Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
11-67056601-C-T c.-592C>T 5_prime_UTR_premature_start_codon_gain ANKRD13D 3 14 0.214286 7 0 0.0234313
11-67056793-C-T c.-400C>T 5_prime_UTR_premature_start_codon_gain ANKRD13D 1 6244 1.60154E-4 3122 0 4.07498E-5
11-67056819-A-G c.-374A>G 5_prime_UTR_premature_start_codon_gain ANKRD13D 1 16416 6.09162E-5 8208 0 NA
11-67056860-C-T c.-470C>T 5_prime_UTR_premature_start_codon_gain ANKRD13D 1 28432 3.51716E-5 14216 0 NA
11-67056941-C-T p.Pro4Ser missense ANKRD13D 1 48258 2.0722E-5 24129 0 NA
11-67056955-C-T p.Phe8Phe synonymous ANKRD13D 1 51460 1.94326E-5 25730 0 NA
11-67056957-C-G p.Pro9Arg missense ANKRD13D 1 51742 1.93267E-5 25871 0 NA
11-67056958-G-T p.Pro9Pro synonymous ANKRD13D 2 51278 3.90031E-5 25639 0 NA
11-67056973-C-T c.-357C>T 5_prime_UTR_premature_start_codon_gain ANKRD13D 1 52760 1.89538E-5 26380 0 NA
11-67056974-T-C p.Trp15Arg missense ANKRD13D 1 53002 1.88672E-5 26501 0 NA
11-67056977-G-A p.Ala16Thr missense ANKRD13D 1 53386 1.87315E-5 26693 0 NA
11-67057003-C-T c.-327C>T 5_prime_UTR_premature_start_codon_gain ANKRD13D 21 56916 3.68965E-4 28458 0 0.011006
11-67057004-G-A p.Ala25Thr missense ANKRD13D 1 56630 1.76585E-5 28315 0 NA
11-67057294-C-T c.-308-6C>T splice_region ANKRD13D 1 76146 1.31327E-5 38073 0 NA
11-67057300-G-A c.-308G>A splice_region ANKRD13D 1 76180 1.31268E-5 38090 0 3.19244E-5
11-67057349-C-T c.-259C>T 5_prime_UTR_premature_start_codon_gain ANKRD13D 1 77236 1.29473E-5 38618 0 NA
11-67057394-C-G c.-214C>G 5_prime_UTR_premature_start_codon_gain ANKRD13D 2 77332 2.58625E-5 38666 0 NA
11-67057399-C-T c.-209C>T 5_prime_UTR_premature_start_codon_gain ANKRD13D 4 77318 5.17344E-5 38659 0 NA
11-67057423-C-T c.-185C>T 5_prime_UTR_premature_start_codon_gain ANKRD13D 1 77376 1.29239E-5 38688 0 NA
11-67057443-C-T c.-172+7C>T splice_region ANKRD13D 2 78154 2.55905E-5 39077 0 NA
11-67057444-C-T c.-172+8C>T splice_region ANKRD13D 4 78178 5.11653E-5 39089 0 3.18674E-5
11-67057551-C-T c.-169C>T 5_prime_UTR_premature_start_codon_gain ANKRD13D 5 81172 6.15976E-5 40586 0 9.55414E-5
11-67057554-C-T p.Asp32Asp synonymous ANKRD13D 1 81178 1.23186E-5 40589 0 NA
11-67057569-C-G p.Asp37Glu missense ANKRD13D 1 81200 1.23153E-5 40600 0 NA
11-67057570-C-T p.Pro38Ser missense ANKRD13D 1 81208 1.23141E-5 40604 0 NA
11-67057571-C-T p.Pro38Leu missense ANKRD13D 1 81210 1.23138E-5 40605 0 0.00125
11-67057574-G-A p.Arg39His missense ANKRD13D 3 81204 3.6944E-5 40602 0 2.30601E-4
11-67057599-C-T c.-121C>T 5_prime_UTR_premature_start_codon_gain ANKRD13D 1895 81218 0.0233323 40609 251 0.0597868
11-67057620-G-A p.Glu54Glu synonymous ANKRD13D 2 81260 2.46124E-5 40630 0 5.71886E-5
11-67057630-G-A p.Val58Met missense ANKRD13D 2 81244 2.46172E-5 40622 0 2.80312E-5
11-67057646-A-G p.Asn63Ser missense ANKRD13D 1 81246 1.23083E-5 40623 0 NA
11-67057650-C-T p.Ala64Ala synonymous ANKRD13D 10 81252 1.23074E-4 40626 0 0.00200275
11-67057652-A-G p.Asn65Ser missense ANKRD13D 1 81246 1.23083E-5 40623 0 6.98178E-6
11-67057652-A-C p.Asn65Thr missense ANKRD13D 1 81246 1.23083E-5 40623 0 3.18552E-5
11-67057653-C-T c.-67C>T 5_prime_UTR_premature_start_codon_gain ANKRD13D 2 81230 2.46214E-5 40615 0 0.00164745
11-67057654-G-C p.Val66Leu missense ANKRD13D 1 81230 1.23107E-5 40615 0 6.25E-4
11-67057668-C-T p.Asn70Asn synonymous ANKRD13D 9 81222 1.10807E-4 40611 0 2.54842E-4
11-67057675-G-A p.Gly73Ser missense ANKRD13D 3 81230 3.69322E-5 40615 0 6.9163E-6
11-67057678-T-G p.Trp74Gly missense ANKRD13D 1 81216 1.23128E-5 40608 0 NA
