Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
17-27920578-C-T c.-62C>T 5_prime_UTR_premature_start_codon_gain ANKRD13B 13 16118 8.06552E-4 8059 0 0.00108713
17-27920622-C-T c.-18C>T 5_prime_UTR_premature_start_codon_gain ANKRD13B 1 29486 3.39144E-5 14743 0 1.18624E-4
17-27920644-T-A p.Ile2Asn missense ANKRD13B 4 34382 1.1634E-4 17191 0 1.2143E-5
17-27920645-C-T p.Ile2Ile synonymous ANKRD13B 2 34754 5.75473E-5 17377 0 NA
17-27920646-C-T p.Pro3Ser missense ANKRD13B 1 34806 2.87307E-5 17403 0 NA
17-27920676-G-C p.Glu13Gln missense ANKRD13B 10 38468 2.59956E-4 19234 0 2.60552E-4
17-27920681-C-T p.Gly14Gly synonymous ANKRD13B 1 38802 2.57719E-5 19401 0 NA
17-27920683-A-G p.Lys15Arg missense ANKRD13B 1 38804 2.57705E-5 19402 0 NA
17-27920687-T-C p.Tyr16Tyr synonymous ANKRD13B 1 38938 2.56819E-5 19469 0 1.57828E-4
17-27920690-G-A p.Pro17Pro synonymous ANKRD13B 1 39298 2.54466E-5 19649 0 3.37838E-5
17-27920693-G-A p.Leu18Leu synonymous ANKRD13B 1 39522 2.53024E-5 19761 0 1.11532E-5
17-27920698-A-T p.Tyr20Phe missense ANKRD13B 1 39186 2.55193E-5 19593 0 NA
17-27920702-C-A p.Leu21Leu synonymous ANKRD13B 1 39374 2.53975E-5 19687 0 NA
17-27920705-G-A p.Val22Val synonymous ANKRD13B 6 39260 1.52827E-4 19630 0 1.67079E-4
17-27920711-C-T p.His24His synonymous ANKRD13B 4 39034 1.02475E-4 19517 0 NA
17-27920715-C-T p.Arg26Cys missense ANKRD13B 6 38974 1.53949E-4 19487 0 4.34434E-4
17-27920739-G-A p.Val34Ile missense ANKRD13B 2 37692 5.30617E-5 18846 0 8.30565E-5
17-27920741-C-T p.Val34Val synonymous ANKRD13B 1 37566 2.66198E-5 18783 0 NA
17-27920747-G-T p.Ala36Ala synonymous ANKRD13B 1 37168 2.69049E-5 18584 0 NA
17-27920749-G-A p.Gly37Asp missense ANKRD13B 1 37162 2.69092E-5 18581 0 NA
17-27920756-AGGAGCGCCTTC-A c.114+4_114+14delGGAGCGCCTTC splice_region ANKRD13B 1 36232 2.75999E-5 18116 0 NA
17-27920761-C-T c.114+8C>T splice_region ANKRD13B 4 35886 1.11464E-4 17943 0 1.33253E-4
17-27934752-T-C c.115-8T>C splice_region ANKRD13B 4 75020 5.33191E-5 37510 0 1.79604E-5
17-27934766-A-G p.Ile41Val missense ANKRD13B 6 76340 7.85958E-5 38170 0 4.26145E-6
17-27934777-G-A p.Leu44Leu synonymous ANKRD13B 1 77010 1.29853E-5 38505 0 NA
17-27934785-G-A p.Arg47His missense ANKRD13B 1 77430 1.29149E-5 38715 0 8.78966E-6
17-27934786-C-T p.Arg47Arg synonymous ANKRD13B 8 77484 1.03247E-4 38742 0 6.15157E-5
17-27934790-C-A p.Arg49Arg synonymous ANKRD13B 3 77924 3.8499E-5 38962 0 8.77901E-6
17-27934793-A-T p.Thr50Ser missense ANKRD13B 1 78158 1.27946E-5 39079 0 1.68677E-5
17-27934816-G-A p.Thr57Thr synonymous ANKRD13B 2 78952 2.53318E-5 39476 0 3.18735E-5
17-27934826-C-G p.Leu61Val missense ANKRD13B 1 79464 1.25843E-5 39732 0 5.86564E-5
