688 0 NA
4-73957157-C-A p.Cys1812Phe missense ANKRD17 1 83366 1.19953E-5 41683 0 8.23669E-6
4-73957162-C-G p.Leu1810Phe missense ANKRD17 1 83364 1.19956E-5 41682 0 NA
4-73957171-G-A p.Asn1807Asn synonymous ANKRD17 1 83358 1.19964E-5 41679 0 8.2371E-6
4-73957181-A-G p.Val1804Ala missense ANKRD17 1 83340 1.1999E-5 41670 0 1.19336E-5
4-73957183-C-CAAGA p.Val1804fs frameshift ANKRD17 2 83342 2.39975E-5 41671 0 NA
4-73957186-T-A p.Gly1802Gly synonymous ANKRD17 1 83334 1.19999E-5 41667 0 NA
4-73957192-C-A p.Gln1800His missense ANKRD17 1 83332 1.20002E-5 41666 0 1.19362E-5
4-73957198-T-C p.Pro1798Pro synonymous ANKRD17 3 83332 3.60006E-5 41666 0 1.59138E-5
4-73957208-G-T p.Pro1795Gln missense ANKRD17 1 83316 1.20025E-5 41658 0 NA
4-73957210-G-A p.Ser1794Ser synonymous ANKRD17 2 83304 2.40085E-5 41652 0 6.25E-4
4-73957218-G-C p.Pro1792Ala missense ANKRD17 1 83274 1.20085E-5 41637 0 1.19418E-5
4-73957228-T-C p.Pro1788Pro synonymous ANKRD17 3 83258 3.60326E-5 41629 0 7.96153E-6
4-73957234-G-A p.His1786His synonymous ANKRD17 1 83254 1.20114E-5 41627 0 NA
4-73957246-A-C p.Thr1782Thr synonymous ANKRD17 1 83252 1.20117E-5 41626 0 6.37024E-5
4-73957271-G-A p.Thr1774Ile missense ANKRD17 2 83310 2.40067E-5 41655 0 1.19408E-5
4-73957279-A-G p.Thr1771Thr synonymous ANKRD17 1 83330 1.20005E-5 41665 0 NA
4-73957280-GTGT-G p.Asn1770del disruptive_inframe_deletion ANKRD17 4 83322 4.80065E-5 41661 0 4.37609E-5
4-73957297-C-T p.Thr1765Thr synonymous ANKRD17 2 83348 2.39958E-5 41674 0 3.18512E-5
4-73957308-C-T p.Val1762Ile missense ANKRD17 3 83368 3.5985E-5 41684 0 3.18492E-5
4-73957315-T-G p.Thr1759Thr synonymous ANKRD17 2 83374 2.39883E-5 41687 0 NA
4-73957321-G-A p.Ala1757Ala synonymous ANKRD17 1 83374 1.19941E-5 41687 0 NA
4-73957325-T-C p.Asn1756Ser missense ANKRD17 2 83374 2.39883E-5 41687 0 3.18593E-5
4-73957329-A-T p.Ser1755Thr missense ANKRD17 2 83376 2.39877E-5 41688 0 NA
4-73957338-C-T p.Val1752Met missense ANKRD17 2 83376 2.39877E-5 41688 0 NA
4-73957347-C-T p.Val1749Ile missense ANKRD17 2 83384 2.39854E-5 41692 0 6.37227E-5
4-73957353-G-C p.Leu1747Val missense ANKRD17 1 83382 1.1993E-5 41691 0 NA
4-73957361-C-T p.Arg1744Gln missense ANKRD17 2 83388 2.39843E-5 41694 0 4.37414E-5
4-73957362-G-C p.Arg1744Gly missense ANKRD17 2 83388 2.39843E-5 41694 0 3.18451E-5
4-73957380-G-C p.Pro1738Ala missense ANKRD17 1 83382 1.1993E-5 41691 0 NA
4-73957382-C-A p.Ser1737Ile missense ANKRD17 1 83386 1.19924E-5 41693 0 NA
4-73957394-G-C p.Ser1733Cys missense ANKRD17 2 83380 2.39866E-5 41690 0 6.36862E-5
4-73957398-T-C p.Thr1732Ala missense ANKRD17 3 83372 3.59833E-5 41686 0 1.19306E-5
4-73957410-T-C p.Thr1728Ala missense ANKRD17 7 83372 8.3961E-5 41686 0 8.23655E-5
4-73957414-A-G p.Ala1726Ala synonymous ANKRD17 1 83372 1.19944E-5 41686 0 NA
4-73957420-T-C p.Ser1724Ser synonymous ANKRD17 49 83364 5.87784E-4 41682 0 0.00133749
4-73957426-G-T p.Thr1722Thr synonymous ANKRD17 11 83366 1.31948E-4 41683 0 8.59654E-4
4-73957437-T-C p.Thr1719Ala missense ANKRD17 1 83354 1.1997E-5 41677 0 4.37546E-5
4-73957466-T-G p.Asn1709Thr missense ANKRD17 1 83360 1.19962E-5 41680 0 NA
4-73957489-C-T p.Gln1701Gln synonymous ANKRD17 1 83370 1.19947E-5 41685 0 NA
4-73957502-C-T p.Arg1697His missense ANKRD17 1 83370 1.19947E-5 41685 0 3.18573E-5
4-73957512-T-C p.Met1694Val missense ANKRD17 2 83370 2.39894E-5 41685 0 1.59068E-5
4-73957517-G-A p.Pro1692Leu missense ANKRD17 2 83374 2.39883E-5 41687 0 NA
4-73957518-G-A p.Pro1692Ser missense ANKRD17 1 83370 1.19947E-5 41685 0 NA
4-73957525-C-T p.Ser1689Ser synonymous ANKRD17 2 83362 2.39917E-5 41681 0 7.95368E-6
4-73957526-G-A p.Ser1689Leu missense ANKRD17 3 83358 3.59893E-5 41679 0 3.97668E-6
4-73957528-G-A p.Asn1688Asn synonymous ANKRD17 1 83360 1.19962E-5 41680 0 NA
4-73957547-C-T p.Ser1682Asn missense ANKRD17 1 83356 1.19967E-5 41678 0 NA
4-73957567-C-A p.Pro1675Pro synonymous ANKRD17 72 83364 8.63682E-4 41682 1 0.00375
4-73957567-C-T p.Pro1675Pro synonymous ANKRD17 3 83366 3.59859E-5 41683 0 6.58935E-5
4-73957576-A-G p.Thr1672Thr synonymous ANKRD17 68 83352 8.15817E-4 41676 0 0.00151057
4-73957587-C-G p.Ala1669Pro missense ANKRD17 1 83350 1.19976E-5 41675 0 NA
4-73957591-T-C p.Pro1667Pro synonymous ANKRD17 17 83360 2.03935E-4 41680 0 0.00121087
4-73957623-A-T p.Leu1657Met missense ANKRD17 1 83352 1.19973E-5 41676 0 8.2371E-6
4-73957626-T-C p.Arg1656Gly missense ANKRD17 4 83360 4.79846E-5 41680 0 2.47117E-5
4-73957633-A-G p.Arg1653Arg synonymous ANKRD17 1 83358 1.19964E-5 41679 0 NA
4-73957666-A-G p.Ala1642Ala synonymous ANKRD17 3 83382 3.5979E-5 41691 0 1.59215E-4
4-73957685-G-T p.Pro1636His missense ANKRD17 1 83394 1.19913E-5 41697 0 NA
4-73957703-A-G p.Leu1630Pro missense ANKRD17 1 83404 1.19898E-5 41702 0 NA
4-73957706-G-C p.Ser1629Cys missense ANKRD17 1 83410 1.1989E-5 41705 0 3.97649E-6
4-73957720-A-G p.Pro1624Pro synonymous ANKRD17 1 83416 1.19881E-5 41708 0 NA
4-73957729-A-G p.Asn1621Asn synonymous ANKRD17 3 83404 3.59695E-5 41702 0 1.27372E-4
4-73957756-G-A p.His1612His synonymous ANKRD17 1 83386 1.19924E-5 41693 0 0.00100705
4-73957762-G-A p.Ser1610Ser synonymous ANKRD17 2 83378 2.39871E-5 41689 0 NA
4-73957776-T-A p.Ile1606Phe missense ANKRD17 1 83384 1.19927E-5 41692 0 NA
4-73957786-A-T p.Thr1602Thr synonymous ANKRD17 1 83378 1.19936E-5 41689 0 3.18431E-5
4-73957789-G-C p.Leu1601Leu synonymous ANKRD17 12 83376 1.43926E-4 41688 0 0.00100705
4-73957816-T-C p.Ser1592Ser synonymous ANKRD17 1 83388 1.19921E-5 41694 0 NA
4-73957818-A-T p.Ser1592Thr missense ANKRD17 1 83382 1.1993E-5 41691 0 NA
4-73957827-C-T p.Val1589Ile missense ANKRD17 5 83382 5.9965E-5 41691 0 8.23642E-6
4-73957843-T-C p.Gly1583Gly synonymous ANKRD17 1 83366 1.19953E-5 41683 0 NA
4-73957863-C-T p.Ala1577Thr missense ANKRD17 1 83362 1.19959E-5 41681 0 8.23642E-6
4-73957875-T-C p.Thr1573Ala missense ANKRD17 1 83350 1.19976E-5 41675 0 NA
