Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
12-133303721-G-A c.*107C>T splice_region ANKLE2 1 57838 1.72897E-5 28919 0 NA
12-133303833-G-A p.Leu938Leu synonymous ANKLE2 1 80082 1.24872E-5 40041 0 NA
12-133303836-C-T p.Ala937Thr missense ANKLE2 43 80048 5.37178E-4 40024 0 0.00206398
12-133303836-C-A p.Ala937Ser missense ANKLE2 1 80048 1.24925E-5 40024 0 NA
12-133303837-G-A p.Ala936Ala synonymous ANKLE2 81 80092 0.00101134 40046 0 0.00146497
12-133303838-G-A p.Ala936Val missense ANKLE2 1 80084 1.24869E-5 40042 0 0.0108136
12-133303841-A-C p.Leu935Arg missense ANKLE2 2 80186 2.4942E-5 40093 0 8.95095E-4
12-133303853-C-T p.Arg931His missense ANKLE2 4 80334 4.97921E-5 40167 0 0.0015448
12-133303854-G-A p.Arg931Cys missense ANKLE2 1 80364 1.24434E-5 40182 0 6.36943E-5
12-133303855-C-T p.Ala930Ala synonymous ANKLE2 4 80398 4.97525E-5 40199 0 3.18431E-5
12-133303856-G-A p.Ala930Val missense ANKLE2 5 80436 6.21612E-5 40218 0 0.00154321
12-133303865-C-T p.Arg927His missense ANKLE2 6 80618 7.44251E-5 40309 0 1.51012E-4
12-133303870-C-G p.Gln925His missense ANKLE2 3 80684 3.71821E-5 40342 0 NA
12-133303878-C-T p.Gly923Arg missense ANKLE2 1 80788 1.23781E-5 40394 0 1.15491E-5
12-133303879-G-A p.His922His synonymous ANKLE2 1 80794 1.23772E-5 40397 0 0.00204918
12-133303884-C-T p.Val921Met missense ANKLE2 18 80830 2.2269E-4 40415 0 0.00205128
12-133303895-C-T p.Arg917His missense ANKLE2 3 80850 3.71058E-5 40425 0 4.52571E-5
12-133303901-G-T p.Pro915His missense ANKLE2 1 80938 1.23551E-5 40469 0 5.91198E-6
12-133303911-G-C p.Leu912Val missense ANKLE2 1 81012 1.23439E-5 40506 0 NA
12-133303912-G-C p.Gly911Gly synonymous ANKLE2 2 80988 2.4695E-5 40494 0 4.47788E-5
12-133303923-C-T p.Ala908Thr missense ANKLE2 1 81056 1.23371E-5 40528 0 6.36902E-5
12-133303924-G-A p.Pro907Pro synonymous ANKLE2 2 81076 2.46682E-5 40538 0 4.42595E-5
12-133303931-CT-C p.Ser905fs frameshift ANKLE2 2 81120 2.46548E-5 40560 0 NA
12-133303941-C-T p.Val902Met missense ANKLE2 1 81168 1.23201E-5 40584 0 6.25E-4
12-133303942-G-A p.Ser901Ser synonymous ANKLE2 1 81148 1.23232E-5 40574 0 0.00102775
12-133303954-C-T p.Pro897Pro synonymous ANKLE2 5 81126 6.16325E-5 40563 0 8.93895E-5
12-133303955-G-A p.Pro897Leu missense ANKLE2 1 81068 1.23353E-5 40534 0 1.33547E-4
12-133303961-T-C p.Tyr895Cys missense ANKLE2 1 81044 1.2339E-5 40522 0 2.37696E-5
12-133303964-C-T p.Ser894Asn missense ANKLE2 20 81016 2.46865E-4 40508 0 6.68534E-4
12-133303971-G-T p.Pro892Thr missense ANKLE2 1 80876 1.23646E-5 40438 0 NA
12-133303973-C-G p.Gly891Ala missense ANKLE2 5294 80696 0.0656042 40348 203 0.0866548
12-133303983-C-T p.Asp888Asn missense ANKLE2 1 80620 1.24039E-5 40310 0 5.96139E-6
12-133303993-A-G p.Ser884Ser synonymous ANKLE2 1 80306 1.24524E-5 40153 0 NA
12-133304002-C-A p.Arg881Ser missense ANKLE2 1 80036 1.24944E-5 40018 0 4.45911E-5
12-133304015-G-A p.Ala877Val missense ANKLE2 2 79594 2.51275E-5 39797 0 0.0010352
12-133304016-C-T p.Ala877Thr missense ANKLE2 1 79532 1.25736E-5 39766 0 1.89475E-5
12-133304017-G-A p.Pro876Pro synonymous ANKLE2 4 79502 5.03132E-5 39751 0 0.0015528
12-133304029-A-G p.Ser872Ser splice_region+synonymous ANKLE2 1 79474 1.25827E-5 39737 0 4.81186E-5