17-27934829-G-C p.Glu62Gln missense ANKRD13B 1 79608 1.25616E-5 39804 0 1.74987E-5
17-27934839-G-A p.Arg65His missense ANKRD13B 1 80068 1.24894E-5 40034 0 3.18654E-5
17-27934851-C-T p.Ala69Val missense ANKRD13B 1 80490 1.24239E-5 40245 0 NA
17-27934852-G-A p.Ala69Ala synonymous ANKRD13B 27 80512 3.35354E-4 40256 0 0.0040282
17-27934855-C-T c.-187C>T 5_prime_UTR_premature_start_codon_gain ANKRD13B 511 80696 0.00633241 40348 8 0.0123677
17-27934855-C-A p.His70Gln missense ANKRD13B 1 80720 1.23885E-5 40360 0 NA
17-27934856-G-A p.Gly71Ser missense ANKRD13B 1 80780 1.23793E-5 40390 0 4.1776E-6
17-27934864-C-T c.-178C>T 5_prime_UTR_premature_start_codon_gain ANKRD13B 3 81256 3.69204E-5 40628 0 7.91179E-5
17-27934876-G-A p.Glu77Glu synonymous ANKRD13B 2 81532 2.45302E-5 40766 0 1.25299E-5
17-27934881-G-A p.Arg79His missense ANKRD13B 3 81544 3.679E-5 40772 0 6.25704E-5
17-27934885-C-T p.Ser80Ser synonymous ANKRD13B 4 81572 4.90364E-5 40786 0 2.10762E-5
17-27935000-C-G c.251-4C>G splice_region ANKRD13B 1 83022 1.2045E-5 41511 0 NA
17-27935001-C-T c.251-3C>T splice_region ANKRD13B 2 83022 2.409E-5 41511 0 NA
17-27935028-G-A p.Arg92Gln missense ANKRD13B 2 83050 2.40819E-5 41525 0 6.37511E-5
17-27935036-G-A p.Glu95Lys missense ANKRD13B 1 83074 1.20375E-5 41537 0 8.38265E-6
17-27935057-C-T p.Arg102Trp missense ANKRD13B 13 83014 1.566E-4 41507 0 1.59408E-4
17-27935059-G-A p.Arg102Arg synonymous ANKRD13B 1 83030 1.20438E-5 41515 0 NA
17-27935092-G-A p.Leu113Leu synonymous ANKRD13B 1 82914 1.20607E-5 41457 0 3.19081E-5
17-27935094-C-T p.Ala114Val missense ANKRD13B 1 82540 1.21153E-5 41270 0 1.74087E-5
17-27935095-G-A p.Ala114Ala synonymous ANKRD13B 3 82670 3.62889E-5 41335 0 8.08094E-6
17-27935098-C-T p.Gly115Gly synonymous ANKRD13B 1 82420 1.2133E-5 41210 0 NA
17-27935104-C-T c.-46C>T 5_prime_UTR_premature_start_codon_gain ANKRD13B 31 82564 3.75466E-4 41282 0 2.38733E-4
17-27935105-G-A p.Val118Met missense ANKRD13B 7 82414 8.4937E-5 41207 0 2.43485E-5
17-27935119-G-T p.Lys122Asn missense ANKRD13B 1 82558 1.21127E-5 41279 0 NA
17-27935124-G-A p.Arg124His missense ANKRD13B 1 82534 1.21162E-5 41267 0 3.18817E-5
17-27935136-C-T c.375+8C>T splice_region ANKRD13B 2 82868 2.41348E-5 41434 0 4.0068E-6
17-27935227-C-T c.-7C>T 5_prime_UTR_premature_start_codon_gain ANKRD13B 6 83208 7.21085E-5 41604 0 2.78569E-5
17-27935258-G-C p.Val141Leu missense+splice_region ANKRD13B 1 83078 1.20369E-5 41539 0 NA
17-27935264-C-T c.421+6C>T splice_region ANKRD13B 1 82988 1.20499E-5 41494 0 NA
17-27935265-G-A c.421+7G>A splice_region ANKRD13B 1 82988 1.20499E-5 41494 0 NA