11-67057690-G-T c.-36+6G>T splice_region ANKRD13D 2 81188 2.46342E-5 40594 0 6.84819E-6
11-67057711-C-T c.-117C>T 5_prime_UTR_premature_start_codon_gain ANKRD13D 2 81120 2.46548E-5 40560 0 9.55536E-5
11-67057780-C-A c.-48C>A 5_prime_UTR_premature_start_codon_gain ANKRD13D 1 81120 1.23274E-5 40560 0 6.43716E-6
11-67057806-A-G p.Ala80Ala synonymous ANKRD13D 2 81234 2.46202E-5 40617 0 NA
11-67057809-C-G p.Val81Val synonymous ANKRD13D 5 81254 6.15354E-5 40627 0 3.18492E-5
11-67057821-C-T p.Asp85Asp synonymous ANKRD13D 2 81308 2.45978E-5 40654 0 NA
11-67057824-C-T c.-4C>T 5_prime_UTR_premature_start_codon_gain ANKRD13D 1 81334 1.2295E-5 40667 0 3.18471E-5
11-67057825-G-A p.Glu87Lys missense ANKRD13D 1 81354 1.2292E-5 40677 0 6.36902E-5
11-67057849-T-C p.Tyr8His missense ANKRD13D 1 81464 1.22754E-5 40732 0 NA
11-67057852-C-T p.Arg9Trp missense ANKRD13D 1 81468 1.22748E-5 40734 0 9.43583E-6
11-67057871-C-T p.Thr15Met missense ANKRD13D 1 81556 1.22615E-5 40778 0 6.25E-4
11-67057872-G-A p.Thr15Thr synonymous ANKRD13D 3 81542 3.67909E-5 40771 0 6.37308E-5
11-67057872-G-T p.Thr15Thr synonymous ANKRD13D 1 81542 1.22636E-5 40771 0 5.23423E-5
11-67057884-G-A p.Ala19Ala synonymous ANKRD13D 8 81472 9.81932E-5 40736 0 7.19578E-4
11-67057887-C-T p.Gly20Gly synonymous ANKRD13D 6 81368 7.37391E-5 40684 0 4.77724E-6
11-67057892-C-T p.Pro22Leu missense ANKRD13D 1 81392 1.22862E-5 40696 0 2.70651E-5
11-67057893-G-A p.Pro22Pro synonymous ANKRD13D 2 81390 2.4573E-5 40695 0 1.0829E-4
11-67057912-C-A p.Arg29Ser missense ANKRD13D 1 81342 1.22938E-5 40671 0 5.0278E-6
11-67057912-C-G p.Arg29Gly missense ANKRD13D 1 81342 1.22938E-5 40671 0 3.18471E-5
11-67057913-G-A p.Arg29His missense ANKRD13D 3 81332 3.68858E-5 40666 0 1.02144E-5
11-67057915-C-G p.Gln30Glu missense+splice_region ANKRD13D 1 81338 1.22944E-5 40669 0 3.12207E-5
11-67057922-A-G c.90+5A>G splice_region ANKRD13D 1 81286 1.23022E-5 40643 0 1.07595E-5
11-67058063-C-T n.513C>T splice_region ANKRD13D 1 64380 1.55328E-5 32190 0 3.18593E-5
11-67058949-C-T p.Ala31Ala splice_region+synonymous ANKRD13D 5 82960 6.027E-5 41480 0 9.58405E-5
11-67058950-C-T p.Pro32Ser missense ANKRD13D 1 82966 1.20531E-5 41483 0 2.78762E-5
11-67058952-C-T p.Pro32Pro synonymous ANKRD13D 1 82974 1.2052E-5 41487 0 2.78747E-5
11-67058953-G-A p.Asp33Asn missense ANKRD13D 3 82972 3.61568E-5 41486 0 3.19673E-5
11-67058985-C-T p.Thr43Thr synonymous ANKRD13D 1 83038 1.20427E-5 41519 0 7.96045E-6
11-67058991-GGGTGAGTGGGGACCTCTGGGCTCCCAGGGATTTGGGGTGGGGCCTTTGGAAAGACCCCCAGTGACCCCTGTGCACCCTGCA-G c.136+1_137-1delGTGAGTGGGGACCTCTGGGCTCCCAGGGATTTGGGGTGGGGCCTTTGGAAAGACCCCCAGTGACCCCTGTGCACCCTGCAG splice_acceptor ANKRD13D 8 83068 9.63066E-5 41534 0 NA
11-67059083-T-C p.Val49Ala missense ANKRD13D 3 83180 3.60664E-5 41590 0 NA
11-67059095-G-T p.Cys53Phe missense ANKRD13D 1 83170 1.20236E-5 41585 0 NA
11-67059101-G-A p.Ser55Asn missense ANKRD13D 2 83166 2.40483E-5 41583 0 NA
11-67059102-C-T p.Ser55Ser synonymous ANKRD13D 5 83164 6.01222E-5 41582 0 8.25614E-6
11-67059103-G-A p.Asp56Asn missense ANKRD13D 1 83164 1.20244E-5 41582 0 3.98035E-6
11-67059106-G-A p.Val57Met missense ANKRD13D 1 83190 1.20207E-5 41595 0 3.18471E-5
11-67059108-G-A p.Val57Val synonymous ANKRD13D 2 83174 2.4046E-5 41587 0 0.0025
11-67059114-C-T p.Arg59Arg synonymous ANKRD13D 1 83166 1.20241E-5 41583 0 4.12861E-5
11-67059124-C-T p.Arg63Trp missense ANKRD13D 6 83176 7.21362E-5 41588 0 5.03525E-4
11-67059125-G-A p.Arg63Gln missense ANKRD13D 2 83180 2.40442E-5 41590 0 8.25859E-6