12-133304031-T-TCTGTCTGTCCGAGGGTGAGTAGCACAGGACAGCACTCTTCCATCTGTGCACG c.2616-3_2616-2insCGTGCACAGATGGAAGAGTGCTGTCCTGTGCTACTCACCCTCGGACAGACAG splice_region ANKLE2 2 79462 2.51693E-5 39731 1 4.84121E-5
12-133304033-C-T c.2616-4G>A splice_region ANKLE2 2 79378 2.51959E-5 39689 0 6.47333E-5
12-133304034-G-A c.2616-5C>T splice_region ANKLE2 2 79394 2.51908E-5 39697 0 2.22873E-4
12-133304610-C-T c.2615+8G>A splice_region ANKLE2 1 81694 1.22408E-5 40847 0 NA
12-133304629-C-T p.Ser868Ser synonymous ANKLE2 7 81734 8.56437E-5 40867 0 1.91205E-4
12-133304630-G-C p.Ser868Trp missense ANKLE2 1 81770 1.22294E-5 40885 0 1.1129E-4
12-133304630-G-A p.Ser868Leu missense ANKLE2 1 81770 1.22294E-5 40885 0 3.18552E-5
12-133304634-G-T p.Pro867Thr missense ANKLE2 1 81824 1.22214E-5 40912 0 1.23161E-5
12-133304640-A-G p.Tyr865His missense ANKLE2 47 81898 5.73885E-4 40949 0 3.512E-4
12-133304650-A-G p.Ala861Ala synonymous ANKLE2 1 81966 1.22002E-5 40983 0 4.03031E-6
12-133304654-C-G p.Ser860Thr missense ANKLE2 1 82014 1.2193E-5 41007 0 1.9233E-4
12-133304657-T-C p.Lys859Arg missense ANKLE2 1 82032 1.21904E-5 41016 0 NA
12-133304670-C-T p.Val855Met missense ANKLE2 2 82220 2.4325E-5 41110 0 3.34538E-5
12-133304674-C-T p.Pro853Pro synonymous ANKLE2 2 82256 2.43143E-5 41128 0 4.02586E-5
12-133304678-A-G p.Phe852Ser missense ANKLE2 1 82282 1.21533E-5 41141 0 NA
12-133304684-T-C p.His850Arg missense ANKLE2 3 82384 3.64148E-5 41192 0 6.37389E-5
12-133304686-G-A p.Pro849Pro synonymous ANKLE2 1 82386 1.2138E-5 41193 0 8.36274E-6
12-133304689-G-A p.Asp848Asp synonymous ANKLE2 1 82388 1.21377E-5 41194 0 4.02424E-6
12-133304691-C-T p.Asp848Asn missense ANKLE2 1 82382 1.21386E-5 41191 0 3.18532E-5
12-133304694-C-T p.Val847Ile missense ANKLE2 13 82420 1.57729E-4 41210 0 0.00125
12-133304695-G-A p.Asp846Asp synonymous ANKLE2 1 82456 1.21277E-5 41228 0 8.36316E-6
12-133304703-A-G p.Cys844Arg missense ANKLE2 2 82538 2.42313E-5 41269 0 3.18451E-5
12-133304709-G-C p.Leu842Val missense ANKLE2 1 82570 1.21109E-5 41285 0 NA
12-133304712-C-T p.Ala841Thr missense ANKLE2 1 82582 1.21092E-5 41291 0 2.50996E-5
12-133304713-G-A p.Ala840Ala synonymous ANKLE2 4 82590 4.8432E-5 41295 0 6.25E-4
12-133304724-C-A p.Asp837Tyr missense ANKLE2 2 82658 2.41961E-5 41329 0 8.37142E-6
12-133304731-G-A p.Leu834Leu synonymous ANKLE2 28 82660 3.38737E-4 41330 0 6.05288E-4
12-133304740-T-A p.Pro831Pro synonymous ANKLE2 1 82634 1.21016E-5 41317 0 NA
12-133304745-C-T p.Glu830Lys missense ANKLE2 1 82564 1.21118E-5 41282 0 NA
12-133304752-A-AG c.2484-4_2484-3insC splice_region ANKLE2 11 82504 1.33327E-4 41252 0 1.27445E-4
12-133304757-G-T c.2484-8C>A splice_region ANKLE2 2 82434 2.42618E-5 41217 0 NA
12-133306254-CACA-C c.2483+8_2483+10delTGT splice_region ANKLE2 11 80898 1.35974E-4 40449 0 5.09474E-4
12-133306257-A-AGT c.2483+7_2483+8insAC splice_region ANKLE2 11 81284 1.35328E-4 40642 0 5.04818E-4
12-133306257-A-G c.2483+8T>C splice_region ANKLE2 2 81284 2.46051E-5 40642 0 NA
12-133306260-C-G c.2483+5G>C splice_region ANKLE2 2 81600 2.45098E-5 40800 0 8.796E-6
12-133306261-C-T c.2483+4G>A splice_region ANKLE2 1 81682 1.22426E-5 40841 0 1.75417E-5
12-133306266-C-T p.Gly828Arg missense+splice_region ANKLE2 1 81996 1.21957E-5 40998 0 NA
12-133306269-AAAGG-A p.Phe827fs frameshift ANKLE2 1 82194 1.21663E-5 41097 0 NA