17-27935884-A-G p.Lys146Arg missense ANKRD13B 1 83034 1.20433E-5 41517 0 NA
17-27935897-T-C p.Ser150Ser synonymous ANKRD13B 5 83034 6.02163E-5 41517 0 6.36943E-5
17-27935901-A-G p.Thr152Ala missense ANKRD13B 1 83030 1.20438E-5 41515 0 NA
17-27935902-C-A p.Thr152Asn missense ANKRD13B 4 83042 4.81684E-5 41521 0 5.03525E-4
17-27935921-C-T p.Ser158Ser synonymous ANKRD13B 6 83046 7.22491E-5 41523 0 0.00125
17-27935922-G-A p.Gly159Ser missense ANKRD13B 1 83046 1.20415E-5 41523 0 NA
17-27935931-C-G p.Leu162Val missense ANKRD13B 8 83044 9.63345E-5 41522 0 9.55962E-5
17-27935960-T-C p.Phe171Phe synonymous ANKRD13B 4 83046 4.81661E-5 41523 0 NA
17-27935966-C-T p.His173His synonymous ANKRD13B 1 83042 1.20421E-5 41521 0 NA
17-27935979-C-T p.Arg178* stop_gained ANKRD13B 1 83016 1.20459E-5 41508 0 NA
17-27936007-G-A p.Gly187Asp missense ANKRD13B 1 83016 1.20459E-5 41508 0 3.98578E-6
17-27936110-G-C p.Ser191Thr missense ANKRD13B 3 82694 3.62783E-5 41347 0 6.25E-4
17-27936112-G-A p.Ala192Thr missense ANKRD13B 1 82650 1.20992E-5 41325 0 3.18695E-5
17-27936115-G-A p.Val193Met missense ANKRD13B 1 82600 1.21065E-5 41300 0 6.70612E-5
17-27936116-T-G p.Val193Gly missense ANKRD13B 1 82612 1.21048E-5 41306 0 NA
17-27936120-C-G p.Val194Val synonymous ANKRD13B 1 82624 1.2103E-5 41312 0 NA
17-27936138-C-T p.Asp68Asp splice_region+synonymous ANKRD13B 232 82698 0.00280539 41349 2 0.0126008
17-27936139-C-T p.Arg201Cys missense ANKRD13B 1 82698 1.20922E-5 41349 0 3.18695E-5
17-27936143-G-A p.Arg202Gln missense ANKRD13B 2 82802 2.4154E-5 41401 0 3.34935E-5
17-27936153-C-T p.Tyr205Tyr synonymous ANKRD13B 2 82822 2.41482E-5 41411 0 2.00605E-5
17-27936179-A-T p.Gln214Leu missense ANKRD13B 2 82616 2.42084E-5 41308 0 NA
17-27936184-C-A p.Arg216Arg synonymous ANKRD13B 25 82542 3.02876E-4 41271 0 0.0015121
17-27936205-G-A p.Ala223Thr missense ANKRD13B 2 82400 2.42718E-5 41200 0 1.046E-4
17-27936211-C-T p.Pro225Ser missense ANKRD13B 1 82470 1.21256E-5 41235 0 NA
17-27936222-A-G p.Glu228Glu synonymous ANKRD13B 1 82542 1.2115E-5 41271 0 2.52156E-5
17-27936231-G-A p.Leu231Leu synonymous ANKRD13B 1 82586 1.21086E-5 41293 0 8.4035E-6
17-27936235-C-T p.Arg233Trp missense ANKRD13B 1 82556 1.2113E-5 41278 0 NA
17-27936236-G-A p.Arg233Gln missense ANKRD13B 1 82578 1.21098E-5 41289 0 4.00243E-6
17-27936243-C-T p.Thr235Thr synonymous ANKRD13B 11 82652 1.33088E-4 41326 0 2.86825E-4
17-27936244-G-A p.Ala236Thr missense ANKRD13B 4 82658 4.83922E-5 41329 0 NA
17-27936245-C-T p.Ala236Val missense ANKRD13B 1 82678 1.20951E-5 41339 0 3.18573E-5
17-27936246-G-A p.Ala236Ala synonymous ANKRD13B 3 82680 3.62845E-5 41340 0 8.41085E-6