4-73957890-CT-C p.Ile1567fs frameshift ANKRD17 1 83326 1.20011E-5 41663 0 3.9782E-6
4-73957894-T-C p.Lys1566Lys synonymous ANKRD17 1 83316 1.20025E-5 41658 0 NA
4-73957906-T-C p.Ser1562Ser synonymous ANKRD17 3 83288 3.60196E-5 41644 0 1.64745E-5
4-73957907-G-A p.Ser1562Leu missense ANKRD17 2 83288 2.40131E-5 41644 0 NA
4-73957909-G-A p.Ser1561Ser synonymous ANKRD17 1 83286 1.20068E-5 41643 0 NA
4-73957911-A-C p.Ser1561Ala missense ANKRD17 11 83274 1.32094E-4 41637 0 3.18634E-5
4-73957922-C-T p.Arg1557His missense ANKRD17 1 83238 1.20137E-5 41619 0 8.23845E-6
4-73957947-T-A p.Ile1549Phe missense ANKRD17 2 83162 2.40494E-5 41581 0 3.18431E-5
4-73957951-T-G p.Lys1547Asn missense ANKRD17 1 83142 1.20276E-5 41571 0 NA
4-73957964-T-C p.Lys1543Arg missense ANKRD17 1 83064 1.20389E-5 41532 0 2.40616E-5
4-73957975-A-G p.Asn1539Asn synonymous ANKRD17 7 82988 8.43495E-5 41494 0 3.22885E-4
4-73957978-A-G p.Ile1538Ile synonymous ANKRD17 1 82944 1.20563E-5 41472 0 NA
4-73957995-G-C p.Gln1533Glu missense ANKRD17 3 82762 3.62485E-5 41381 0 8.34084E-6
4-73957997-C-T p.Arg1532Lys missense ANKRD17 1 82740 1.20861E-5 41370 0 NA
4-73959809-T-A p.Ile1521Leu missense ANKRD17 1 83088 1.20354E-5 41544 0 NA
4-73959853-G-A p.Ala1506Val missense ANKRD17 1 83120 1.20308E-5 41560 0 NA
4-73959876-A-C p.Asn1498Lys missense ANKRD17 1 83100 1.20337E-5 41550 0 NA
4-73959924-T-C p.Pro1482Pro synonymous ANKRD17 1 82882 1.20653E-5 41441 0 7.16464E-5
4-73959945-C-T p.Arg1475Arg splice_region+synonymous ANKRD17 2 82686 2.41879E-5 41343 0 1.99478E-5
4-73962826-T-C c.4424+8A>G splice_region ANKRD17 2 83190 2.40414E-5 41595 0 NA
4-73962827-TACTC-T c.4424+3_4424+6delGAGT splice_region ANKRD17 6 83194 7.21206E-5 41597 0 4.08664E-6
4-73962839-T-C p.Val1473Val synonymous ANKRD17 4 83268 4.80377E-5 41634 0 NA
4-73962869-T-C p.Gln1463Gln synonymous ANKRD17 5 83300 6.0024E-5 41650 0 2.22987E-4
4-73962876-C-G p.Arg1461Pro missense ANKRD17 1 83308 1.20036E-5 41654 0 NA
4-73962877-G-A p.Arg1461Cys missense ANKRD17 1 83310 1.20034E-5 41655 0 4.02204E-6
4-73962888-GC-CT p.Ala1457Arg missense ANKRD17 2 83310 2.40067E-5 41655 0 NA
4-73962920-G-A p.Pro1446Pro synonymous ANKRD17 4 83268 4.80377E-5 41634 0 1.59226E-4
4-73962930-C-A p.Gly1443Val missense ANKRD17 1 83264 1.201E-5 41632 0 1.64761E-5
4-73962942-C-T p.Cys1439Tyr missense ANKRD17 5 83232 6.0073E-5 41616 0 4.0858E-6
4-73962945-G-A p.Thr1438Ile missense ANKRD17 4 83202 4.80758E-5 41601 0 2.47885E-5
4-73962946-T-C p.Thr1438Ala missense ANKRD17 1 83206 1.20184E-5 41603 0 8.24117E-6
4-73962949-A-T p.Ser1437Thr missense ANKRD17 2 83182 2.40437E-5 41591 0 8.3062E-6
4-73962950-T-C p.Leu1436Leu synonymous ANKRD17 2 83174 2.4046E-5 41587 0 1.24527E-5
4-73962968-T-C p.Glu1430Glu synonymous ANKRD17 15 83000 1.80723E-4 41500 0 1.59246E-4
4-73962977-A-C p.Thr1427Thr synonymous ANKRD17 3 82808 3.62284E-5 41404 0 NA
4-73962989-T-TTTTATTGAAGCCTTGCCAGAAACAGATTTTCTCTCTTC c.4269-1_4269insGAAGAGAGAAAATCTGTTTCTGGCAAGGCTTCAATAAA splice_acceptor ANKRD17 4 82622 4.84133E-5 41311 0 NA
4-73963783-A-T c.4268+7T>A splice_region ANKRD17 29 83102 3.48969E-4 41551 0 4.14013E-4
4-73963787-A-G c.4268+3T>C splice_region ANKRD17 2 83172 2.40466E-5 41586 0 NA
4-73963794-T-C p.Ile1422Val missense ANKRD17 1 83232 1.20146E-5 41616 0 8.60363E-6
4-73963817-T-C p.Lys1414Arg missense ANKRD17 1 83302 1.20045E-5 41651 0 NA
4-73963824-C-G p.Glu1412Gln missense ANKRD17 1 83304 1.20042E-5 41652 0 NA
4-73963837-T-C p.Thr1407Thr synonymous ANKRD17 126 83296 0.00151268 41648 2 0.00471248
4-73963842-CAAG-C p.Leu1405del conservative_inframe_deletion ANKRD17 1 83310 1.20034E-5 41655 0 NA
4-73963868-C-T p.Ser1397Asn missense ANKRD17 1 83334 1.19999E-5 41667 0 1.64745E-5
4-73963872-C-T p.Val1396Met missense ANKRD17 1 83336 1.19996E-5 41668 0 NA
4-73963901-T-C p.Asn1386Ser missense ANKRD17 1 83370 1.19947E-5 41685 0 8.23669E-6
4-73963904-T-C p.Asp1385Gly missense ANKRD17 1 83374 1.19941E-5 41687 0 3.18431E-5
4-73963921-G-T p.Asn1379Lys missense ANKRD17 1 83394 1.19913E-5 41697 0 3.97659E-6
4-73963934-C-A p.Ser1375Ile missense ANKRD17 1 83394 1.19913E-5 41697 0 NA
4-73963941-C-T p.Asp1373Asn missense ANKRD17 2 83396 2.3982E-5 41698 0 NA
4-73963942-G-A p.Ser1372Ser synonymous ANKRD17 1 83394 1.19913E-5 41697 0 3.18492E-5
4-73963943-C-T p.Ser1372Asn missense ANKRD17 1 83394 1.19913E-5 41697 0 3.97662E-6
4-73963965-T-C p.Asn1365Asp missense ANKRD17 1 83388 1.19921E-5 41694 0 NA
4-73963975-C-T p.Gly1361Gly synonymous ANKRD17 1 83396 1.1991E-5 41698 0 8.23642E-6
4-73963984-G-A p.Ser1358Ser synonymous ANKRD17 1 83404 1.19898E-5 41702 0 4.11821E-5
4-73963997-C-T p.Ser1354Asn missense ANKRD17 1 83400 1.19904E-5 41700 0 3.97687E-6
4-73964016-C-A p.Val1348Leu missense ANKRD17 1 83396 1.1991E-5 41698 0 NA
4-73964016-C-T p.Val1348Met missense ANKRD17 1 83396 1.1991E-5 41698 0 NA
4-73964033-T-A p.Tyr1342Phe missense ANKRD17 4 83406 4.79582E-5 41703 0 1.59062E-5
4-73964039-A-T p.Ile1340Asn missense ANKRD17 2 83406 2.39791E-5 41703 0 NA
4-73964044-T-C p.Leu1338Leu synonymous ANKRD17 2 83408 2.39785E-5 41704 0 8.23642E-6
4-73964052-C-T p.Asp1336Asn missense ANKRD17 1 83394 1.19913E-5 41697 0 8.23642E-6
4-73964064-T-A p.Ile1332Phe missense ANKRD17 2 83386 2.39848E-5 41693 0 9.55231E-5
4-73964079-G-A p.Pro1327Ser missense ANKRD17 1 83362 1.19959E-5 41681 0 NA
4-73964114-C-T p.Ser1315Asn missense ANKRD17 1 83304 1.20042E-5 41652 0 7.9545E-6
4-73964116-G-C p.Thr1314Thr synonymous ANKRD17 1 83308 1.20036E-5 41654 0 NA
4-73964122-A-C p.Thr1312Thr synonymous ANKRD17 1 83304 1.20042E-5 41652 0 6.37186E-5
4-73964150-G-T p.Ser1303Tyr missense ANKRD17 1 83242 1.20132E-5 41621 0 3.18451E-5
4-73964170-G-T p.Thr1296Thr synonymous ANKRD17 3 83206 3.60551E-5 41603 0 6.36943E-5
4-73964174-G-A p.Ala1295Val missense ANKRD17 1 83186 1.20213E-5 41593 0 5.03525E-4
4-73964176-A-C p.Ser1294Ser synonymous ANKRD17 2 83182 2.40437E-5 41591 0 NA