12-133306272-G-C p.Leu826Val missense ANKLE2 1 82306 1.21498E-5 41153 0 4.05456E-6
12-133306279-C-G p.Arg823Arg synonymous ANKLE2 1 82530 1.21168E-5 41265 0 NA
12-133306280-C-T p.Arg823Gln missense ANKLE2 1 82566 1.21115E-5 41283 0 5.93975E-5
12-133306281-G-A p.Arg823Trp missense ANKLE2 7 82606 8.47396E-5 41303 0 0.0015121
12-133306282-C-T p.Arg822Arg synonymous ANKLE2 1 82628 1.21024E-5 41314 0 8.08113E-6
12-133306283-C-A p.Arg822Met missense ANKLE2 1 82660 1.20978E-5 41330 0 4.04083E-6
12-133306288-CG-C p.Pro820fs frameshift ANKLE2 1 82760 1.20831E-5 41380 0 3.30841E-5
12-133306288-C-T p.Pro820Pro synonymous ANKLE2 1 82760 1.20831E-5 41380 0 8.41439E-6
12-133306288-C-G p.Pro820Pro synonymous ANKLE2 1 82760 1.20831E-5 41380 0 NA
12-133306289-G-A p.Pro820Leu missense ANKLE2 2 82780 2.41604E-5 41390 0 0.00125
12-133306290-G-C p.Pro820Ala missense ANKLE2 10 82810 1.20758E-4 41405 0 1.53299E-4
12-133306294-C-A p.Arg818Ser missense ANKLE2 1 82854 1.20694E-5 41427 0 NA
12-133306295-C-G p.Arg818Thr missense ANKLE2 4 82866 4.82707E-5 41433 0 1.2097E-5
12-133306305-C-T p.Glu815Lys missense ANKLE2 3 82910 3.61838E-5 41455 0 5.86422E-5
12-133306317-C-T p.Glu811Lys missense ANKLE2 5 82946 6.02802E-5 41473 0 2.1761E-4
12-133306317-C-G p.Glu811Gln missense ANKLE2 2 82946 2.41121E-5 41473 0 6.4771E-5
12-133306318-G-A p.His810His synonymous ANKLE2 1 82944 1.20563E-5 41472 0 9.71691E-5
12-133306336-A-G p.Ser804Ser synonymous ANKLE2 1 82940 1.20569E-5 41470 0 8.36344E-6
12-133306337-C-T p.Ser804Asn missense ANKLE2 1 82960 1.2054E-5 41480 0 NA
12-133306340-A-G p.Leu803Ser missense ANKLE2 1 82990 1.20496E-5 41495 0 3.34532E-5
12-133306347-T-C p.Met801Val missense ANKLE2 1 83002 1.20479E-5 41501 0 NA
12-133306353-C-T p.Ala799Thr missense ANKLE2 1 82986 1.20502E-5 41493 0 4.18018E-5
12-133306354-G-A p.Ile798Ile synonymous ANKLE2 2 83006 2.40946E-5 41503 0 2.50836E-5
12-133306362-C-T p.Ala796Thr missense ANKLE2 2 83034 2.40865E-5 41517 0 NA
12-133306368-T-G p.Met794Leu missense ANKLE2 2 83072 2.40755E-5 41536 0 1.67082E-5
12-133306370-T-C p.Glu793Gly missense ANKLE2 1 83068 1.20383E-5 41534 0 NA
12-133306382-C-T p.Arg789Lys missense ANKLE2 5 83074 6.01873E-5 41537 0 9.61169E-5
12-133306386-T-C p.Arg788Gly missense ANKLE2 5 83066 6.01931E-5 41533 0 1.28066E-4
12-133306387-G-A p.His787His synonymous ANKLE2 1 83070 1.2038E-5 41535 0 NA
12-133306391-C-T p.Gly786Asp missense ANKLE2 2 83068 2.40767E-5 41534 0 8.34543E-6
12-133306392-C-A p.Gly786Cys missense ANKLE2 1 83080 1.20366E-5 41540 0 4.02114E-6
12-133306398-C-T p.Gly784Arg missense ANKLE2 2 83102 2.40668E-5 41551 0 1.60829E-5
12-133306401-G-C p.Leu783Val missense ANKLE2 1 83110 1.20322E-5 41555 0 1.6685E-5
12-133306404-G-A p.Gln782* stop_gained ANKLE2 1 83108 1.20325E-5 41554 0 5.628E-5
12-133306410-C-T p.Ala780Thr missense ANKLE2 4 83116 4.81255E-5 41558 0 6.02996E-5
12-133306411-G-A p.Pro779Pro synonymous ANKLE2 27 83120 3.24832E-4 41560 0 1.28049E-4
12-133306419-G-A p.Pro777Ser missense ANKLE2 1 83148 1.20267E-5 41574 0 NA
12-133306433-C-G p.Arg772Thr missense ANKLE2 1 83184 1.20215E-5 41592 0 NA
12-133306436-T-C p.Glu771Gly missense ANKLE2 1 83182 1.20218E-5 41591 0 NA