17-27936249-C-T p.Pro237Pro synonymous ANKRD13B 1 82718 1.20893E-5 41359 0 1.68231E-5
17-27936250-G-A p.Val238Ile missense ANKRD13B 1 82704 1.20913E-5 41352 0 8.40845E-6
17-27936252-C-T p.Val238Val synonymous ANKRD13B 297 82702 0.00359121 41351 3 0.0092091
17-27936253-G-A p.Val239Ile missense ANKRD13B 11 82712 1.32992E-4 41356 0 6.72619E-5
17-27936258-C-G p.Thr240Thr synonymous ANKRD13B 1 82800 1.20773E-5 41400 0 8.40181E-6
17-27936272-C-A p.Thr245Asn missense ANKRD13B 1 82852 1.20697E-5 41426 0 NA
17-27936296-G-T c.755+3G>T splice_region ANKRD13B 29 82904 3.49802E-4 41452 0 2.86661E-4
17-27936373-G-A p.Arg252Arg splice_region+synonymous ANKRD13B 2 83000 2.40964E-5 41500 0 1.68464E-5
17-27936403-T-G p.Ser262Arg missense ANKRD13B 3 82812 3.62266E-5 41406 0 1.68483E-5
17-27936404-G-A p.Glu263Lys missense ANKRD13B 2 82818 2.41493E-5 41409 0 NA
17-27936411-C-T p.Thr265Met missense ANKRD13B 2 82730 2.4175E-5 41365 0 1.19684E-5
17-27936426-G-A p.Gly270Glu missense ANKRD13B 1 82380 1.21389E-5 41190 0 NA
17-27936427-G-A p.Gly270Gly synonymous ANKRD13B 2 82344 2.42884E-5 41172 0 NA
17-27937698-C-T c.823-5C>T splice_region ANKRD13B 1 82972 1.20523E-5 41486 0 3.18532E-5
17-27937699-C-A c.823-4C>A splice_region ANKRD13B 24 82984 2.89212E-4 41492 0 1.70812E-4
17-27937707-A-G p.Tyr276Cys missense ANKRD13B 1 83026 1.20444E-5 41513 0 NA
17-27937721-G-C p.Val281Leu missense ANKRD13B 1 83106 1.20328E-5 41553 0 NA
17-27937721-G-A p.Val281Met missense ANKRD13B 1 83106 1.20328E-5 41553 0 5.03525E-4
17-27937735-C-T p.Thr285Thr synonymous ANKRD13B 1 83144 1.20273E-5 41572 0 NA
17-27937742-C-T p.Arg288Trp missense ANKRD13B 1 83142 1.20276E-5 41571 0 1.66389E-5
17-27937744-G-T p.Arg288Arg synonymous ANKRD13B 2 83140 2.40558E-5 41570 0 NA
17-27937758-C-T p.Ser293Leu missense ANKRD13B 1 83140 1.20279E-5 41570 0 8.32709E-6
17-27937761-A-G p.Glu294Gly missense ANKRD13B 2 83140 2.40558E-5 41570 0 3.33122E-5
17-27937768-C-G p.His296Gln missense ANKRD13B 4 83110 4.8129E-5 41555 0 6.25E-4
17-27937771-G-A p.Lys297Lys synonymous ANKRD13B 146 83100 0.00175692 41550 2 0.00407591
17-27938619-C-T p.Ser309Ser synonymous ANKRD13B 1 82954 1.20549E-5 41477 0 NA
17-27938631-C-T p.Ile313Ile synonymous ANKRD13B 3 82922 3.61786E-5 41461 0 4.12793E-5
17-27938640-G-A p.Gln316Gln synonymous ANKRD13B 6 82874 7.23991E-5 41437 0 1.59226E-4
17-27938643-C-T p.His317His synonymous ANKRD13B 5 82840 6.03573E-5 41420 0 5.96834E-5
17-27938646-G-C p.Gly318Gly synonymous ANKRD13B 24 82834 2.89736E-4 41417 0 1.65123E-4
17-27938646-G-A p.Gly318Gly synonymous ANKRD13B 2 82834 2.41447E-5 41417 0 NA
17-27938649-C-T p.Gly319Gly synonymous ANKRD13B 1 82800 1.20773E-5 41400 0 7.95811E-6