11-67059153-T-C p.Ser72Ser synonymous ANKRD13D 2 83122 2.4061E-5 41561 0 NA
11-67059165-C-T p.Phe76Phe synonymous ANKRD13D 1 83110 1.20322E-5 41555 0 2.48028E-5
11-67059166-G-A p.Glu77Lys missense ANKRD13D 23 83106 2.76755E-4 41553 0 2.48024E-4
11-67059185-G-A p.Arg83Gln missense ANKRD13D 2 82982 2.41016E-5 41491 0 8.28061E-5
11-67059190-C-T p.Arg85Trp missense ANKRD13D 1 82946 1.2056E-5 41473 0 3.18669E-5
11-67059191-G-A p.Arg85Gln missense ANKRD13D 2 82966 2.41063E-5 41483 0 5.03525E-4
11-67059202-A-G p.Ile89Val missense ANKRD13D 1 82926 1.20589E-5 41463 0 6.37064E-5
11-67059218-G-T c.280+1G>T splice_donor ANKRD13D 2 82830 2.41458E-5 41415 0 NA
11-67059456-C-T c.281-6C>T splice_region ANKRD13D 1 82114 1.21782E-5 41057 0 4.5864E-5
11-67059457-G-T c.281-5G>T splice_region ANKRD13D 1 82140 1.21743E-5 41070 0 5.51268E-5
11-67059457-G-A c.281-5G>A splice_region ANKRD13D 7 82142 8.52183E-5 41071 0 3.18573E-5
11-67059464-G-A p.Ala95Thr missense+splice_region ANKRD13D 1 82304 1.21501E-5 41152 0 9.0848E-6
11-67059478-G-A p.Val99Val synonymous ANKRD13D 1 82236 1.21601E-5 41118 0 NA
11-67059484-A-G p.Glu101Glu synonymous ANKRD13D 1 82364 1.21412E-5 41182 0 NA
11-67059486-T-C p.Val102Ala missense ANKRD13D 1 82374 1.21398E-5 41187 0 3.18654E-5
11-67059496-C-T p.Asp105Asp synonymous ANKRD13D 25 82462 3.0317E-4 41231 0 3.494E-4
11-67059498-G-A p.Arg106Gln missense ANKRD13D 2 82468 2.42518E-5 41234 0 1.22014E-5
11-67059499-G-T p.Arg106Arg synonymous ANKRD13D 1783 82454 0.0216242 41227 30 0.026461
11-67059502-G-A p.Gln107Gln synonymous ANKRD13D 36 82482 4.36459E-4 41241 1 7.76692E-5
11-67059517-G-A p.Glu112Glu synonymous ANKRD13D 3 82512 3.63583E-5 41256 0 1.10078E-4
11-67059522-T-C p.Leu114Pro missense ANKRD13D 2 82528 2.42342E-5 41264 0 3.18471E-5
11-67059526-G-T p.Gly115Gly synonymous ANKRD13D 1 82508 1.212E-5 41254 0 NA
11-67059530-A-C p.Thr117Pro missense ANKRD13D 3 82524 3.63531E-5 41262 0 2.8E-5
11-67059534-T-G p.Leu118Arg missense ANKRD13D 1 82570 1.21109E-5 41285 0 3.99438E-6
11-67059544-C-T p.Pro121Pro synonymous ANKRD13D 6 82562 7.26727E-5 41281 0 0.00125156
11-67059545-G-A p.Glu122Lys missense ANKRD13D 2 82562 2.42242E-5 41281 0 7.98301E-6
11-67059559-C-T p.Ala126Ala synonymous ANKRD13D 3 82652 3.62968E-5 41326 0 7.496E-5
11-67059574-C-T p.Ser131Ser synonymous ANKRD13D 4 82698 4.83688E-5 41349 0 2.49567E-5
11-67059580-G-A p.Glu133Glu synonymous ANKRD13D 50 82756 6.04186E-4 41378 0 4.45831E-4
11-67059582-A-C p.His134Pro missense ANKRD13D 1 82766 1.20823E-5 41383 0 NA
11-67059586-G-A p.Val135Val synonymous ANKRD13D 2 82776 2.41616E-5 41388 0 NA
11-67059591-G-C p.Ser137Thr missense ANKRD13D 4 82760 4.83325E-5 41380 0 2.78949E-5
11-67059598-C-T p.Leu139Leu synonymous ANKRD13D 1 82760 1.20831E-5 41380 0 2.39149E-5
11-67059608-A-G p.Ile143Val missense ANKRD13D 7 82746 8.45962E-5 41373 0 6.37105E-5
11-67059610-C-T p.Ile143Ile synonymous ANKRD13D 4 82734 4.83477E-5 41367 0 1.16953E-4
11-67059611-G-A p.Val144Ile missense ANKRD13D 23 82716 2.7806E-4 41358 0 6.37064E-4
11-67059615-C-G p.Ser145Cys missense ANKRD13D 1 82714 1.20899E-5 41357 0 NA
11-67059623-C-G p.Leu148Val missense ANKRD13D 2 82680 2.41896E-5 41340 0 NA
11-67059625-GGAC-G p.Asp149del conservative_inframe_deletion ANKRD13D 1 82644 1.21001E-5 41322 0 NA
11-67059633-G-A p.Arg151His missense ANKRD13D 1 82576 1.21101E-5 41288 0 NA
11-67059640-G-A p.Val153Val synonymous ANKRD13D 1 82448 1.21289E-5 41224 0 4.09705E-6
11-67059658-C-G c.470+7C>G splice_region ANKRD13D 1 81590 1.22564E-5 40795 0 NA