12-133306438-T-C p.Val770Val synonymous ANKLE2 1 83188 1.2021E-5 41594 0 NA
12-133306441-T-C p.Ala769Ala synonymous ANKLE2 4 83186 4.8085E-5 41593 0 4.01639E-6
12-133306442-GC-AT p.Ala769Ile missense ANKLE2 1 83186 1.20213E-5 41593 0 NA
12-133306478-T-C p.Lys757Arg missense ANKLE2 4 83204 4.80746E-5 41602 0 NA
12-133306503-A-G p.Ser749Pro missense ANKLE2 1 83180 1.20221E-5 41590 0 NA
12-133306512-G-A p.Arg746Cys missense ANKLE2 16 83170 1.92377E-4 41585 0 5.03525E-4
12-133306541-A-G p.Phe736Ser missense ANKLE2 1 83114 1.20317E-5 41557 0 NA
12-133306548-C-T p.Val734Ile missense ANKLE2 2 83134 2.40575E-5 41567 0 3.18756E-5
12-133306551-T-G p.Thr733Pro missense ANKLE2 4 83128 4.81186E-5 41564 0 NA
12-133306558-C-T p.Ser730Ser synonymous ANKLE2 100 83106 0.00120328 41553 0 8.28712E-4
12-133306559-G-A p.Ser730Leu missense ANKLE2 10 83112 1.2032E-4 41556 0 5.10074E-4
12-133306567-T-C p.Pro727Pro synonymous ANKLE2 1 83108 1.20325E-5 41554 0 8.03361E-6
12-133306584-C-T p.Glu722Lys missense ANKLE2 1 83092 1.20349E-5 41546 0 NA
12-133306588-AC-A p.Arg720fs frameshift ANKLE2 1 83074 1.20375E-5 41537 0 8.32778E-6
12-133306589-C-T p.Arg720His missense ANKLE2 28993 82804 0.35014 41402 5509 0.37
12-133306589-C-A p.Arg720Leu missense ANKLE2 1 83062 1.20392E-5 41531 0 8.32279E-6
12-133306590-G-A p.Arg720Cys missense ANKLE2 18 83056 2.16721E-4 41528 0 4.14885E-4
12-133306590-G-T p.Arg720Ser missense ANKLE2 1 83056 1.20401E-5 41528 0 NA
12-133306592-G-T p.Pro719His missense ANKLE2 3 83052 3.61219E-5 41526 0 8.32959E-6
12-133306593-G-T p.Pro719Thr missense ANKLE2 3 83040 3.61272E-5 41520 0 4.99783E-5
12-133306593-G-C p.Pro719Ala missense ANKLE2 10 83040 1.20424E-4 41520 0 1.59541E-4
12-133306593-G-A p.Pro719Ser missense ANKLE2 1 83040 1.20424E-5 41520 0 NA
12-133306602-G-T p.Pro716Thr missense ANKLE2 3 83054 3.61211E-5 41527 0 NA
12-133306607-T-C p.Lys714Arg missense ANKLE2 1 83044 1.20418E-5 41522 0 NA
12-133306612-C-A p.Ala712Ala synonymous ANKLE2 4 83008 4.81881E-5 41504 0 1.66775E-5
12-133306612-C-T p.Ala712Ala synonymous ANKLE2 1 83008 1.2047E-5 41504 0 3.1902E-5
12-133306648-C-A p.Gly700Gly synonymous ANKLE2 1 82830 1.20729E-5 41415 0 2.01134E-5
12-133306652-T-C p.Asn699Ser missense ANKLE2 1 82850 1.207E-5 41425 0 3.18837E-5
12-133306662-T-G p.Ser696Arg missense ANKLE2 1 82828 1.20732E-5 41414 0 4.02036E-6
12-133306663-G-A p.His695His synonymous ANKLE2 5 82810 6.03792E-5 41405 0 9.56267E-5
12-133306670-C-T p.Gly693Asp missense ANKLE2 4 82760 4.83325E-5 41380 0 NA
12-133306671-C-T p.Gly693Ser missense ANKLE2 2 82758 2.41668E-5 41379 0 6.37511E-5
12-133306674-C-G p.Gly692Arg missense ANKLE2 2 82736 2.41733E-5 41368 0 NA
12-133306675-C-T p.Pro691Pro synonymous ANKLE2 1 82744 1.20855E-5 41372 0 6.37552E-5
12-133306676-G-A p.Pro691Leu missense ANKLE2 99 82714 0.0011969 41357 0 8.12616E-4
12-133306681-G-A p.Ala689Ala synonymous ANKLE2 12 82622 1.4524E-4 41311 0 5.03525E-4
12-133306683-C-G p.Ala689Pro missense ANKLE2 1 82580 1.21095E-5 41290 0 8.37998E-6
12-133306684-G-A p.Ala688Ala synonymous ANKLE2 4 82574 4.84414E-5 41287 0 9.56389E-5
12-133306699-T-G p.Ala683Ala synonymous ANKLE2 1 82516 1.21189E-5 41258 0 NA
12-133306710-C-T p.Glu680Lys missense ANKLE2 5409 82442 0.0656098 41221 206 0.0666015