17-27938652-C-T p.Pro320Pro synonymous ANKRD13B 1 82802 1.2077E-5 41401 0 NA
17-27938888-G-A c.970-6G>A splice_region ANKRD13B 1 83120 1.20308E-5 41560 0 4.13702E-6
17-27938922-CC-AA p.Ala333Glu missense ANKRD13B 1 83178 1.20224E-5 41589 0 NA
17-27938953-C-T p.Tyr343Tyr synonymous ANKRD13B 5 83214 6.0086E-5 41607 0 2.48423E-5
17-27938964-A-G p.Asn347Ser missense ANKRD13B 2 83204 2.40373E-5 41602 0 4.96598E-5
17-27938967-T-C p.Phe348Ser missense ANKRD13B 1 83202 1.20189E-5 41601 0 3.98092E-6
17-27938982-G-A p.Arg353His missense ANKRD13B 1 83194 1.20201E-5 41597 0 8.27883E-6
17-27938995-C-A p.Arg357Arg synonymous ANKRD13B 18 83146 2.16487E-4 41573 0 4.46172E-4
17-27939030-GC-G c.1100+7delC splice_region ANKRD13B 2 83046 2.4083E-5 41523 0 2.49709E-5
17-27939173-G-T p.Leu380Leu synonymous ANKRD13B 2 83024 2.40894E-5 41512 0 NA
17-27939179-G-A p.Leu382Leu synonymous ANKRD13B 1 83038 1.20427E-5 41519 0 3.97728E-5
17-27939182-T-C p.Cys383Cys synonymous ANKRD13B 2 83036 2.40859E-5 41518 0 2.47255E-5
17-27939216-G-A p.Val395Ile missense ANKRD13B 1 82898 1.2063E-5 41449 0 3.97725E-6
17-27939227-GC-G p.Leu399fs frameshift ANKRD13B 1 82772 1.20814E-5 41386 0 NA
17-27939244-G-A p.Arg404Gln missense ANKRD13B 2 82378 2.42783E-5 41189 0 3.97772E-6
17-27939258-C-G p.Leu409Val missense ANKRD13B 1 81914 1.22079E-5 40957 0 NA
17-27939261-C-T p.Arg410Cys missense ANKRD13B 2 81648 2.44954E-5 40824 0 3.97839E-6
17-27939299-C-T c.1258+8C>T splice_region ANKRD13B 1 78242 1.27809E-5 39121 0 4.13627E-5
17-27939427-G-C p.Pro422Pro synonymous ANKRD13B 64 64210 9.96729E-4 32105 0 0.00210406
17-27939433-C-A p.Phe424Leu missense ANKRD13B 1 64006 1.56235E-5 32003 0 NA
17-27939436-C-T p.His425His synonymous ANKRD13B 100 63786 0.00156774 31893 0 0.0025
17-27939449-C-T p.Arg430Cys missense ANKRD13B 1 62032 1.61207E-5 31016 0 NA
17-27939450-G-A p.Arg430His missense ANKRD13B 1 61962 1.61389E-5 30981 0 NA
17-27939497-G-C p.Val446Leu missense ANKRD13B 2 55264 3.61899E-5 27632 0 NA
17-27939507-G-GAAGAATACTTCAA p.Ser449fs frameshift ANKRD13B 1 53968 1.85295E-5 26984 0 NA
17-27939515-A-T p.Ser452Cys missense ANKRD13B 1 53640 1.86428E-5 26820 0 3.19326E-5
17-27939516-G-T p.Ser452Ile missense ANKRD13B 1 53298 1.87624E-5 26649 0 NA
17-27939517-C-T p.Ser452Ser synonymous ANKRD13B 1 52960 1.88822E-5 26480 0 2.63116E-5
17-27939522-C-T p.Thr454Met missense ANKRD13B 4 52332 7.64351E-5 26166 0 2.49917E-4
17-27939561-C-T p.Ser467Phe missense ANKRD13B 2 47250 4.2328E-5 23625 0 3.21812E-5