11-67066532-C-T p.Asn158Asn synonymous ANKRD13D 113 82186 0.00137493 41093 1 9.66449E-4
11-67066536-TGTG-T p.Gly161del conservative_inframe_deletion ANKRD13D 1 82106 1.21794E-5 41053 0 NA
11-67066554-C-T p.Arg166Trp missense ANKRD13D 1 81470 1.22745E-5 40735 0 NA
11-67066557-T-G p.Ser167Ala missense ANKRD13D 1 81340 1.22941E-5 40670 0 NA
11-67066564-AGAT-A p.Met170del conservative_inframe_deletion ANKRD13D 1 80892 1.23622E-5 40446 0 NA
11-67066580-C-T p.Ser174Ser synonymous ANKRD13D 3 78776 3.80827E-5 39388 0 8.26583E-6
11-67066581-G-A p.Gly175Ser missense ANKRD13D 1 78966 1.26637E-5 39483 0 1.65338E-5
11-67066586-C-T p.Tyr176Tyr synonymous ANKRD13D 1 76794 1.30219E-5 38397 0 NA
11-67066586-C-A p.Tyr176* stop_gained ANKRD13D 1 76794 1.30219E-5 38397 0 NA
11-67066587-G-A p.Glu177Lys missense ANKRD13D 2 77050 2.59572E-5 38525 0 6.40328E-5
11-67066590-G-A p.Ala178Thr missense ANKRD13D 1 76298 1.31065E-5 38149 0 NA
11-67066997-C-T c.538-4C>T splice_region ANKRD13D 1 80282 1.24561E-5 40141 0 NA
11-67067008-G-A p.Ser182Asn missense ANKRD13D 2 80496 2.4846E-5 40248 0 5.11457E-5
11-67067018-C-T p.Asn185Asn synonymous ANKRD13D 2 80690 2.47862E-5 40345 0 1.27535E-4
11-67067029-T-C p.Val189Ala missense ANKRD13D 1 80852 1.23683E-5 40426 0 NA
11-67067045-G-A p.Thr194Thr synonymous ANKRD13D 3 81004 3.70352E-5 40502 0 6.37714E-5
11-67067061-C-G p.Gln200Glu missense ANKRD13D 1 81128 1.23262E-5 40564 0 1.27877E-5
11-67067071-C-T p.Ser203Leu missense ANKRD13D 4 81178 4.92744E-5 40589 0 6.37877E-5
11-67067075-G-A p.Arg204Arg synonymous ANKRD13D 14 81192 1.72431E-4 40596 0 3.18756E-4
11-67067081-A-AGCG c.619_619+1insCGG splice_donor ANKRD13D 1 81248 1.2308E-5 40624 0 NA
11-67067082-G-C p.Ala207Pro missense+splice_region ANKRD13D 1 81252 1.23074E-5 40626 0 NA
11-67067084-T-G c.619+2T>G splice_donor ANKRD13D 1 81234 1.23101E-5 40617 0 NA
11-67067086-A-AG c.619+4_619+5insG splice_region ANKRD13D 1 81240 1.23092E-5 40620 0 NA
11-67067088-C-CTCCATT c.619+6_619+7insTCCATT splice_region ANKRD13D 1 81244 1.23086E-5 40622 0 NA
11-67067094-TGCG-T n.1731+3_1731+5delGCG splice_region ANKRD13D 1 81228 1.2311E-5 40614 0 NA
11-67067096-C-T n.1731+4C>T splice_region ANKRD13D 1 81208 1.23141E-5 40604 0 NA
11-67067097-G-GGGGAAGACTCCATTCCAGT n.1731+5_1731+6insGGGAAGACTCCATTCCAGT splice_region ANKRD13D 1 81192 1.23165E-5 40596 0 NA
11-67067290-C-T c.620-8C>T splice_region ANKRD13D 19 82158 2.31262E-4 41079 0 1.59418E-4
11-67067293-C-T c.620-5C>T splice_region ANKRD13D 7 82174 8.51851E-5 41087 0 3.18837E-5
11-67067294-G-A c.620-4G>A splice_region ANKRD13D 4 82184 4.86713E-5 41092 0 NA
11-67067298-C-T p.Ala207Val missense+splice_region ANKRD13D 1 82240 1.21595E-5 41120 0 3.2089E-5
11-67067299-G-A p.Ala207Ala splice_region+synonymous ANKRD13D 1 82274 1.21545E-5 41137 0 6.37714E-5
11-67067314-C-G p.Phe212Leu missense ANKRD13D 1 82490 1.21227E-5 41245 0 NA
11-67067334-C-T p.Ala219Val missense ANKRD13D 1 82384 1.21383E-5 41192 0 3.18959E-5
11-67067335-G-T p.Ala219Ala synonymous ANKRD13D 2 82372 2.42801E-5 41186 0 NA
11-67067343-A-G p.His222Arg missense ANKRD13D 11 82362 1.33557E-4 41181 0 1.59459E-4
11-67067349-C-G p.Ser224Cys missense ANKRD13D 1 82314 1.21486E-5 41157 0 9.14762E-6
11-67067350-C-T p.Ser224Ser synonymous ANKRD13D 2 82290 2.43043E-5 41145 0 NA
11-67067354-A-G p.Thr226Ala missense ANKRD13D 1 82136 1.21749E-5 41068 0 NA
11-67067354-AC-A p.Ala228fs frameshift ANKRD13D 1 82136 1.21749E-5 41068 0 5.07161E-6
11-67067356-C-T p.Thr226Thr synonymous ANKRD13D 1 82108 1.21791E-5 41054 0 9.56755E-5