12-133306717-G-C p.Phe677Leu missense ANKLE2 2 82464 2.4253E-5 41232 0 8.40548E-6
12-133306721-G-A p.Ala676Val missense ANKLE2 4 82412 4.85366E-5 41206 0 NA
12-133306722-C-T p.Ala676Thr missense ANKLE2 4 82384 4.85531E-5 41192 0 1.61031E-5
12-133306723-G-A p.Ser675Ser synonymous ANKLE2 1 82352 1.2143E-5 41176 0 1.6839E-5
12-133306724-C-A p.Ser675Ile missense ANKLE2 1 82374 1.21398E-5 41187 0 NA
12-133306729-C-T p.Arg673Arg synonymous ANKLE2 3 82308 3.64485E-5 41154 0 1.20831E-5
12-133306731-T-C p.Arg673Gly missense ANKLE2 2 82328 2.42931E-5 41164 0 5.03525E-4
12-133306732-C-T p.Thr672Thr synonymous ANKLE2 1 82324 1.21471E-5 41162 0 3.18654E-5
12-133306732-C-G p.Thr672Thr synonymous ANKLE2 8 82324 9.7177E-5 41162 0 2.23058E-4
12-133306733-G-A p.Thr672Met missense ANKLE2 6 82316 7.28898E-5 41158 0 7.58777E-5
12-133306733-G-C p.Thr672Arg missense ANKLE2 2 82316 2.42966E-5 41158 0 NA
12-133306737-G-A p.His671Tyr missense ANKLE2 16 82276 1.94467E-4 41138 0 2.86716E-4
12-133306742-A-G p.Phe669Ser missense ANKLE2 1 82228 1.21613E-5 41114 0 3.18613E-5
12-133306749-C-T p.Gly667Ser missense ANKLE2 4 82120 4.87092E-5 41060 0 8.49935E-6
12-133306756-G-A p.Pro664Pro synonymous ANKLE2 4 81988 4.87876E-5 40994 0 6.37064E-5
12-133306756-G-C p.Pro664Pro synonymous ANKLE2 1 81988 1.21969E-5 40994 0 1.59266E-4
12-133306758-G-C p.Pro664Ala missense ANKLE2 1 81944 1.22035E-5 40972 0 NA
12-133306759-C-T p.Pro663Pro synonymous ANKLE2 2 81906 2.44182E-5 40953 0 4.26483E-5
12-133306759-C-A p.Pro663Pro synonymous ANKLE2 1 81906 1.22091E-5 40953 0 6.37186E-5
12-133306760-G-A p.Pro663Leu missense ANKLE2 7 81882 8.54889E-5 40941 0 5.12269E-5
12-133306761-G-C p.Pro663Ala missense ANKLE2 3 81864 3.66461E-5 40932 0 NA
12-133306762-G-A p.Ser662Ser synonymous ANKLE2 301 81822 0.00367872 40911 2 0.00684932
12-133306765-G-A p.Asn661Asn synonymous ANKLE2 1 81810 1.22234E-5 40905 0 NA
12-133306769-T-A p.Asn660Ile missense ANKLE2 14 81736 1.71283E-4 40868 0 2.22973E-4
12-133306779-CATTTTGCCG-C p.Arg654_Asn656del conservative_inframe_deletion ANKLE2 1 81518 1.22672E-5 40759 0 NA
12-133306780-A-G p.Asn656Asn synonymous ANKLE2 1374 81486 0.0168618 40743 52 0.031746
12-133306787-C-T p.Arg654Gln missense ANKLE2 123 81356 0.00151187 40678 0 0.00270752
12-133306788-G-A p.Arg654Trp missense ANKLE2 1 81368 1.22898E-5 40684 0 6.36983E-5
12-133306790-T-C p.Asn653Ser missense ANKLE2 3 81354 3.68759E-5 40677 0 1.77532E-5
12-133306798-T-TTCTTCCAAGCTCATGTCA p.Asp644_Glu649dup disruptive_inframe_insertion ANKLE2 1 81302 1.22998E-5 40651 0 NA
12-133306808-C-T p.Ser647Asn missense ANKLE2 1029 81194 0.0126734 40597 8 0.0215287
12-133306811-A-T p.Met1? start_lost ANKLE2 1 81214 1.23131E-5 40607 0 NA
12-133306813-GTCATCT-G p.Glu643_Asp644del disruptive_inframe_deletion ANKLE2 2 81188 2.46342E-5 40594 0 9.15617E-6
12-133306824-C-T p.Asp642Asn missense ANKLE2 2 81082 2.46664E-5 40541 0 NA
12-133306828-A-C p.Phe640Leu missense ANKLE2 1 81026 1.23417E-5 40513 0 NA
12-133306831-C-T p.Ala639Ala synonymous ANKLE2 1 80988 1.23475E-5 40494 0 6.25E-4
12-133306832-G-A p.Ala639Val missense ANKLE2 3 80942 3.70636E-5 40471 0 6.36983E-5
12-133306839-C-T p.Val637Met missense ANKLE2 2 80934 2.47115E-5 40467 0 9.522E-6