17-27939572-AGTGAGGCCCCCCGCGAGAACGCCTGCCCCTCGGCTCTCCCCGGGGTGGGTGGGAGGGGCGCGCCCGGCCGTGCCTGACCCAGCCCCCGCGCCCCCAG-A c.1411+1_1412-1delGTGAGGCCCCCCGCGAGAACGCCTGCCCCTCGGCTCTCCCCGGGGTGGGTGGGAGGGGCGCGCCCGGCCGTGCCTGACCCAGCCCCCGCGCCCCCAG splice_acceptor ANKRD13B 2 45608 4.3852E-5 22804 1 NA
17-27939578-GC-G c.1411+7delC splice_region ANKRD13B 1 44860 2.22916E-5 22430 0 NA
17-27939579-C-A c.1411+7C>A splice_region ANKRD13B 1 44716 2.23634E-5 22358 0 NA
17-27939663-C-A c.1412-7C>A splice_region ANKRD13B 1 52362 1.90978E-5 26181 0 NA
17-27939665-C-A c.1412-5C>A splice_region ANKRD13B 15 52924 2.83425E-4 26462 0 7.02741E-4
17-27939677-C-T p.Cys473Cys synonymous ANKRD13B 4 54364 7.35781E-5 27182 0 4.49802E-4
17-27939682-G-C p.Gly475Ala missense ANKRD13B 1 55536 1.80063E-5 27768 0 NA
17-27939687-G-C p.Glu477Gln missense ANKRD13B 1 56638 1.7656E-5 28319 0 3.1904E-5
17-27939710-G-A p.Glu484Glu synonymous ANKRD13B 2 61670 3.24307E-5 30835 0 5.07614E-4
17-27939716-G-C p.Pro486Pro synonymous ANKRD13B 2 63576 3.14584E-5 31788 0 NA
17-27939722-C-T p.Gly488Gly synonymous ANKRD13B 1 65986 1.51547E-5 32993 0 1.81145E-5
17-27939728-C-T p.Ser490Ser synonymous ANKRD13B 3 67538 4.44194E-5 33769 0 2.46202E-5
17-27939737-C-T p.Gly493Gly synonymous ANKRD13B 2 68194 2.93281E-5 34097 0 3.18715E-5
17-27939737-C-A p.Gly493Gly synonymous ANKRD13B 1 68194 1.4664E-5 34097 0 NA
17-27939751-C-G p.Ala498Gly missense ANKRD13B 1 70334 1.42179E-5 35167 0 1.11158E-5
17-27939752-G-A p.Ala498Ala synonymous ANKRD13B 1 70718 1.41407E-5 35359 0 NA
17-27939761-GGAC-G p.Asp506del conservative_inframe_deletion ANKRD13B 3 72684 4.12746E-5 36342 0 1.79027E-4
17-27939761-G-GGAC p.Asp506dup conservative_inframe_insertion ANKRD13B 1 72724 1.37506E-5 36362 0 6.31858E-5
17-27939764-C-T p.Asp502Asp synonymous ANKRD13B 1 72796 1.3737E-5 36398 0 NA
17-27939773-C-G p.Asp505Glu missense ANKRD13B 2 75374 2.65343E-5 37687 0 NA
17-27939788-C-T p.Phe510Phe synonymous ANKRD13B 2 77200 2.59067E-5 38600 0 NA
17-27939796-A-C p.Gln513Pro missense ANKRD13B 1 77762 1.28598E-5 38881 0 NA
17-27939812-G-A p.Glu518Glu synonymous ANKRD13B 1 78082 1.2807E-5 39041 0 NA
17-27939815-G-A p.Ala519Ala synonymous ANKRD13B 1 77934 1.28314E-5 38967 0 9.55621E-6
17-27939818-C-A p.Gly520Gly synonymous ANKRD13B 1 77812 1.28515E-5 38906 0 NA
17-27939819-A-G p.Ser521Gly missense ANKRD13B 2 77846 2.56918E-5 38923 0 NA
17-27939830-CCAGGTGCGTCTCCGCGGGCGCGCGGGGCCACGGGACTCCGCGCCGCCACGGCTAACGCCCACGCCTCCCCG-C p.Gln525del splice_donor ANKRD13B 2 78046 2.56259E-5 39023 1 NA
17-27939831-C-G p.Gln525Glu missense+splice_region ANKRD13B 1 78074 1.28084E-5 39037 0 9.64041E-6
17-27939839-T-TCTCCGCGGGCGCGCGGGGCCACGGGA c.1575+6_1575+7insCTCCGCGGGCGCGCGGGGCCACGGGA splice_region ANKRD13B 1 78054 1.28116E-5 39027 0 NA