4-73964182-A-T p.Gly1292Gly synonymous ANKRD17 2 83156 2.40512E-5 41578 0 NA
4-73964196-T-C p.Thr1288Ala missense ANKRD17 1 83058 1.20398E-5 41529 0 NA
4-73964208-T-C p.Ser1284Gly missense ANKRD17 8 82938 9.64576E-5 41469 0 0.00100705
4-73964230-A-G p.Pro1276Pro synonymous ANKRD17 3 82650 3.62976E-5 41325 0 3.18471E-5
4-73964232-G-T p.Pro1276Thr missense ANKRD17 1 82562 1.21121E-5 41281 0 NA
4-73964235-C-G p.Glu1275Gln missense+splice_region ANKRD17 4 82502 4.84837E-5 41251 0 1.27372E-4
4-73964239-T-TTCAACTTTAA c.3821-3_3821-2insTTAAAGTTGA splice_region ANKRD17 3 82414 3.64016E-5 41207 0 NA
4-73966580-G-A n.561C>T splice_region ANKRD17 1 24260 4.12201E-5 12130 0 NA
4-73968085-G-T c.3820+8C>A splice_region ANKRD17 1 80020 1.24969E-5 40010 0 8.37423E-6
4-73968108-TTTC-T p.Glu1268del conservative_inframe_deletion ANKRD17 5 80196 6.23473E-5 40098 0 3.20357E-5
4-73968118-T-C p.Gln1265Gln synonymous ANKRD17 5 80210 6.23364E-5 40105 0 3.48363E-4
4-73968123-C-T p.Ala1264Thr missense ANKRD17 2 80204 2.49364E-5 40102 0 4.40176E-6
4-73968134-T-G p.Glu1260Ala missense ANKRD17 1 80198 1.24691E-5 40099 0 8.35254E-6
4-73968156-C-T p.Ala1253Thr missense ANKRD17 2 80110 2.49657E-5 40055 0 NA
4-73968169-T-C p.Leu1248Leu synonymous ANKRD17 10 80118 1.24816E-4 40059 0 5.18135E-4
4-73968171-G-GTTAAAATTATA p.Leu1248fs frameshift ANKRD17 1 80110 1.24828E-5 40055 0 NA
4-73968215-C-CT p.Arg1233fs frameshift ANKRD17 6 79982 7.50169E-5 39991 0 NA
4-73968216-T-G p.Arg1233Arg synonymous ANKRD17 3 79964 3.75169E-5 39982 0 NA
4-73968229-C-T p.Ala1228Ala synonymous ANKRD17 26 79662 3.26379E-4 39831 0 4.20413E-4
4-73968232-A-T p.Ala1227Ala synonymous ANKRD17 1 79592 1.25641E-5 39796 0 2.11076E-5
4-73968249-G-T p.Arg1222Arg synonymous ANKRD17 5 79432 6.29469E-5 39716 0 8.29352E-5
4-73968266-T-TTTTCCAA c.3649-3_3649-2insTTGGAAA splice_region ANKRD17 2 79308 2.52181E-5 39654 0 NA
4-73968270-A-G c.3649-6T>C splice_region ANKRD17 1 79272 1.26148E-5 39636 0 NA
4-73968272-A-G c.3649-8T>C splice_region ANKRD17 77 79256 9.71535E-4 39628 0 8.13262E-4
4-73979540-C-T p.Ser1206Asn missense ANKRD17 1 83110 1.20322E-5 41555 0 NA
4-73979581-T-TCAAA p.Gln1192fs frameshift ANKRD17 1 82960 1.2054E-5 41480 0 NA
4-73979589-T-C p.Ile1190Val missense ANKRD17 1 82896 1.20633E-5 41448 0 6.36862E-5
4-73979597-A-T p.Met1187Lys missense ANKRD17 1 82828 1.20732E-5 41414 0 NA
4-73979626-C-CT c.3532-2_3532-1insA splice_acceptor ANKRD17 2 82280 2.43072E-5 41140 1 NA
4-73981531-A-G c.3531+7T>C splice_region ANKRD17 1 82594 1.21074E-5 41297 0 3.18431E-5
4-73981614-C-G p.Arg1152Pro missense ANKRD17 1 82794 1.20782E-5 41397 0 NA
4-73984408-T-C p.Arg1144Arg synonymous ANKRD17 1 83270 1.20091E-5 41635 0 NA
4-73984441-G-A p.Asn1133Asn synonymous ANKRD17 1 83360 1.19962E-5 41680 0 3.97776E-6
4-73984482-A-G p.Leu1120Leu synonymous ANKRD17 1 83400 1.19904E-5 41700 0 1.98847E-5
4-73984483-C-T p.Gln1119Gln synonymous ANKRD17 1 83398 1.19907E-5 41699 0 NA
4-73984495-G-A p.Leu1115Leu synonymous ANKRD17 6 83402 7.19407E-5 41701 0 5.03525E-4
4-73984524-A-G p.Leu1106Leu synonymous ANKRD17 1 83400 1.19904E-5 41700 0 3.19366E-5
4-73984556-A-G p.Ile1095Thr missense ANKRD17 1 83326 1.20011E-5 41663 0 8.23859E-6
4-73985941-A-G p.Asp1070Asp synonymous ANKRD17 1 83278 1.2008E-5 41639 0 3.58029E-5
4-73985963-G-A p.Pro1063Leu missense ANKRD17 1 83284 1.20071E-5 41642 0 NA
4-73985964-G-A p.Pro1063Ser missense ANKRD17 1 83288 1.20065E-5 41644 0 NA
4-73985967-C-A p.Ala1062Ser missense ANKRD17 1 83280 1.20077E-5 41640 0 NA
4-73985999-C-T p.Arg1051Gln missense ANKRD17 1 83208 1.20181E-5 41604 0 NA
4-73986001-G-A p.Gly1050Gly synonymous ANKRD17 1 83210 1.20178E-5 41605 0 NA
4-73986007-C-T p.Glu1048Glu synonymous ANKRD17 1 83198 1.20195E-5 41599 0 NA
4-73986010-C-T p.Ala1047Ala synonymous ANKRD17 192 83196 0.0023078 41598 0 0.008125
4-73986025-G-A p.Ala1042Ala synonymous ANKRD17 1 83152 1.20262E-5 41576 0 7.96331E-6
4-73986046-G-A p.Leu1035Leu synonymous ANKRD17 1 83070 1.2038E-5 41535 0 7.96984E-6
4-73986590-T-C c.3096+8A>G splice_region ANKRD17 1 82318 1.2148E-5 41159 0 NA
4-73986595-T-C c.3096+3A>G splice_region ANKRD17 1 82386 1.2138E-5 41193 0 NA
4-73986670-G-A p.Ala1008Ala synonymous ANKRD17 7 82734 8.46085E-5 41367 0 8.2409E-5
4-73986725-C-A p.Gly990Val missense ANKRD17 1 82586 1.21086E-5 41293 0 NA
4-73986748-A-G p.Ala982Ala synonymous ANKRD17 22 82680 2.66086E-4 41340 0 1.91203E-4
4-73986805-A-G p.Gly963Gly synonymous ANKRD17 36 82636 4.35645E-4 41318 0 6.36983E-4
4-73987377-T-C p.Ile947Val missense ANKRD17 1 82820 1.20744E-5 41410 0 NA
4-73987402-C-T p.Leu938Leu synonymous ANKRD17 2 82680 2.41896E-5 41340 0 NA
4-73987408-T-C p.Leu936Leu synonymous ANKRD17 1 82642 1.21004E-5 41321 0 3.18532E-5
4-73987435-G-A p.His927His synonymous ANKRD17 1 82310 1.21492E-5 41155 0 NA
4-73987443-T-C p.Lys925Glu missense ANKRD17 1 82208 1.21643E-5 41104 0 NA
4-73987464-A-G p.Leu918Leu synonymous ANKRD17 1 81814 1.22228E-5 40907 0 NA
4-73987465-T-C p.Leu917Leu synonymous ANKRD17 143 81792 0.00174834 40896 0 0.00189764
4-73987473-C-T p.Val915Met missense ANKRD17 4 81538 4.90569E-5 40769 0 5.0863E-5
4-73987476-C-T p.Val914Met missense+splice_region ANKRD17 2 81508 2.45375E-5 40754 0 NA
4-73987484-T-C c.2740-8A>G splice_region ANKRD17 1 81046 1.23387E-5 40523 0 NA
4-73990623-A-G c.2739+7T>C splice_region ANKRD17 1890 81450 0.0232044 40725 14 0.031875
4-73990626-T-C c.2739+4A>G splice_region ANKRD17 1 81700 1.22399E-5 40850 0 8.32889E-6
4-73990663-T-C p.Pro902Pro synonymous ANKRD17 9 82456 1.09149E-4 41228 0 5.03525E-4
4-73990681-T-C p.Glu896Glu synonymous ANKRD17 9 82692 1.08838E-4 41346 0 5.03525E-4
4-73990687-C-T p.Gln894Gln synonymous ANKRD17 1 82782 1.20799E-5 41391 0 NA
4-73990698-T-G p.Ile891Leu missense ANKRD17 1 82890 1.20642E-5 41445 0 NA
4-73990708-A-G p.Asn887Asn synonymous ANKRD17 1 82974 1.2052E-5 41487 0 8.26364E-6