12-133306840-G-A c.-28C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 2 80890 2.47249E-5 40445 0 6.36902E-5
12-133306841-G-A p.Ser636Phe missense ANKLE2 1 80898 1.23612E-5 40449 0 1.90905E-5
12-133306844-A-G p.Ile635Thr missense ANKLE2 1 80874 1.23649E-5 40437 0 NA
12-133306850-T-C p.Asn633Ser missense ANKLE2 2 80740 2.47709E-5 40370 0 3.18471E-5
12-133306851-T-G p.Asn633His missense ANKLE2 1 80746 1.23845E-5 40373 0 3.18431E-5
12-133306857-C-CAGACGTGGTGGCTTTATCTCGGCAGGAGGCTTCCCGTTCTCCTGTTTCT c.1892-2_1892-1insAGAAACAGGAGAACGGGAAGCCTCCTGCCGAGATAAAGCCACCACGTCT splice_acceptor ANKLE2 2 80612 2.48102E-5 40306 0 2.91591E-5
12-133306858-T-TTCCCAGCACTCTA c.1892-3_1892-2insTAGAGTGCTGGGA splice_region ANKLE2 1 80610 1.24054E-5 40305 0 NA
12-133306860-T-TGGATCAC c.1892-5_1892-4insGTGATCC splice_region ANKLE2 1 80546 1.24153E-5 40273 0 NA
12-133306861-G-GGATCACGAGGTC c.1892-6_1892-5insGACCTCGTGATC splice_region ANKLE2 1 80556 1.24137E-5 40278 0 NA
12-133306894-G-A c.-82C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 3 79444 3.77624E-5 39722 0 1.18092E-5
12-133306906-C-T c.-94G>A 5_prime_UTR_premature_start_codon_gain ANKLE2 20 78126 2.55997E-4 39063 0 1.27616E-4
12-133306907-G-A c.-95C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 5 78012 6.40927E-5 39006 0 6.39141E-5
12-133306924-T-A c.-112A>T 5_prime_UTR_premature_start_codon_gain ANKLE2 1 73962 1.35205E-5 36981 0 NA
12-133307003-G-A c.-191C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 1 33144 3.01714E-5 16572 0 3.85713E-5
12-133307068-C-A c.-256G>T 5_prime_UTR_premature_start_codon_gain ANKLE2 1 30818 3.24486E-5 15409 0 NA
12-133307070-C-A c.-258G>T 5_prime_UTR_premature_start_codon_gain ANKLE2 1 30230 3.30797E-5 15115 0 NA
12-133307074-C-T c.-262G>A 5_prime_UTR_premature_start_codon_gain ANKLE2 4 27446 1.45741E-4 13723 0 NA
12-133307075-G-A c.-263C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 5 26682 1.87392E-4 13341 0 1.59368E-4
12-133307237-G-A c.-425C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 1 646 0.00154799 323 0 1.91217E-4
12-133307924-G-A c.-1112C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 2 162 0.0123457 81 0 0.00939311
12-133308172-G-A c.-1360C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 2 104 0.0192308 52 0 0.0305283
12-133308359-G-A c.-1547C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 2 1080 0.00185185 540 0 0.00114657
12-133308471-G-A c.-1659C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 1 1122 8.91266E-4 561 0 0.00522693
12-133308506-G-A c.-1694C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 1 1124 8.8968E-4 562 0 6.43915E-5
12-133308512-G-A c.-1700C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 1 1126 8.88099E-4 563 0 0.00242564
12-133308572-G-A c.-1760C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 2 1120 0.00178571 560 0 0.00558659
12-133308588-G-A c.-1776C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 3 1122 0.0026738 561 0 4.90368E-4
12-133308670-G-A c.-1858C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 1 1136 8.80282E-4 568 0 9.76372E-5
12-133310583-T-C n.1686A>G splice_region ANKLE2 1 52366 1.90964E-5 26183 0 6.39754E-5
12-133310603-C-G p.Ter649Serext*? stop_lost ANKLE2 5 52376 9.54636E-5 26188 0 2.24E-4