17-27939897-C-A c.1576-8C>A splice_region ANKRD13B 2 78228 2.55663E-5 39114 0 3.19326E-5
17-27939927-C-A p.Thr533Asn missense ANKRD13B 1 78784 1.26929E-5 39392 0 1.84877E-5
17-27939931-C-T p.Asn534Asn synonymous ANKRD13B 1 78826 1.26862E-5 39413 0 3.43209E-5
17-27939942-G-A p.Gly538Asp missense ANKRD13B 2 78712 2.54091E-5 39356 0 NA
17-27939946-C-T p.Thr539Thr synonymous ANKRD13B 1 78702 1.27062E-5 39351 0 NA
17-27939990-C-T p.Pro114Leu missense ANKRD13B 1 77554 1.28942E-5 38777 0 NA
17-27939992-G-A p.Ala115Thr missense ANKRD13B 3 77472 3.87237E-5 38736 0 1.37889E-5
17-27939999-C-T p.Pro117Leu missense ANKRD13B 1 77190 1.2955E-5 38595 0 NA
17-27940000-G-T p.Pro117Pro synonymous ANKRD13B 3 77226 3.8847E-5 38613 0 NA
17-27940003-G-A p.Glu118Glu synonymous ANKRD13B 1 77160 1.29601E-5 38580 0 NA
17-27940011-T-C p.Leu121Pro missense ANKRD13B 1 76766 1.30266E-5 38383 0 NA
17-27940013-C-G p.Arg122Gly missense ANKRD13B 1 76658 1.3045E-5 38329 0 4.99127E-6
17-27940017-G-A p.Arg123Lys missense ANKRD13B 2 76530 2.61335E-5 38265 0 5.10204E-6
17-27940020-G-T p.Gly124Val missense ANKRD13B 5 76398 6.54467E-5 38199 0 1.56104E-5
17-27940030-C-A p.Leu127Leu synonymous ANKRD13B 1 75738 1.32034E-5 37869 0 NA
17-27940191-G-A c.*155G>A splice_region ANKRD13B 1 48990 2.04123E-5 24495 0 NA
17-27940366-C-T c.1653-6C>T splice_region ANKRD13B 1 42808 2.33601E-5 21404 0 3.19285E-5
17-27940368-C-A c.1653-4C>A splice_region ANKRD13B 1 42994 2.32591E-5 21497 0 NA
17-27940372-G-C p.Arg551Ser missense+splice_region ANKRD13B 1 43352 2.3067E-5 21676 0 NA
17-27940375-C-T p.Ser552Ser synonymous ANKRD13B 7 43224 1.61947E-4 21612 0 3.19203E-5
17-27940376-G-A p.Ala553Thr missense ANKRD13B 5 43414 1.1517E-4 21707 0 6.38447E-5
17-27940402-T-G p.Pro561Pro synonymous ANKRD13B 1 47784 2.09275E-5 23892 0 3.1904E-5
17-27940405-GCCC-G p.Pro564del disruptive_inframe_deletion ANKRD13B 1 47908 2.08733E-5 23954 0 NA
17-27940408-C-T p.Pro563Pro synonymous ANKRD13B 2 48972 4.08397E-5 24486 0 NA
17-27940422-C-G p.Pro568Arg missense ANKRD13B 1 51278 1.95015E-5 25639 0 NA
17-27940447-A-G p.Pro576Pro synonymous ANKRD13B 1 55312 1.80793E-5 27656 0 NA
17-27940448-G-C p.Gly577Arg missense ANKRD13B 1 55514 1.80135E-5 27757 0 8.23913E-6
17-27940457-G-A p.Gly580Ser missense ANKRD13B 2 56452 3.54283E-5 28226 0 3.18817E-5
17-27940465-G-A p.Val582Val synonymous ANKRD13B 2 57698 3.46632E-5 28849 0 NA
17-27940465-G-T p.Val582Val synonymous ANKRD13B 2 57698 3.46632E-5 28849 0 NA
17-27940469-C-T p.Arg584Trp missense ANKRD13B 1 57898 1.72718E-5 28949 0 NA
17-27940490-C-T p.Arg591Trp missense ANKRD13B 1 59700 1.67504E-5 29850 0 NA