4-73990717-C-T p.Leu884Leu synonymous ANKRD17 1 83052 1.20406E-5 41526 0 NA
4-73990741-A-C p.Gly876Gly synonymous ANKRD17 1 83176 1.20227E-5 41588 0 NA
4-73990755-C-A p.Ala872Ser missense ANKRD17 1 83224 1.20158E-5 41612 0 NA
4-73990761-T-C p.Ile870Val missense ANKRD17 1 83228 1.20152E-5 41614 0 3.18552E-5
4-73990762-G-A p.Leu869Leu synonymous ANKRD17 4 83234 4.80573E-5 41617 0 6.36943E-5
4-73990773-AACCTGGAGAAAAATAATGATCTTCTCACTACATGCTAAGGCAAAAGAACAAAATATCTGACCTTCAAAATAGGACTAAAAAATAATGTTCCTAAATAAATTTTTTGACCAGTATTCCAAAAAATAAAACAAAAGTAGGCCCT-A p.Gly865fs frameshift ANKRD17 2 83254 2.40229E-5 41627 1 NA
4-73990780-A-G c.2594-5T>C splice_region ANKRD17 10 83242 1.20132E-4 41621 0 0.00125
4-73990781-G-T c.2594-6C>A splice_region ANKRD17 1 83246 1.20126E-5 41623 0 NA
4-73990911-G-C c.2593+7C>G splice_region ANKRD17 13 82824 1.56959E-4 41412 0 3.19081E-5
4-73990911-GC-G c.2593+6delG splice_region ANKRD17 2 82826 2.4147E-5 41413 0 8.51694E-6
4-73990913-C-A c.2593+5G>T splice_region ANKRD17 1 82832 1.20726E-5 41416 0 1.65311E-5
4-73990914-C-A c.2593+4G>T splice_region ANKRD17 2 82836 2.41441E-5 41418 0 3.30502E-5
4-73990919-T-C p.Lys864Lys splice_region+synonymous ANKRD17 1 82892 1.20639E-5 41446 0 8.48507E-6
4-73990925-G-A p.Asp862Asp synonymous ANKRD17 4 82924 4.82369E-5 41462 0 0.00100705
4-73990941-C-G p.Ser857Thr missense ANKRD17 1 82996 1.20488E-5 41498 0 NA
4-73990960-G-A p.Leu851Leu synonymous ANKRD17 1 83054 1.20404E-5 41527 0 3.18674E-5
4-73990970-C-T p.Leu847Leu synonymous ANKRD17 11 83062 1.32431E-4 41531 0 4.78042E-4
4-73990979-G-A p.His844His synonymous ANKRD17 7 83072 8.42643E-5 41536 0 4.11977E-5
4-73991003-T-A p.Ter828Leuext*? stop_lost ANKRD17 1 83052 1.20406E-5 41526 0 NA
4-73991006-T-C p.His827Arg missense ANKRD17 79262 79392 0.998363 39696 39568 0.999375
4-73991009-C-T p.Arg826Gln missense ANKRD17 3 83004 3.61428E-5 41502 0 4.94788E-5
4-73991012-G-A p.Thr825Ile missense ANKRD17 1 82998 1.20485E-5 41499 0 8.24906E-6
4-73991027-A-C p.Leu820Arg missense+splice_region ANKRD17 2 82906 2.41237E-5 41453 0 NA
4-73991033-T-C c.2482-4A>G splice_region ANKRD17 1 82806 1.20764E-5 41403 0 4.46385E-6
4-73991036-G-T c.2482-7C>A splice_region ANKRD17 1 82748 1.20849E-5 41374 0 4.49111E-6
4-74000892-G-C p.Leu800Val missense+splice_region ANKRD17 1 83246 1.20126E-5 41623 0 NA
4-74000895-CTTGGAG-C c.2396-7_2396-2delCTCCAA splice_acceptor ANKRD17 2 83248 2.40246E-5 41624 0 6.36943E-5
4-74000915-T-C p.Gln800Gln synonymous ANKRD17 1 83296 1.20054E-5 41648 0 3.18817E-5
4-74000918-G-A p.Ser799Ser synonymous ANKRD17 2 83294 2.40113E-5 41647 0 3.18451E-5
4-74000923-T-C p.Ile798Val missense ANKRD17 4 83300 4.80192E-5 41650 0 9.56084E-5
4-74000933-A-G p.Ile794Ile synonymous ANKRD17 2 83298 2.40102E-5 41649 0 8.23954E-6
4-74000959-T-C p.Met786Val missense ANKRD17 1 83248 1.20123E-5 41624 0 3.99179E-6
4-74000968-C-T p.Ala783Thr missense ANKRD17 2 83214 2.40344E-5 41607 0 6.25E-4
4-74000984-TG-T c.2333-3delC splice_region ANKRD17 2 83066 2.40772E-5 41533 0 NA
4-74000984-T-TTTATTCCTGATGGGAAGAGTG c.2333-3_2333-2insCACTCTTCCCATCAGGAATAA splice_region ANKRD17 1 83066 1.20386E-5 41533 0 NA
4-74000990-A-G c.2333-8T>C splice_region ANKRD17 1 82968 1.20528E-5 41484 0 NA
4-74005251-C-A p.Ala1028Ser missense ANKRD17 1 83212 1.20175E-5 41606 0 NA
4-74005267-C-T p.Thr1022Thr synonymous ANKRD17 3 83246 3.60378E-5 41623 0 1.67751E-5
4-74005267-C-A p.Thr1022Thr synonymous ANKRD17 1 83246 1.20126E-5 41623 0 1.2002E-5
4-74005274-T-C p.Asn1020Ser missense ANKRD17 2 83282 2.40148E-5 41641 0 3.33428E-5
4-74005290-G-A p.Pro1015Ser missense ANKRD17 4 83296 4.80215E-5 41648 0 9.55353E-5
4-74005307-C-G p.Gly1009Ala missense ANKRD17 2 83284 2.40142E-5 41642 0 NA
4-74005308-CTTG-C p.Gln1008del conservative_inframe_deletion ANKRD17 5 83278 6.00399E-5 41639 0 4.3772E-5
4-74005313-T-C p.Gln1007Arg missense ANKRD17 1 83280 1.20077E-5 41640 0 NA
4-74005336-C-CTGAAAAA p.Gln1000fs frameshift ANKRD17 1 83234 1.20143E-5 41617 0 NA
4-74005338-C-T p.Gly999Arg missense ANKRD17 1 83238 1.20137E-5 41619 0 NA
4-74005352-T-A p.Gln994Leu missense ANKRD17 1 83198 1.20195E-5 41599 0 3.98172E-6
4-74005379-A-C p.Val985Gly missense ANKRD17 1 83102 1.20334E-5 41551 0 NA
4-74005399-T-C p.Thr978Thr synonymous ANKRD17 1 83022 1.2045E-5 41511 0 NA
4-74005402-A-G p.Leu977Leu synonymous ANKRD17 80 82994 9.63925E-4 41497 0 0.00264382
4-74005410-C-T p.Ala975Thr missense ANKRD17 1 82938 1.20572E-5 41469 0 3.18634E-5
4-74005413-T-C p.Ile974Val missense ANKRD17 3 82932 3.61742E-5 41466 0 3.98206E-6
4-74005422-G-A p.Pro971Ser missense ANKRD17 1 82898 1.2063E-5 41449 0 NA
4-74005429-G-C p.Pro968Pro synonymous ANKRD17 1 82896 1.20633E-5 41448 0 NA
4-74005431-G-A p.Pro968Ser missense ANKRD17 1 82888 1.20645E-5 41444 0 1.64921E-5
4-74005438-C-T p.Ala965Ala synonymous ANKRD17 6 82858 7.2413E-5 41429 0 5.03525E-4
4-74005439-G-A p.Ala965Val missense ANKRD17 1 82862 1.20683E-5 41431 0 3.18573E-5
4-74005444-A-G p.Pro963Pro synonymous ANKRD17 9 82890 1.08578E-4 41445 0 4.77768E-4
4-74005457-G-T p.Pro959His missense ANKRD17 1 82830 1.20729E-5 41415 0 6.36902E-5
4-74005468-A-C p.Pro955Pro synonymous ANKRD17 1 82778 1.20805E-5 41389 0 NA
4-74005476-T-C p.Ile953Val missense ANKRD17 1 82722 1.20887E-5 41361 0 8.24022E-6
4-74005480-C-T p.Ala951Ala synonymous ANKRD17 142 82666 0.00171776 41333 1 0.00264399
4-74005480-C-A p.Ala951Ala synonymous ANKRD17 6 82666 7.25812E-5 41333 0 9.55657E-5
4-74005487-C-T p.Gly949Asp missense ANKRD17 1 82682 1.20945E-5 41341 0 8.23981E-6
4-74005504-C-T p.Gln943Gln synonymous ANKRD17 1 82662 1.20975E-5 41331 0 1.19499E-5
4-74005543-C-T p.Gln930Gln synonymous ANKRD17 9 82872 1.08601E-4 41436 0 9.88435E-5
4-74005549-C-T p.Arg928Arg synonymous ANKRD17 52 82936 6.26989E-4 41468 0 0.0013696
4-74005551-G-A p.Arg928Trp missense ANKRD17 6 82936 7.23449E-5 41468 0 3.18471E-5
4-74005556-T-C p.Tyr926Cys missense ANKRD17 1 82994 1.20491E-5 41497 0 3.98026E-6