11-67067357-G-A p.Gly227Arg missense+splice_region ANKRD13D 3 82102 3.65399E-5 41051 0 2.75123E-5
11-67067358-GGGTGAGCCGGGGCTGGGCCGAGACAGGGCTGGCGGGGGGCCGAGCCTGGGCGGGAGGGCACCCTCTGTCACCTTGATGGCTGAGTCCGCCCTGGGACCCACGCA-G p.Ala228fs frameshift ANKRD13D 6 82124 7.30602E-5 41062 0 NA
11-67067366-CGG-C c.681+8_681+9delGG splice_region ANKRD13D 1 81938 1.22043E-5 40969 0 NA
11-67067465-C-G p.Ala228Gly missense+splice_region ANKRD13D 1 81856 1.22166E-5 40928 0 8.51078E-6
11-67067466-C-T p.Ala228Ala splice_region+synonymous ANKRD13D 3 81936 3.66139E-5 40968 0 1.45416E-4
11-67067469-C-T p.Pro229Pro synonymous ANKRD13D 222 82064 0.00270521 41032 2 0.00619492
11-67067475-G-C p.Gln231His missense ANKRD13D 1 82302 1.21504E-5 41151 0 1.20683E-5
11-67067483-C-T p.Ala234Val missense ANKRD13D 1 82524 1.21177E-5 41262 0 NA
11-67067484-C-T p.Ala234Ala synonymous ANKRD13D 1 82562 1.21121E-5 41281 0 2.51378E-5
11-67067491-A-G p.Thr237Ala missense ANKRD13D 1 82722 1.20887E-5 41361 0 1.66872E-5
11-67067501-C-T p.Thr240Ile missense ANKRD13D 1 82872 1.20668E-5 41436 0 NA
11-67067505-C-T n.1118C>T splice_region ANKRD13D 1 82954 1.20549E-5 41477 0 3.98813E-6
11-67067510-C-T p.Ser243Phe missense ANKRD13D 2 83002 2.40958E-5 41501 0 6.62976E-5
11-67067514-T-C p.Pro244Pro synonymous ANKRD13D 1 83044 1.20418E-5 41522 0 NA
11-67067516-A-G p.Glu245Gly missense ANKRD13D 2 83060 2.4079E-5 41530 0 NA
11-67067517-G-A p.Glu245Glu synonymous ANKRD13D 7 83070 8.42663E-5 41535 0 6.37511E-5
11-67067526-C-T p.Phe248Phe synonymous ANKRD13D 3 83114 3.6095E-5 41557 0 9.56145E-5
11-67067534-A-G p.Asn251Ser missense ANKRD13D 1 83164 1.20244E-5 41582 0 1.65281E-5
11-67067534-A-C p.Asn251Thr missense ANKRD13D 2 83164 2.40489E-5 41582 0 1.19404E-5
11-67067552-G-A p.Arg257Gln missense ANKRD13D 2 83180 2.40442E-5 41590 0 1.59198E-5
11-67067553-G-A p.Arg257Arg synonymous ANKRD13D 4 83182 4.80873E-5 41591 0 5.78283E-5
11-67067558-T-C p.Ile259Thr missense ANKRD13D 1 83186 1.20213E-5 41593 0 NA
11-67067563-C-T p.Arg261Cys missense ANKRD13D 1 83160 1.2025E-5 41580 0 3.98016E-6
11-67067564-G-T p.Arg261Leu missense ANKRD13D 3 83166 3.60724E-5 41583 0 6.36933E-5
11-67067565-C-T p.Arg261Arg synonymous ANKRD13D 1 83170 1.20236E-5 41585 0 3.18817E-5
11-67067569-A-G p.Ile263Val missense ANKRD13D 11 83182 1.3224E-4 41591 0 1.59196E-5
11-67067601-T-A c.812+7T>A splice_region ANKRD13D 2 82956 2.41092E-5 41478 0 6.38447E-5
11-67067978-C-T n.470+8C>T splice_region ANKRD13D 11 2584 0.00425697 1292 0 0.00446059
11-67068274-G-T c.-164G>T 5_prime_UTR_premature_start_codon_gain ANKRD13D 3 55574 5.39821E-5 27787 0 NA
11-67068289-C-T c.-149C>T 5_prime_UTR_premature_start_codon_gain ANKRD13D 1 60924 1.64139E-5 30462 0 NA
11-67068296-A-T c.-142A>T 5_prime_UTR_premature_start_codon_gain ANKRD13D 1 64094 1.56021E-5 32047 0 NA
11-67068310-C-T c.-128C>T 5_prime_UTR_premature_start_codon_gain ANKRD13D 12 68530 1.75106E-4 34265 0 2.87155E-4
11-67068311-G-T c.-127G>T 5_prime_UTR_premature_start_codon_gain ANKRD13D 1 69352 1.44192E-5 34676 0 NA
11-67068388-C-T c.-50C>T 5_prime_UTR_premature_start_codon_gain ANKRD13D 3 80140 3.74345E-5 40070 0 6.25E-4
11-67068427-G-A c.-11G>A 5_prime_UTR_premature_start_codon_gain ANKRD13D 16 82128 1.94818E-4 41064 0 6.69131E-4
11-67068450-C-T p.Arg5Trp missense ANKRD13D 3 82480 3.63725E-5 41240 0 1.54613E-4
11-67068451-G-A p.Arg5Gln missense ANKRD13D 1 82514 1.21192E-5 41257 0 8.56003E-6
11-67068453-C-T c.813-8C>T splice_region ANKRD13D 2 82510 2.42395E-5 41255 0 8.01385E-6
11-67068462-T-A p.Phe272Ile missense+splice_region ANKRD13D 1 82492 1.21224E-5 41246 0 4.00138E-6