12-133310605-C-T p.Ser648Ser synonymous ANKLE2 2 52364 3.81942E-5 26182 0 1.09518E-4
12-133310606-G-A p.Ser648Leu missense ANKLE2 2 52370 3.81898E-5 26185 0 1.16843E-4
12-133310607-A-T p.Ser648Thr missense ANKLE2 2 52366 3.81927E-5 26183 1 NA
12-133310619-C-T p.Glu644Lys missense ANKLE2 1 52372 1.90942E-5 26186 0 0.00125
12-133310620-G-A p.Leu643Leu synonymous ANKLE2 3 52356 5.73E-5 26178 0 6.25E-4
12-133310638-A-G p.Arg637Arg synonymous ANKLE2 1 52338 1.91066E-5 26169 0 1.50211E-5
12-133310639-C-T p.Arg637His missense ANKLE2 1074 52190 0.0205787 26095 13 0.0325
12-133310640-G-A p.Arg637Cys missense ANKLE2 3 52322 5.73373E-5 26161 0 7.22126E-5
12-133310642-T-A p.His636Leu missense ANKLE2 1 52294 1.91227E-5 26147 0 0.00116499
12-133310648-C-T p.Arg634Gln missense ANKLE2 1 52184 1.9163E-5 26092 0 3.25457E-5
12-133310649-G-T p.Arg634Arg synonymous ANKLE2 1 51602 1.93791E-5 25801 0 8.1078E-6
12-133310649-G-A p.Arg634Trp missense ANKLE2 1 51604 1.93783E-5 25802 0 6.52614E-5
12-133310651-A-G p.Met633Thr missense ANKLE2 1 52038 1.92167E-5 26019 0 NA
12-133310656-C-T p.Val631Val splice_region+synonymous ANKLE2 1 51884 1.92738E-5 25942 0 NA
12-133310659-TA-T c.1892-3delT splice_region ANKLE2 4816 40944 0.117624 20472 0 0.453671
12-133310659-T-TA c.1892-3_1892-2insT splice_region ANKLE2 103 50658 0.00203324 25329 0 0.0205328
12-133310659-TAA-T c.1892-4_1892-3delTT splice_region ANKLE2 118 50730 0.00232604 25365 0 0.0269444
12-133310659-T-A c.1892-2A>T splice_acceptor ANKLE2 6 51058 1.17513E-4 25529 0 NA
12-133310659-TAAA-T c.1892-5_1892-3delTTT splice_region ANKLE2 1 51050 1.95886E-5 25525 0 5.41477E-4
12-133310659-T-TAAA c.1892-3_1892-2insTTT splice_region ANKLE2 1 51080 1.95771E-5 25540 0 NA
12-133310659-T-TAA c.1892-3_1892-2insTT splice_region ANKLE2 7 51076 1.37051E-4 25538 0 3.68204E-4
12-133310664-A-C c.1892-7T>G splice_region ANKLE2 1 52336 1.91073E-5 26168 0 NA
12-133310975-C-T p.Thr629Thr synonymous ANKLE2 1 83168 1.20239E-5 41584 0 1.66409E-5
12-133310976-G-A p.Thr629Met missense ANKLE2 1 83190 1.20207E-5 41595 0 1.27421E-4
12-133310988-T-A p.Asp625Val missense ANKLE2 19 83278 2.28151E-4 41639 0 9.04399E-4
12-133310989-C-T p.Asp625Asn missense ANKLE2 2 83276 2.40165E-5 41638 0 NA
12-133311006-C-T p.Arg619Gln missense ANKLE2 4 83250 4.8048E-5 41625 0 1.60413E-5
12-133311014-T-C p.Thr616Thr synonymous ANKLE2 1 83278 1.2008E-5 41639 0 NA
12-133311022-G-T p.Gln614Lys missense ANKLE2 1 83320 1.20019E-5 41660 0 8.28116E-6
12-133311028-C-A p.Ala612Ser missense ANKLE2 1 83336 1.19996E-5 41668 0 4.00921E-6
12-133311029-C-T p.Lys611Lys synonymous ANKLE2 3 83344 3.59954E-5 41672 0 2.22987E-4
12-133311030-T-C p.Lys611Arg missense ANKLE2 6 83354 7.19821E-5 41677 0 5.03525E-4
12-133311035-G-A p.Gly609Gly synonymous ANKLE2 1 83350 1.19976E-5 41675 0 NA
12-133311047-C-T p.Gln605Gln synonymous ANKLE2 1 83376 1.19939E-5 41688 0 NA
12-133311049-G-C p.Gln605Glu missense ANKLE2 1 83380 1.19933E-5 41690 0 NA
12-133311055-G-A p.Leu603Phe missense ANKLE2 13 83392 1.5589E-4 41696 0 4.77859E-4
12-133311065-TA-T p.Leu599fs frameshift ANKLE2 1 83380 1.19933E-5 41690 0 8.01584E-6
12-133311067-G-A p.Leu599Leu synonymous ANKLE2 2 83376 2.39877E-5 41688 0 7.45243E-5