4-74005577-TCTCCAA-T p.Val917_Gly918del disruptive_inframe_deletion ANKRD17 1 83136 1.20285E-5 41568 0 3.29478E-5
4-74005582-A-G p.Val917Val synonymous ANKRD17 1 83168 1.20239E-5 41584 0 3.97877E-6
4-74005594-A-G p.Thr913Thr synonymous ANKRD17 11 83198 1.32215E-4 41599 0 1.23556E-4
4-74005598-A-G p.Leu912Pro missense ANKRD17 18 83198 2.16351E-4 41599 0 1.23567E-4
4-74005624-T-C p.Gln903Gln synonymous ANKRD17 4 83226 4.80619E-5 41613 0 4.11923E-5
4-74005637-T-A p.Gln899Leu missense ANKRD17 2 83208 2.40361E-5 41604 0 NA
4-74005644-G-C p.Gln897Glu missense ANKRD17 2 83202 2.40379E-5 41601 0 NA
4-74005655-G-A p.Ala893Val missense ANKRD17 2 83166 2.40483E-5 41583 0 NA
4-74005675-C-T p.Lys886Lys synonymous ANKRD17 1 83142 1.20276E-5 41571 0 1.64775E-5
4-74005680-T-G p.Lys885Gln missense ANKRD17 4 83148 4.8107E-5 41574 0 1.59238E-5
4-74005708-C-T p.Glu875Glu synonymous ANKRD17 6 83212 7.2105E-5 41606 0 4.94234E-5
4-74005717-T-C p.Val872Val synonymous ANKRD17 3 83254 3.60343E-5 41627 1 NA
4-74005725-G-T p.Gln870Lys missense ANKRD17 1 83282 1.20074E-5 41641 0 NA
4-74005729-T-C p.Glu868Glu synonymous ANKRD17 1 83282 1.20074E-5 41641 0 8.23683E-6
4-74005762-T-C p.Glu857Glu synonymous ANKRD17 1 83352 1.19973E-5 41676 0 3.97785E-6
4-74005789-G-A p.Ile848Ile synonymous ANKRD17 4 83370 4.79789E-5 41685 0 3.18593E-5
4-74005807-T-C p.Gln842Gln synonymous ANKRD17 7 83364 8.39691E-5 41682 0 9.94297E-5
4-74005846-A-G p.Asn829Asn synonymous ANKRD17 1 83316 1.20025E-5 41658 0 NA
4-74005927-C-G p.Gln802His missense ANKRD17 1 82950 1.20555E-5 41475 0 NA
4-74005931-T-C p.Asn801Ser missense ANKRD17 5 82922 6.02976E-5 41461 0 6.36902E-5
4-74005962-T-G p.Asn791His missense ANKRD17 1 82610 1.21051E-5 41305 0 NA
4-74005991-T-C p.Lys781Arg missense ANKRD17 8 81766 9.78402E-5 40883 0 4.83359E-5
4-74006002-T-TTTATTCCTGATGGGAAGA c.2333-3_2333-2insTCTTCCCATCAGGAATAA splice_region ANKRD17 6 81036 7.40412E-5 40518 3 NA
4-74006002-T-TTTATTCCTGATGGGAAGAGTGGTGGCAACATTG c.2333-3_2333-2insCAATGTTGCCACCACTCTTCCCATCAGGAATAA splice_region ANKRD17 2 81040 2.46792E-5 40520 1 NA
4-74006007-G-GA c.2333-8_2333-7insT splice_region ANKRD17 1 80720 1.23885E-5 40360 0 1.45252E-5
4-74007463-T-C p.Asn776Ser missense ANKRD17 2 83170 2.40471E-5 41585 0 8.2702E-6
4-74007470-T-C p.Ile774Val missense ANKRD17 2 83164 2.40489E-5 41582 0 8.26364E-6
4-74007471-G-A p.Pro773Pro synonymous ANKRD17 1 83186 1.20213E-5 41593 0 NA
4-74007473-G-A p.Pro773Ser missense ANKRD17 3 83188 3.60629E-5 41594 0 3.97937E-6
4-74007483-G-A p.Ala769Ala synonymous ANKRD17 1 83198 1.20195E-5 41599 0 8.25914E-6
4-74007490-T-C p.Asn767Ser missense ANKRD17 1 83220 1.20163E-5 41610 0 1.65196E-5
4-74007510-C-T c.385-1G>A splice_acceptor ANKRD17 2 83174 2.4046E-5 41587 0 NA
4-74007534-C-T p.Leu752Leu synonymous ANKRD17 4 83088 4.81417E-5 41544 0 3.18552E-5
4-74007536-G-A p.Leu752Leu synonymous ANKRD17 19 83060 2.2875E-4 41530 0 7.64234E-4
4-74007558-A-G p.Ala744Ala splice_region+synonymous ANKRD17 2 82814 2.41505E-5 41407 0 9.00463E-6
4-74007560-C-A p.Ala744Ser missense+splice_region ANKRD17 2 82786 2.41587E-5 41393 0 9.0501E-6
4-74007953-T-A c.2229+6A>T splice_region ANKRD17 1 81966 1.22002E-5 40983 0 3.18613E-5
4-74007970-C-T p.Asp740Asn missense ANKRD17 1 81926 1.22061E-5 40963 0 NA
4-74007975-G-A p.Ser738Phe missense ANKRD17 1 81980 1.21981E-5 40990 0 NA
4-74008003-G-A p.Pro729Ser missense ANKRD17 1 82078 1.21835E-5 41039 0 NA
4-74008006-G-C p.Pro728Ala missense ANKRD17 13 82098 1.58347E-4 41049 0 8.29531E-6
4-74008009-G-A p.Pro727Ser missense ANKRD17 2 82102 2.43599E-5 41051 0 NA
4-74008034-A-G p.Asp718Asp synonymous ANKRD17 1 82630 1.21021E-5 41315 0 NA
4-74008057-T-C p.Ser711Gly missense ANKRD17 2 82918 2.41202E-5 41459 0 3.30781E-5
4-74008069-C-G p.Gly707Arg missense ANKRD17 1 82930 1.20584E-5 41465 0 NA
4-74008091-A-G p.Thr699Thr synonymous ANKRD17 5 82964 6.02671E-5 41482 0 1.01642E-4
4-74008105-A-G c.2086-3T>C splice_region ANKRD17 1 82946 1.2056E-5 41473 0 NA
4-74008353-A-G c.2085+4T>C splice_region ANKRD17 3 83204 3.6056E-5 41602 0 4.94438E-5
4-74008357-T-C p.Lys695Lys splice_region+synonymous ANKRD17 3 83238 3.60412E-5 41619 0 3.98149E-6
4-74008370-G-C p.Thr691Ser missense ANKRD17 1 83278 1.2008E-5 41639 0 8.24076E-6
4-74008372-A-G p.Pro690Pro synonymous ANKRD17 1 83280 1.20077E-5 41640 0 NA
4-74008398-G-A p.Leu682Leu synonymous ANKRD17 1 83318 1.20022E-5 41659 0 NA
4-74008411-C-A p.Leu677Leu synonymous ANKRD17 1 83328 1.20008E-5 41664 0 3.97852E-6
4-74008420-C-G p.Gly674Gly synonymous ANKRD17 5 83320 6.00096E-5 41660 0 8.24511E-6
4-74008459-A-G p.Ala661Ala synonymous ANKRD17 15 83330 1.80007E-4 41665 0 9.55171E-5
4-74008459-A-C p.Ala661Ala synonymous ANKRD17 1 83330 1.20005E-5 41665 0 NA
4-74008480-C-T p.Ala654Ala synonymous ANKRD17 65 83300 7.80312E-4 41650 0 0.00125
4-74008482-C-T p.Ala654Thr missense+splice_region ANKRD17 1 83308 1.20036E-5 41654 0 NA
4-74008487-A-G c.1958-3T>C splice_region ANKRD17 4 83278 4.80319E-5 41639 0 1.70172E-5
4-74010459-T-C c.1957+3A>G splice_region ANKRD17 1 81602 1.22546E-5 40801 0 8.91695E-6
4-74010485-G-A p.Thr645Ile missense ANKRD17 1 82510 1.21197E-5 41255 0 8.43213E-6
4-74010507-C-T p.Ala638Thr missense ANKRD17 2 82628 2.42049E-5 41314 0 NA
4-74010510-C-A p.Ala637Ser missense ANKRD17 2 82604 2.42119E-5 41302 0 4.08884E-6
4-74010543-C-G p.Glu626Gln missense ANKRD17 1 82210 1.2164E-5 41105 0 3.32336E-5
4-74010549-C-CCAGATCTGCGCCTGCCTGAAGTAAGACAT c.1870-1_1870insATGTCTTACTTCAGGCAGGCGCAGATCTG splice_acceptor ANKRD17 4 82032 4.87615E-5 41016 2 NA
4-74010550-C-CAGATCTGCGCCTGCCTGAAGTAAGACATCTGCTACATCAGTA c.1870-2_1870-1insTACTGATGTAGCAGATGTCTTACTTCAGGCAGGCGCAGATCT splice_acceptor ANKRD17 2 81980 2.43962E-5 40990 1 NA
4-74010555-TA-T c.1870-7delT splice_region ANKRD17 2011 54828 0.0366783 27414 0 0.434362
4-74010555-T-TA c.1870-7_1870-6insT splice_region ANKRD17 273 77154 0.00353838 38577 0 0.0433869