11-67068492-CACCCGCTCTCCCTGGGTGACCAGGTG-C p.Leu284fs frameshift ANKRD13D 1 82488 1.2123E-5 41244 0 NA
11-67068497-G-A p.Pro283Pro synonymous ANKRD13D 4 82464 4.8506E-5 41232 0 4.98645E-5
11-67068511-A-G p.Asp288Gly missense ANKRD13D 2 82486 2.42465E-5 41243 0 NA
11-67068518-G-A p.Val290Val synonymous ANKRD13D 1 82472 1.21253E-5 41236 0 NA
11-67068520-C-T p.Thr291Ile missense ANKRD13D 2 82484 2.42471E-5 41242 0 8.29064E-6
11-67068528-A-G p.Ile294Val missense ANKRD13D 4 82548 4.84567E-5 41274 0 8.2883E-6
11-67068530-C-T p.Ile294Ile synonymous ANKRD13D 193 82522 0.00233877 41261 0 0.00524282
11-67068536-A-C p.Leu296Leu synonymous ANKRD13D 1 82608 1.21054E-5 41304 0 1.27584E-4
11-67068542-C-T p.Ala298Ala synonymous ANKRD13D 2 82686 2.41879E-5 41343 0 6.37389E-5
11-67068551-C-T p.Asn301Asn synonymous ANKRD13D 5 82774 6.04054E-5 41387 0 6.37181E-5
11-67068553-C-T p.Ala302Val missense ANKRD13D 1 82790 1.20788E-5 41395 0 1.59297E-5
11-67068557-C-T p.His303His synonymous ANKRD13D 4 82838 4.8287E-5 41419 0 8.28089E-6
11-67068572-C-T p.Arg308Arg synonymous ANKRD13D 143 82928 0.00172439 41464 1 0.00396689
11-67068573-G-A p.Asp309Asn missense ANKRD13D 3 82938 3.61716E-5 41469 0 1.27437E-4
11-67068583-C-G p.Thr312Ser missense ANKRD13D 2 82966 2.41063E-5 41483 0 NA
11-67068588-C-T p.Arg314Cys missense ANKRD13D 3 82940 3.61707E-5 41470 0 8.29848E-6
11-67068602-C-T p.Gly318Gly synonymous ANKRD13D 22 82940 2.65252E-4 41470 1 6.25E-4
11-67068608-C-T p.Pro320Pro synonymous ANKRD13D 4 82936 4.823E-5 41468 0 1.99658E-5
11-67068764-T-A p.Phe328Ile missense ANKRD13D 1 82994 1.20491E-5 41497 0 NA
11-67068769-C-T p.His329His synonymous ANKRD13D 1 82976 1.20517E-5 41488 0 4.00933E-6
11-67068772-G-A p.Val330Val synonymous ANKRD13D 2 82972 2.41045E-5 41486 0 2.80184E-5
11-67068782-C-T p.Arg334Cys missense ANKRD13D 1 82962 1.20537E-5 41481 0 6.37064E-5
11-67068785-A-G p.Ile335Val missense ANKRD13D 2 82972 2.41045E-5 41486 0 3.33834E-5
11-67068787-C-T p.Ile335Ile synonymous ANKRD13D 5 82968 6.02642E-5 41484 0 2.79401E-5
11-67068788-A-G p.Thr336Ala missense ANKRD13D 3 82960 3.6162E-5 41480 0 NA
11-67068789-C-T p.Thr336Ile missense ANKRD13D 4 82978 4.82055E-5 41489 0 6.3678E-5
11-67068793-C-T p.Phe337Phe synonymous ANKRD13D 4 82978 4.82055E-5 41489 0 0.00100806
11-67068796-C-A p.Ser338Arg missense ANKRD13D 2 82978 2.41028E-5 41489 0 1.19726E-5
11-67068810-G-T p.Cys343Phe missense ANKRD13D 3 82944 3.6169E-5 41472 0 8.32487E-6
11-67068815-G-A p.Glu345Lys missense ANKRD13D 1 82900 1.20627E-5 41450 0 3.33106E-5
11-67068826-C-T p.Ser348Ser synonymous ANKRD13D 1 82838 1.20718E-5 41419 0 NA
11-67068829-C-T p.Ser349Ser synonymous ANKRD13D 3 82816 3.62249E-5 41408 1 NA
11-67068830-G-A p.Val350Met missense ANKRD13D 32 82818 3.86389E-4 41409 0 9.87387E-4
11-67068840-C-T p.Pro353Leu missense ANKRD13D 4 82762 4.83314E-5 41381 0 1.20213E-5
11-67068843-C-T p.Ala354Val missense ANKRD13D 3 82744 3.62564E-5 41372 0 6.37024E-5
11-67068856-T-C p.Ala358Ala synonymous ANKRD13D 1 82726 1.20881E-5 41363 0 NA
11-67068859-T-C p.Val359Val synonymous ANKRD13D 77646 82318 0.943245 41159 36736 0.968125
11-67068863-G-A p.Ala361Thr missense ANKRD13D 5 82664 6.04858E-5 41332 0 6.25E-4
11-67068865-A-G p.Ala361Ala synonymous ANKRD13D 2 82704 2.41826E-5 41352 0 0.00125
11-67068867-CAGGTACCCCAACGGGAGGAAGAGGGAGCCTGCACAGCTTTCTGGTCACCAAGCCCCGCGGGTTGAGCGTGGCCCCTCTGCCACCTGCCT-C p.Asn364fs frameshift ANKRD13D 8 82716 9.67165E-5 41358 0 NA