17-27940498-G-A p.Ala593Ala synonymous ANKRD13B 2 60026 3.33189E-5 30013 0 6.37755E-5
17-27940510-G-C p.Ser597Ser synonymous ANKRD13B 3 60362 4.97001E-5 30181 0 1.276E-4
17-27940513-G-A p.Ala598Ala synonymous ANKRD13B 4 60404 6.62208E-5 30202 0 2.40381E-5
17-27940515-A-G p.Gln599Arg missense ANKRD13B 72 60520 0.00118969 30260 0 0.00768322
17-27940515-A-T p.Gln599Leu missense ANKRD13B 4 60522 6.60917E-5 30261 0 4.02214E-5
17-27940517-G-T p.Glu600* stop_gained ANKRD13B 1 60688 1.64777E-5 30344 0 NA
17-27940520-CAGG-C p.Glu603del conservative_inframe_deletion ANKRD13B 2 60400 3.31126E-5 30200 0 8.00038E-6
17-27940533-G-A p.Arg605Gln missense ANKRD13B 2 60264 3.31873E-5 30132 0 3.37986E-5
17-27940535-C-T p.Arg606Trp missense ANKRD13B 1 58774 1.70143E-5 29387 0 0.00125
17-27940536-G-A p.Arg606Gln missense ANKRD13B 1 58552 1.70788E-5 29276 0 8.53053E-6
17-27940540-C-T p.Arg607Arg synonymous ANKRD13B 1 58286 1.71568E-5 29143 0 NA
17-27940547-CAGG-C p.Glu614del conservative_inframe_deletion ANKRD13B 2 59374 3.36848E-5 29687 0 1.65523E-4
17-27940553-G-C p.Glu612Gln missense ANKRD13B 26 60128 4.32411E-4 30064 1 0.00118052
17-27940568-C-T p.Arg617Cys missense ANKRD13B 1 60292 1.65859E-5 30146 0 NA
17-27940568-C-G p.Arg617Gly missense ANKRD13B 1 60292 1.65859E-5 30146 0 NA
17-27940578-G-A p.Arg620Lys missense ANKRD13B 6 61138 9.81386E-5 30569 1 3.23785E-5
17-27940743-G-A c.*137+6G>A splice_region ANKRD13B 1 70544 1.41755E-5 35272 0 NA
17-27941253-A-ATT c.*138-10_*138-9dupTT splice_region ANKRD13B 413 44046 0.00937656 22023 10 0.00447131
17-27941253-A-AT c.*138-9dupT splice_region ANKRD13B 1392 42282 0.0329218 21141 60 0.109572
17-27941253-A-ATTT c.*138-11_*138-9dupTTT splice_region ANKRD13B 106 44256 0.00239516 22128 2 9.82704E-4
17-27941253-A-ATTTT c.*138-12_*138-9dupTTTT splice_region ANKRD13B 31 44290 6.99932E-4 22145 1 NA
17-27941253-A-ATTTTTT c.*138-14_*138-9dupTTTTTT splice_region ANKRD13B 5 44304 1.12857E-4 22152 0 NA
17-27941253-A-ATTTTT c.*138-13_*138-9dupTTTTT splice_region ANKRD13B 10 44304 2.25713E-4 22152 1 NA
17-27941253-A-ATTTTTTTTT c.*138-17_*138-9dupTTTTTTTTT splice_region ANKRD13B 1 44304 2.25713E-5 22152 0 NA
17-27941253-A-ATTTTTTT c.*138-15_*138-9dupTTTTTTT splice_region ANKRD13B 2 44304 4.51426E-5 22152 0 NA
17-27941273-G-T c.*138-8G>T splice_region ANKRD13B 2 42774 4.67574E-5 21387 0 0.0384138
17-27941275-G-T c.*138-6G>T splice_region ANKRD13B 11 43204 2.54606E-4 21602 0 0.00705322
17-27941276-A-T c.*138-5A>T splice_region ANKRD13B 5 43324 1.15409E-4 21662 0 0.00463238
17-27941777-G-A c.*1177G>A splice_region ANKRD13B 1 44774 2.23344E-5 22387 0 3.18573E-5