4-74010555-TAA-T c.1870-8_1870-7delTT splice_region ANKRD17 68 81374 8.35648E-4 40687 0 0.0148416
4-74010555-T-TAA c.1870-7_1870-6insTT splice_region ANKRD17 2 81666 2.449E-5 40833 0 6.24328E-4
4-74010555-T-A c.1870-6A>T splice_region ANKRD17 2 81686 2.4484E-5 40843 0 6.79471E-4
4-74010555-TAAA-T c.1870-9_1870-7delTTT splice_region ANKRD17 6 81656 7.3479E-5 40828 0 9.64152E-4
4-74012487-T-A p.Ala621Ala synonymous ANKRD17 2 82296 2.43025E-5 41148 0 NA
4-74012489-C-T p.Ala621Thr missense ANKRD17 1 82356 1.21424E-5 41178 0 3.18492E-5
4-74012502-T-G p.Leu616Phe missense ANKRD17 1 82678 1.20951E-5 41339 0 NA
4-74012513-C-T p.Ala613Thr missense ANKRD17 8 82866 9.65414E-5 41433 0 0.00151057
4-74012515-A-G p.Val612Ala missense ANKRD17 1 82890 1.20642E-5 41445 0 6.37354E-5
4-74012540-C-T p.Ala604Thr missense ANKRD17 3 82992 3.61481E-5 41496 0 NA
4-74012541-A-G p.Tyr603Tyr synonymous ANKRD17 1 82988 1.20499E-5 41494 0 6.25E-4
4-74012548-A-G p.Leu601Pro missense ANKRD17 1 82994 1.20491E-5 41497 0 8.25123E-6
4-74012555-T-G p.Thr599Pro missense ANKRD17 1 82980 1.20511E-5 41490 0 NA
4-74012576-C-A p.Ala592Ser missense ANKRD17 2 82874 2.4133E-5 41437 0 NA
4-74012577-A-G p.His591His synonymous ANKRD17 3 82860 3.62056E-5 41430 0 5.03525E-4
4-74012578-T-C p.His591Arg missense ANKRD17 1 82832 1.20726E-5 41416 0 NA
4-74012580-A-T p.Val590Val synonymous ANKRD17 1 82814 1.20753E-5 41407 0 NA
4-74012582-C-T p.Val590Ile missense ANKRD17 2 82774 2.41622E-5 41387 0 3.98565E-6
4-74012593-G-GCAGC c.1760-4_1760-3insGCTG splice_region ANKRD17 2 82692 2.41861E-5 41346 1 NA
4-74012594-T-C c.1760-4A>G splice_region ANKRD17 1 82680 1.20948E-5 41340 0 8.26515E-6
4-74012595-A-T c.1760-5T>A splice_region ANKRD17 1 82648 1.20995E-5 41324 0 4.01623E-6
4-74012950-A-G c.1759+8T>C splice_region ANKRD17 9 82096 1.09628E-4 41048 0 5.66047E-4
4-74012961-C-T p.Ala586Thr missense ANKRD17 1 82158 1.21717E-5 41079 0 NA
4-74012963-G-A p.Ala585Val missense ANKRD17 2 82318 2.4296E-5 41159 0 NA
4-74012979-C-T p.Val580Ile missense ANKRD17 2 82514 2.42383E-5 41257 0 3.18573E-5
4-74012988-A-G p.Leu577Leu synonymous ANKRD17 39 82690 4.71641E-4 41345 0 9.56084E-4
4-74013005-G-C p.Ala571Gly missense ANKRD17 3 82958 3.61629E-5 41479 0 1.65229E-5
4-74013006-C-T p.Ala571Thr missense ANKRD17 4 82980 4.82044E-5 41490 0 NA
4-74013022-A-C p.Ser565Ser synonymous ANKRD17 1 83052 1.20406E-5 41526 0 4.44541E-5
4-74013043-G-A p.Ala558Ala synonymous ANKRD17 11 83120 1.32339E-4 41560 0 1.84706E-4
4-74013101-G-A p.Thr539Ile missense ANKRD17 1 83014 1.20462E-5 41507 0 NA
4-74013105-A-C p.Leu538Val missense ANKRD17 1 82926 1.20589E-5 41463 0 3.18532E-5
4-74013151-T-TTGACCAAGAAGTAATGCCACCATTTCTTCATGTCCTTCTCG c.1568-3_1568-2insCGAGAAGGACATGAAGAAATGGTGGCATTACTTCTTGGTCA splice_region ANKRD17 2 81006 2.46895E-5 40503 1 NA
4-74014521-T-TA c.1567+8_1567+9insT splice_region ANKRD17 1 83184 1.20215E-5 41592 0 1.1959E-5
4-74014524-G-A c.1567+6C>T splice_region ANKRD17 1 83192 1.20204E-5 41596 0 4.12814E-5
4-74014526-T-C c.1567+4A>G splice_region ANKRD17 2 83216 2.40338E-5 41608 0 9.0795E-5
4-74014648-C-T p.Ala483Ala synonymous ANKRD17 1 83346 1.19982E-5 41673 0 0.00151057
4-74014675-A-G p.Ala474Ala synonymous ANKRD17 2 83342 2.39975E-5 41671 0 NA
4-74014728-C-T p.Gly457Ser missense ANKRD17 1 83288 1.20065E-5 41644 0 NA
4-74014733-T-C p.Asp455Gly missense ANKRD17 1 83278 1.2008E-5 41639 0 9.3633E-6
4-74014756-A-T p.Val447Val synonymous ANKRD17 2 83182 2.40437E-5 41591 0 NA
4-74014768-C-CATGCAAGCCTCCATCAGAGCAGTGTGCATTTCATCTGTT c.1330-2_1330-1insAACAGATGAAATGCACACTGCTCTGATGGAGGCTTGCAT splice_acceptor ANKRD17 2 83078 2.40738E-5 41539 1 NA
4-74014772-T-C c.1330-5A>G splice_region ANKRD17 1 83000 1.20482E-5 41500 0 5.2333E-5
4-74017183-T-C p.Thr431Thr synonymous ANKRD17 1 83174 1.2023E-5 41587 0 NA
4-74017201-C-T p.Ala425Ala synonymous ANKRD17 985 83122 0.0118501 41561 3 0.0125
4-74017204-G-A p.Gly424Gly synonymous ANKRD17 4 83118 4.81244E-5 41559 0 3.18654E-5
4-74017204-G-T p.Gly424Gly synonymous ANKRD17 5 83118 6.01554E-5 41559 0 4.13538E-5
4-74017223-C-T p.Arg418Gln missense ANKRD17 1 83020 1.20453E-5 41510 0 2.49004E-5
4-74019625-C-T p.Glu402Glu synonymous ANKRD17 2 83042 2.40842E-5 41521 0 NA
4-74019646-C-T p.Thr395Thr synonymous ANKRD17 5 83178 6.0112E-5 41589 0 5.83217E-5
4-74019673-C-T p.Leu386Leu synonymous ANKRD17 1 83308 1.20036E-5 41654 0 NA
4-74019703-A-G p.Ser376Ser synonymous ANKRD17 1 83298 1.20051E-5 41649 0 1.64802E-5
4-74019727-A-G p.His368His synonymous ANKRD17 2 83284 2.40142E-5 41642 0 3.97985E-6
4-74019751-A-G p.Ile360Ile synonymous ANKRD17 53 83210 6.36943E-4 41605 0 0.00172018
4-74019763-G-A p.Ser356Ser synonymous ANKRD17 6 83144 7.2164E-5 41572 0 1.27665E-4
4-74019763-G-T p.Ser356Ser synonymous ANKRD17 4 83144 4.81093E-5 41572 0 3.99205E-6
4-74019784-A-G p.Val349Val synonymous ANKRD17 1 83070 1.2038E-5 41535 0 1.65063E-5
4-74019787-A-G p.Asp348Asp synonymous ANKRD17 9 83048 1.08371E-4 41524 0 7.62409E-5
4-74019808-A-G p.Ala341Ala synonymous ANKRD17 3 82698 3.62766E-5 41349 0 NA
4-74019808-A-T p.Ala341Ala synonymous ANKRD17 1 82698 1.20922E-5 41349 0 NA
4-74021341-G-A c.1000+7C>T splice_region ANKRD17 1 83214 1.20172E-5 41607 0 3.98489E-6
4-74021399-C-T p.Val317Met missense ANKRD17 1 83276 1.20083E-5 41638 0 3.97836E-6
4-74021410-T-C p.His313Arg missense ANKRD17 1 83282 1.20074E-5 41641 0 8.25314E-6
4-74021418-A-G p.Asn310Asn synonymous ANKRD17 37 83276 4.44306E-4 41638 0 4.77677E-4
4-74021421-A-G p.Ala309Ala synonymous ANKRD17 1 83278 1.2008E-5 41639 0 5.03525E-4
4-74021438-G-A p.Pro304Ser missense ANKRD17 1 83268 1.20094E-5 41634 0 8.25505E-6
4-74021448-A-C p.Gly300Gly synonymous ANKRD17 1 83260 1.20106E-5 41630 0 3.97871E-6
4-74021483-T-C p.Met289Val missense ANKRD17 1 83234 1.20143E-5 41617 0 3.98368E-6
4-74021732-G-A c.852+4C>T splice_region ANKRD17 2 83288 2.40131E-5 41644 0 1.27486E-4