11-67068874-C-T c.1087+5C>T splice_region ANKRD13D 2 82714 2.41797E-5 41357 0 5.0388E-5
11-67068876-C-T c.1087+7C>T splice_region ANKRD13D 1 82720 1.2089E-5 41360 0 NA
11-67068971-C-T p.Pro367Leu missense ANKRD13D 2 82820 2.41488E-5 41410 0 3.18471E-5
11-67068972-G-A p.Pro367Pro synonymous ANKRD13D 1 82804 1.20767E-5 41402 0 6.25E-4
11-67068977-AGGT-A p.Val370del disruptive_inframe_deletion ANKRD13D 1 82802 1.2077E-5 41401 0 NA
11-67068987-C-T p.Pro372Pro synonymous ANKRD13D 3 82798 3.62328E-5 41399 0 0.00125
11-67068990-C-T p.Thr373Thr synonymous ANKRD13D 127 82782 0.00153415 41391 0 0.00168822
11-67068991-G-A p.Val374Met missense ANKRD13D 1 82786 1.20793E-5 41393 0 8.34962E-6
11-67069008-C-T p.Asn379Asn synonymous ANKRD13D 1 82732 1.20872E-5 41366 0 6.37024E-5
11-67069017-C-T p.Ser382Ser synonymous ANKRD13D 2 82634 2.42031E-5 41317 0 7.99099E-6
11-67069024-G-A p.Gly385Ser missense ANKRD13D 1 82654 1.20986E-5 41327 0 3.99527E-6
11-67069027-A-G p.Met386Val missense ANKRD13D 1 82624 1.2103E-5 41312 0 9.55536E-5
11-67069034-G-A p.Arg388His missense ANKRD13D 10 82464 1.21265E-4 41232 0 1.16032E-4
11-67069037-A-G p.Asn389Ser missense ANKRD13D 1 82432 1.21312E-5 41216 0 3.18431E-5
11-67069038-C-T p.Asn389Asn synonymous ANKRD13D 1 82426 1.21321E-5 41213 0 2.00059E-5
11-67069039-G-A p.Glu390Lys missense ANKRD13D 3 82490 3.6368E-5 41245 0 1.67496E-5
11-67069043-C-G p.Pro391Arg missense ANKRD13D 4 82520 4.84731E-5 41260 0 8.37703E-6
11-67069045-C-T p.Leu392Phe missense ANKRD13D 1 82506 1.21203E-5 41253 0 4.18943E-5
11-67069046-T-TC p.Arg393fs frameshift ANKRD13D 1 82478 1.21244E-5 41239 0 3.99949E-6
11-67069048-C-T p.Arg393Trp missense ANKRD13D 2 82468 2.42518E-5 41234 0 5.03525E-4
11-67069053-C-T p.Asp394Asp synonymous ANKRD13D 1 82370 1.21403E-5 41185 0 5.03804E-5
11-67069059-C-T p.Asp396Asp synonymous ANKRD13D 1 82332 1.21459E-5 41166 0 6.41252E-5
11-67069077-C-T p.Phe402Phe synonymous ANKRD13D 8 81954 9.76157E-5 40977 0 6.75778E-5
11-67069087-C-T p.Gln406* stop_gained ANKRD13D 1 82006 1.21942E-5 41003 0 NA
11-67069089-G-A p.Gln406Gln synonymous ANKRD13D 1 82018 1.21924E-5 41009 0 3.18451E-5
11-67069095-G-C p.Leu408Leu synonymous ANKRD13D 2 81872 2.44284E-5 40936 0 4.81781E-5
11-67069098-T-A p.Leu409Leu synonymous ANKRD13D 33 81770 4.03571E-4 40885 0 3.41374E-4
11-67069103-C-T p.Ala411Val missense ANKRD13D 1 81584 1.22573E-5 40792 0 3.1839E-5
11-67069104-G-A p.Ala411Ala synonymous ANKRD13D 1 81544 1.22633E-5 40772 0 3.62339E-5
11-67069115-C-T p.Ala415Val missense ANKRD13D 1 81042 1.23393E-5 40521 0 4.04285E-6
11-67069116-G-A p.Ala415Ala synonymous ANKRD13D 68 81032 8.39175E-4 40516 0 0.00504032
11-67069118-AGCAGGTGGGACTTGCCCAGGGGGTGGGCTCTGGCCTCTGCAGCCACACGGCAGAAGTGACAGCTGTGGGCTCTGGTGGCT-A p.Val418_Thr419del splice_acceptor ANKRD13D 8 80894 9.88949E-5 40447 0 NA
11-67069208-C-T p.Thr419Thr synonymous ANKRD13D 4 72528 5.51511E-5 36264 0 3.98303E-5
11-67069225-C-T p.Thr425Ile missense ANKRD13D 1 72158 1.38585E-5 36079 0 NA
11-67069233-C-T p.Arg428Trp missense ANKRD13D 2 71160 2.81057E-5 35580 0 1.25315E-5
11-67069234-G-A p.Arg428Gln missense ANKRD13D 1 71240 1.40371E-5 35620 0 3.40901E-5
11-67069235-G-A p.Arg428Arg synonymous ANKRD13D 1 71024 1.40797E-5 35512 0 1.15591E-5
11-67069238-C-T p.Pro429Pro synonymous ANKRD13D 10 70728 1.41387E-4 35364 0 2.33503E-4
11-67069239-G-A p.Gly430Ser missense ANKRD13D 4 70708 5.65707E-5 35354 0 3.18735E-5
11-67069243-C-G p.Ala431Gly missense ANKRD13D 19 70522 2.69419E-4 35261 0 0.003125
11-67069243-C-T p.Ala431Val missense ANKRD13D 1 70520 1.41804E-5 35260 0 1.19623E-5