4-74021775-A-C p.Leu271Leu synonymous ANKRD17 2 83364 2.39912E-5 41682 0 6.36902E-5
4-74021777-G-A p.Leu271Phe missense ANKRD17 2 83364 2.39912E-5 41682 0 NA
4-74021778-G-A p.Leu270Leu synonymous ANKRD17 2 83362 2.39917E-5 41681 0 3.18593E-5
4-74021781-G-A p.Ser269Ser synonymous ANKRD17 1 83352 1.19973E-5 41676 0 8.30565E-6
4-74021782-C-G p.Ser269Thr missense ANKRD17 1 83350 1.19976E-5 41675 0 NA
4-74021787-C-T p.Gly267Gly synonymous ANKRD17 6 83354 7.19821E-5 41677 0 0.00151057
4-74021797-G-A p.Thr264Ile missense ANKRD17 1 83360 1.19962E-5 41680 0 NA
4-74021799-G-A p.His263His synonymous ANKRD17 1 83358 1.19964E-5 41679 0 1.1951E-5
4-74021805-A-AAAATTT p.Asn261delinsLysAsnPhe disruptive_inframe_insertion ANKRD17 1 83354 1.1997E-5 41677 0 NA
4-74021817-C-T p.Gly257Gly synonymous ANKRD17 1 83348 1.19979E-5 41674 0 NA
4-74021859-T-C p.Ser243Ser synonymous ANKRD17 4 83348 4.79916E-5 41674 0 2.5468E-4
4-74021873-C-A p.Ala239Ser missense ANKRD17 1 83322 1.20016E-5 41661 0 NA
4-74021883-G-GTTGTCCGA c.705-1_705insTCGGACAA splice_acceptor ANKRD17 3 83300 3.60144E-5 41650 1 NA
4-74021883-G-GTTGTCCGACTGCCCTGCATTTGCTGTGCTTTCAGCTCT c.705-1_705insAGAGCTGAAAGCACAGCAAATGCAGGGCAGTCGGACAA splice_acceptor ANKRD17 2 83300 2.40096E-5 41650 0 NA
4-74021888-T-G c.705-5A>C splice_region ANKRD17 170 83272 0.0020415 41636 0 0.00152837
4-74021890-C-A c.705-7G>T splice_region ANKRD17 8 83254 9.60915E-5 41627 0 9.3993E-5
4-74021890-C-T c.705-7G>A splice_region ANKRD17 5 83254 6.00572E-5 41627 0 3.41793E-5
4-74021891-G-A c.705-8C>T splice_region ANKRD17 3 83266 3.60291E-5 41633 0 9.55475E-5
4-74026901-G-A c.704+8C>T splice_region ANKRD17 1 83328 1.20008E-5 41664 0 NA
4-74026911-G-C p.Asp234Glu missense+splice_region ANKRD17 1 83368 1.1995E-5 41684 0 NA
4-74026913-C-T p.Asp234Asn missense ANKRD17 1 83370 1.19947E-5 41685 0 NA
4-74026914-C-T p.Ser233Ser synonymous ANKRD17 1 83372 1.19944E-5 41686 0 1.20412E-5
4-74026928-T-G p.Asn229His missense ANKRD17 4 83392 4.79662E-5 41696 0 4.78084E-5
4-74026952-G-A p.Arg221Cys missense ANKRD17 2 83408 2.39785E-5 41704 0 8.24063E-6
4-74026959-T-C p.Ala218Ala synonymous ANKRD17 1 83408 1.19893E-5 41704 0 8.2394E-6
4-74026962-A-C p.Ala217Ala synonymous ANKRD17 8 83408 9.59141E-5 41704 0 8.35143E-5
4-74026980-C-T p.Ala211Ala synonymous ANKRD17 1 83416 1.19881E-5 41708 0 6.36659E-5
4-74026998-T-C p.Thr205Thr synonymous ANKRD17 8 83412 9.59095E-5 41706 0 6.25E-4
4-74027013-T-C p.Val200Val synonymous ANKRD17 1 83418 1.19878E-5 41709 0 NA
4-74027036-T-C p.Lys193Glu missense ANKRD17 2 83406 2.39791E-5 41703 0 3.97719E-6
4-74027046-C-T p.Thr189Thr synonymous ANKRD17 1 83402 1.19901E-5 41701 0 NA
4-74027064-T-G p.Gly183Gly splice_region+synonymous ANKRD17 2 83386 2.39848E-5 41693 0 6.36943E-5
4-74027067-T-TGC c.548-3_548-2insGC splice_region ANKRD17 1 83378 1.19936E-5 41689 0 NA
4-74027073-A-G c.548-8T>C splice_region ANKRD17 1 83350 1.19976E-5 41675 0 1.19651E-5
4-74043089-G-GTACA c.547+7_547+8insTGTA splice_region ANKRD17 1 81608 1.22537E-5 40804 0 1.2113E-5
4-74043122-T-C p.Arg174Arg synonymous ANKRD17 2 82454 2.42559E-5 41227 0 NA
4-74043127-C-G p.Ala173Pro missense ANKRD17 1 82516 1.21189E-5 41258 0 NA
4-74043146-T-C p.Thr166Thr synonymous ANKRD17 9 82640 1.08906E-4 41320 0 5.18164E-5
4-74043176-T-C p.Ser156Ser synonymous ANKRD17 1 82706 1.2091E-5 41353 0 NA
4-74043178-A-G p.Ser156Pro missense ANKRD17 1 82706 1.2091E-5 41353 0 NA
4-74043205-G-A p.Leu147Leu synonymous ANKRD17 1 82650 1.20992E-5 41325 0 NA
4-74043208-T-C p.Met146Val missense ANKRD17 8 82642 9.68031E-5 41321 0 6.37389E-5
4-74043217-C-G p.Glu143Gln missense ANKRD17 1 82662 1.20975E-5 41331 0 NA
4-74043230-A-T p.Asp138Glu missense ANKRD17 1 82610 1.21051E-5 41305 0 NA
4-74043234-A-C p.Leu137Trp missense ANKRD17 1 82618 1.21039E-5 41309 0 NA
4-74043239-G-A p.Phe135Phe synonymous ANKRD17 2 82608 2.42107E-5 41304 0 8.32889E-6
4-74043248-C-T p.Val132Val splice_region+synonymous ANKRD17 1 82438 1.21303E-5 41219 0 4.01216E-6
4-74043254-TA-T c.394-5delT splice_region ANKRD17 1 82222 1.21622E-5 41111 0 NA
4-74043255-A-G c.394-5T>C splice_region ANKRD17 3 82302 3.64511E-5 41151 0 1.67971E-5
4-74088687-C-G c.54+4G>C splice_region ANKRD17 1 75428 1.32577E-5 37714 0 NA
4-74088699-T-C p.Ile16Val missense ANKRD17 1 75598 1.32279E-5 37799 0 7.44114E-6
4-74088708-G-C p.Leu13Val missense ANKRD17 1 75678 1.32139E-5 37839 0 8.05542E-5
4-74088715-T-A p.Ala10Ala synonymous ANKRD17 1 75732 1.32045E-5 37866 0 1.48688E-5
4-74088717-C-T p.Ala10Thr missense ANKRD17 2 75770 2.63957E-5 37885 0 NA
4-74088730-C-T p.Ala5Ala synonymous ANKRD17 5 75794 6.59683E-5 37897 0 1.59205E-4
4-74088735-T-C p.Thr4Ala missense ANKRD17 1 75830 1.31874E-5 37915 0 9.55414E-5
4-74088744-T-C p.Met1? start_lost ANKRD17 3 75794 3.9581E-5 37897 0 3.1839E-5
4-74088776-C-G c.-32G>C 5_prime_UTR_premature_start_codon_gain ANKRD17 1 75466 1.3251E-5 37733 0 NA
4-74123985-G-A c.393+8C>T splice_region ANKRD17 2 80222 2.49308E-5 40111 0 8.24212E-6
4-74124011-C-CTCG p.Asp124dup disruptive_inframe_insertion ANKRD17 3 80280 3.73692E-5 40140 0 2.00898E-5
4-74124011-CTCG-C p.Asp124del disruptive_inframe_deletion ANKRD17 1 80280 1.24564E-5 40140 0 NA
4-74124011-CTCGTCG-C p.Asp123_Asp124del disruptive_inframe_deletion ANKRD17 1 80280 1.24564E-5 40140 0 4.94356E-5
4-74124014-G-C p.Asp124Glu missense ANKRD17 15 80252 1.86911E-4 40126 0 1.32663E-4
4-74124019-C-T p.Asp123Asn missense ANKRD17 1 80244 1.2462E-5 40122 0 4.01555E-6
4-74124023-G-C p.Asp121Glu missense ANKRD17 1 80224 1.24651E-5 40112 0 NA
4-74124035-C-T p.Glu117Glu synonymous ANKRD17 2 80188 2.49414E-5 40094 0 NA
4-74124052-T-C p.Ser112Gly missense ANKRD17 2 79948 2.50163E-5 39974 0 NA
4-74124054-G-A p.Thr111Ile missense ANKRD17 39 79858 4.88367E-4 39929 0 9.88647E-4
4-74124055-T-TGCC p.Gly110dup conservative_inframe_insertion ANKRD17 1 79828 1.25269E-5 39914 0 4.43048E-5