11-67069245-C-T p.Arg432Cys missense ANKRD13D 3 70636 4.24713E-5 35318 0 0.0010142
11-67069275-G-A p.Glu442Lys missense ANKRD13D 1 71196 1.40457E-5 35598 0 4.75979E-5
11-67069276-A-C p.Glu442Ala missense ANKRD13D 1 71170 1.40509E-5 35585 0 NA
11-67069284-C-T p.Gln445* stop_gained ANKRD13D 1 70676 1.41491E-5 35338 0 NA
11-67069292-GC-TA p.GluArg447AspArg missense+splice_region ANKRD13D 1 69870 1.43123E-5 34935 0 NA
11-67069293-C-T p.Arg448Trp missense+splice_region ANKRD13D 1 69586 1.43707E-5 34793 0 2.15193E-5
11-67069294-G-A p.Arg448Gln missense+splice_region ANKRD13D 2 69414 2.88126E-5 34707 0 2.96915E-5
11-67069301-C-T c.1343+7C>T splice_region ANKRD13D 1 68888 1.45163E-5 34444 0 3.18776E-5
11-67069590-G-A p.Arg448Arg splice_region+synonymous ANKRD13D 2 78680 2.54194E-5 39340 0 1.07093E-5
11-67069608-G-C p.Leu454Leu synonymous ANKRD13D 13 79466 1.63592E-4 39733 0 3.50609E-4
11-67069625-C-A p.Pro460His missense ANKRD13D 1 79908 1.25144E-5 39954 0 0.00203252
11-67069653-A-G p.Thr469Thr synonymous ANKRD13D 1 80438 1.24319E-5 40219 0 NA
11-67069656-C-T p.Pro470Pro synonymous ANKRD13D 1 80598 1.24073E-5 40299 0 NA
11-67069657-C-G p.Pro471Ala missense ANKRD13D 1 80602 1.24066E-5 40301 0 4.96648E-5
11-67069659-A-T p.Pro471Pro synonymous ANKRD13D 1 80626 1.24029E-5 40313 0 NA
11-67069660-G-C p.Ala472Pro missense ANKRD13D 1 80622 1.24036E-5 40311 0 3.18695E-5
11-67069661-C-T p.Ala472Val missense ANKRD13D 12 80654 1.48784E-4 40327 1 7.75504E-4
11-67069666-G-A p.Gly474Ser missense ANKRD13D 1 80696 1.23922E-5 40348 0 3.18695E-5
11-67069670-C-T p.Pro475Leu missense ANKRD13D 2 80758 2.47653E-5 40379 0 NA
11-67069683-A-G p.Glu479Glu synonymous ANKRD13D 3 80862 3.71002E-5 40431 0 4.87981E-6
11-67069714-T-A p.Ser490Thr missense ANKRD13D 1 80672 1.23959E-5 40336 0 NA
11-67069716-A-C p.Ser490Ser synonymous ANKRD13D 1 80662 1.23974E-5 40331 0 6.39673E-5
11-67069717-C-T p.Arg491Trp missense ANKRD13D 3 80638 3.72033E-5 40319 0 3.23335E-5
11-67069723-C-G p.Gln493Glu missense ANKRD13D 1 80588 1.24088E-5 40294 0 NA
11-67069731-G-T p.Glu495Asp missense ANKRD13D 1 80544 1.24156E-5 40272 0 NA
11-67069731-G-C p.Glu495Asp missense ANKRD13D 2 80544 2.48311E-5 40272 0 NA
11-67069732-C-T p.Arg496Trp missense ANKRD13D 1 80508 1.24211E-5 40254 0 6.25782E-4
11-67069739-G-A p.Arg498Gln missense ANKRD13D 1 80386 1.244E-5 40193 0 3.73357E-5
11-67069743-C-T p.Arg499Arg synonymous ANKRD13D 7 80278 8.7197E-5 40139 0 6.37511E-5
11-67069744-G-T p.Gly500Trp missense ANKRD13D 8 80328 9.95917E-5 40164 0 0.0021346
11-67069744-G-C p.Gly500Arg missense ANKRD13D 28 80328 3.48571E-4 40164 0 5.09165E-4
11-67069744-G-A p.Gly500Arg missense ANKRD13D 4 80328 4.97958E-5 40164 0 5.03598E-5
11-67069749-G-C p.Gln501His missense ANKRD13D 1 80244 1.2462E-5 40122 0 6.37105E-5
11-67069764-C-T p.Asp506Asp synonymous ANKRD13D 2 79910 2.50282E-5 39955 0 NA
11-67069771-C-A p.Arg509Arg synonymous ANKRD13D 11 79696 1.38024E-4 39848 0 6.18497E-4
11-67069771-C-T p.Arg509Trp missense ANKRD13D 1 79696 1.25477E-5 39848 0 4.96968E-5
11-67069772-G-A p.Arg509Gln missense ANKRD13D 1 79706 1.25461E-5 39853 0 3.18532E-5
11-67069792-A-G p.Thr516Ala missense ANKRD13D 2 79078 2.52915E-5 39539 0 NA
11-67069950-G-C c.*147G>C splice_region ANKRD13D 2 46526 4.29867E-5 23263 0 3.18512E-5
11-67069951-C-A c.*148C>A splice_region ANKRD13D 1 46064 2.17089E-5 23032 0 8.07754E-4
11-67069953-G-T c.*150G>T splice_region ANKRD13D 1 44950 2.22469E-5 22475 0 NA
11-67069953-G-GC n.579dupC splice_region ANKRD13D 3 44950 6.67408E-5 22475 0 NA