4-74124055-T-TGCCGCCGCCGCC p.Gly107_Gly110dup conservative_inframe_insertion ANKRD17 1 79828 1.25269E-5 39914 0 NA
4-74124056-G-GCCGCCGCCGCCACCTCCGCCTCCA p.Gly103_Gly110dup disruptive_inframe_insertion ANKRD17 1 79766 1.25367E-5 39883 0 NA
4-74124056-GCCGCCGCCGCCACCTCCGCCTCCA-G p.Gly103_Gly110del disruptive_inframe_deletion ANKRD17 2 79766 2.50733E-5 39883 0 7.45959E-5
4-74124059-G-A p.Gly109Gly synonymous ANKRD17 3 79678 3.76515E-5 39839 0 8.28308E-6
4-74124059-GCCGCCGCCACCTCCGCCTCCA-G p.Gly103_Gly109del disruptive_inframe_deletion ANKRD17 2 79680 2.51004E-5 39840 0 1.65662E-5
4-74124059-G-GCCGCCGCCACCT p.Gly106_Gly109dup disruptive_inframe_insertion ANKRD17 3 79680 3.76506E-5 39840 0 NA
4-74124059-GCCGCCGCCACCT-G p.Gly106_Gly109del disruptive_inframe_deletion ANKRD17 1 79680 1.25502E-5 39840 0 NA
4-74124062-G-T p.Gly108Gly synonymous ANKRD17 2 79606 2.51237E-5 39803 0 5.8045E-5
4-74124064-C-A p.Gly108Cys missense ANKRD17 1 79612 1.25609E-5 39806 0 1.66132E-5
4-74124065-GCCACCTCCGCCT-G p.Gly104_Gly107del disruptive_inframe_deletion ANKRD17 1 79560 1.25691E-5 39780 0 8.32847E-6
4-74124065-GCCACCTCCGCCTCCACCGCCGCCT-G p.Gly100_Gly107del disruptive_inframe_deletion ANKRD17 4 79560 5.02765E-5 39780 0 4.99709E-5
4-74124071-TCCGCCTCCACCG-T p.Gly102_Gly105del disruptive_inframe_deletion ANKRD17 992 79522 0.0124745 39761 10 0.0134966
4-74124071-T-TCCGCCTCCACCG p.Gly102_Gly105dup disruptive_inframe_insertion ANKRD17 10 79530 1.25739E-4 39765 0 9.65313E-5
4-74124075-C-A p.Gly104Val missense ANKRD17 2 79526 2.5149E-5 39763 0 3.64762E-5
4-74124075-C-T p.Gly104Asp missense ANKRD17 1 79526 1.25745E-5 39763 0 NA
4-74124078-C-G p.Gly103Ala missense ANKRD17 1 79482 1.25815E-5 39741 0 NA
4-74124111-C-G p.Ser92Thr missense ANKRD17 2 79818 2.5057E-5 39909 0 5.98209E-5
4-74124113-G-GTCGCTGCTGCTT p.Glu87_Ser90dup disruptive_inframe_insertion ANKRD17 3 79828 3.75808E-5 39914 0 4.05134E-6
4-74124115-CGCT-C p.Ser90del conservative_inframe_deletion ANKRD17 1 79826 1.25272E-5 39913 0 NA
4-74124123-C-G p.Ser88Thr missense ANKRD17 1 79820 1.25282E-5 39910 0 NA
4-74124137-G-C p.Pro83Pro synonymous ANKRD17 1 79768 1.25364E-5 39884 0 NA
4-74124140-G-T p.Pro82Pro synonymous ANKRD17 2 79790 2.50658E-5 39895 0 3.19611E-5
4-74124141-G-A p.Pro82Leu missense ANKRD17 1 79772 1.25357E-5 39886 0 9.18476E-6
4-74124142-G-T p.Pro82Thr missense ANKRD17 1 79760 1.25376E-5 39880 0 6.39713E-5
4-74124144-C-G p.Arg81Pro missense ANKRD17 14 79722 1.7561E-4 39861 0 2.72951E-4
4-74124153-C-T p.Arg78Gln missense ANKRD17 2 79692 2.50966E-5 39846 0 NA
4-74124155-G-C p.Asn77Lys missense ANKRD17 1 79674 1.25511E-5 39837 0 NA
4-74124164-G-C p.Ala74Ala synonymous ANKRD17 5 79602 6.28125E-5 39801 0 6.25E-4
4-74124169-TGTG-T p.His72del conservative_inframe_deletion ANKRD17 2 79580 2.51319E-5 39790 0 6.39386E-5
4-74124169-T-C p.Lys73Glu missense ANKRD17 1 79580 1.2566E-5 39790 0 NA
4-74124172-G-A p.His72Tyr missense ANKRD17 3 79542 3.77159E-5 39771 0 1.26901E-5
4-74124190-GCTT-G p.Lys65del conservative_inframe_deletion ANKRD17 4 79218 5.04936E-5 39609 0 0.00104493
4-74124202-G-T p.Leu62Met missense ANKRD17 1 78900 1.26743E-5 39450 0 2.22252E-5
4-74124207-A-G p.Leu60Pro missense ANKRD17 1 78728 1.2702E-5 39364 0 9.57977E-5
4-74124219-C-T p.Arg56Gln missense ANKRD17 3 78202 3.83622E-5 39101 0 7.07414E-5
4-74124220-G-C p.Arg56Gly missense ANKRD17 2 78134 2.55971E-5 39067 0 6.09481E-6
4-74124232-G-A p.Arg52Cys missense ANKRD17 2 77600 2.57732E-5 38800 0 6.687E-6
4-74124235-G-A p.Pro51Ser missense ANKRD17 1 77506 1.29022E-5 38753 0 NA
4-74124246-G-A p.Ser47Leu missense ANKRD17 1 76584 1.30576E-5 38292 0 3.19489E-5
4-74124257-G-C p.Ser43Arg missense ANKRD17 4 75676 5.28569E-5 37838 0 3.19387E-5
4-74124258-C-T p.Ser43Asn missense ANKRD17 2 75628 2.64452E-5 37814 0 3.19489E-5
4-74124262-T-TGCCGCCAACGCC p.Gly41_Ser42insGlyValGlyGly conservative_inframe_insertion ANKRD17 1 75268 1.32859E-5 37634 0 1.08552E-5
4-74124263-G-T p.Gly41Gly synonymous ANKRD17 1 75084 1.33184E-5 37542 0 NA
4-74124266-G-A p.Gly40Gly synonymous ANKRD17 1 74798 1.33693E-5 37399 0 4.172E-5
4-74124273-C-G p.Gly38Ala missense ANKRD17 1 73660 1.35759E-5 36830 0 NA
4-74124284-C-G p.Glu34Asp missense ANKRD17 1 71032 1.40782E-5 35516 0 NA
4-74124293-C-T p.Ala31Ala synonymous ANKRD17 1 68098 1.46847E-5 34049 0 1.71045E-5
4-74124295-C-CG p.Ala31fs frameshift ANKRD17 1 67410 1.48346E-5 33705 0 1.84543E-5
4-74124296-G-T p.Pro30Pro synonymous ANKRD17 2 71728 2.78831E-5 35864 0 NA
4-74124296-G-A p.Pro30Pro synonymous ANKRD17 1 71728 1.39416E-5 35864 0 0.00215517
4-74124296-GGGGGGGCCCGCCACAGCCGCCACCGCC-G p.Ala22_Pro30del disruptive_inframe_deletion ANKRD17 3 71728 4.18247E-5 35864 0 1.56642E-5
4-74124300-G-A p.Pro29Leu missense ANKRD17 1 71118 1.40611E-5 35559 0 NA
4-74124303-C-G p.Gly28Ala missense ANKRD17 2 70484 2.83752E-5 35242 0 3.20945E-5
4-74124321-G-A p.Ala22Val missense ANKRD17 1 68634 1.457E-5 34317 0 3.19693E-5
4-74124330-C-G p.Ser19Thr missense ANKRD17 4 67250 5.94796E-5 33625 0 1.20986E-5
4-74124337-C-G p.Glu17Gln missense ANKRD17 1 67008 1.49236E-5 33504 0 NA
4-74124339-CCTT-C p.Glu15del disruptive_inframe_deletion ANKRD17 2 66880 2.99043E-5 33440 0 NA
4-74124345-G-A p.Ala14Val missense ANKRD17 1 65874 1.51805E-5 32937 0 NA
4-74124349-C-T p.Ala13Thr missense ANKRD17 2 65416 3.05736E-5 32708 0 NA
4-74124397-G-C c.-12C>G 5_prime_UTR_premature_start_codon_gain ANKRD17 1 57212 1.74789E-5 28606 0 NA
4-74124413-G-A c.-28C>T 5_prime_UTR_premature_start_codon_gain ANKRD17 5 52474 9.52853E-5 26237 0 5.45554E-5
4-74124447-T-A c.-62A>T 5_prime_UTR_premature_start_codon_gain ANKRD17 1 43564 2.29547E-5 21782 0 NA
4-74124469-C-G c.-84G>C 5_prime_UTR_premature_start_codon_gain ANKRD17 11 40126 2.74136E-4 20063 0 7.72947E-4
4-74124477-G-A c.-92C>T 5_prime_UTR_premature_start_codon_gain ANKRD17 63 38962 0.00161696 19481 0 0.00116445