12-133311069-C-T p.Arg598Lys missense ANKLE2 1 83374 1.19941E-5 41687 0 NA
12-133311069-C-A p.Arg598Ile missense ANKLE2 1 83374 1.19941E-5 41687 0 1.2024E-5
12-133311070-T-G p.Arg598Arg synonymous ANKLE2 1 83372 1.19944E-5 41686 0 3.18756E-5
12-133311074-C-T p.Leu596Leu synonymous ANKLE2 2 83356 2.39935E-5 41678 0 4.00786E-6
12-133311082-C-T p.Glu594Lys missense ANKLE2 3 83346 3.59945E-5 41673 0 4.00821E-6
12-133311097-C-A p.Asp589Tyr missense ANKLE2 1 83320 1.20019E-5 41660 0 NA
12-133311118-C-A p.Glu582* stop_gained ANKLE2 1 83244 1.20129E-5 41622 0 NA
12-133311122-G-A c.-196C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 2 83212 2.4035E-5 41606 0 1.65736E-5
12-133311130-C-A p.Val578Phe missense ANKLE2 1 83148 1.20267E-5 41574 0 NA
12-133311135-G-T p.Pro576His missense ANKLE2 1 83076 1.20372E-5 41538 0 8.05867E-6
12-133311142-C-G p.Gly574Arg missense ANKLE2 1 82984 1.20505E-5 41492 0 NA
12-133311157-G-C p.Leu569Val missense ANKLE2 1 82672 1.2096E-5 41336 0 8.36064E-6
12-133311201-G-T c.-275C>A 5_prime_UTR_premature_start_codon_gain ANKLE2 1 81396 1.22856E-5 40698 0 NA
12-133311294-T-C c.-368A>G 5_prime_UTR_premature_start_codon_gain ANKLE2 2 68084 2.93755E-5 34042 0 NA
12-133311363-G-A c.-437C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 5 35794 1.39688E-4 17897 0 NA
12-133311469-G-A c.-543C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 2 7462 2.68025E-4 3731 0 9.55414E-5
12-133311687-T-C c.-761A>G 5_prime_UTR_premature_start_codon_gain ANKLE2 1 6460 1.54799E-4 3230 0 NA
12-133311994-T-C p.Gly566Gly splice_region+synonymous ANKLE2 3 83230 3.60447E-5 41615 0 NA
12-133311999-C-T p.Val565Met missense ANKLE2 2 83224 2.40315E-5 41612 0 NA
12-133312005-C-G p.Glu563Gln missense ANKLE2 1 83262 1.20103E-5 41631 0 NA
12-133312009-G-T p.Gly561Gly synonymous ANKLE2 68 83282 8.16503E-4 41641 0 0.00125
12-133312018-C-T p.Pro558Pro synonymous ANKLE2 1 83296 1.20054E-5 41648 0 6.25E-4
12-133312019-G-A p.Pro558Leu missense ANKLE2 2 83296 2.40108E-5 41648 0 8.28322E-6
12-133312020-G-A p.Pro558Ser missense ANKLE2 1 83300 1.20048E-5 41650 0 NA
12-133312024-C-T p.Ser556Ser synonymous ANKLE2 33 83312 3.96101E-4 41656 0 0.00352467
12-133312025-G-A p.Ser556Leu missense ANKLE2 14 83324 1.68019E-4 41662 1 0.00125
12-133312036-G-A p.His552His synonymous ANKLE2 5 83330 6.00024E-5 41665 0 5.03525E-4
12-133312047-A-C p.Phe549Val missense ANKLE2 13 83334 1.55999E-4 41667 0 6.25E-4
12-133312066-T-TG p.Pro543fs frameshift ANKLE2 1 83298 1.20051E-5 41649 0 1.60699E-5
12-133312067-G-A p.Pro542Leu missense ANKLE2 3 83290 3.60187E-5 41645 0 1.00363E-4
12-133312080-G-A p.Leu538Phe missense ANKLE2 4 83258 4.80434E-5 41629 0 0.00100705
12-133312084-G-A p.Arg536Arg synonymous ANKLE2 1 83232 1.20146E-5 41616 0 NA
12-133312085-C-T p.Arg536His missense ANKLE2 1 83204 1.20187E-5 41602 0 8.30772E-6
12-133312102-T-C c.1594-4A>G splice_region ANKLE2 3 83054 3.61211E-5 41527 0 1.6073E-4
12-133312104-A-C c.1594-6T>G splice_region ANKLE2 1 83024 1.20447E-5 41512 0 NA
12-133313472-A-T c.1593+7T>A splice_region ANKLE2 273 82854 0.00329495 41427 2 0.00758542
12-133313473-G-A c.1593+6C>T splice_region ANKLE2 1 82858 1.20688E-5 41429 0 1.74365E-5
12-133313491-C-G p.Leu527Leu synonymous ANKLE2 2 83010 2.40935E-5 41505 0 3.18695E-5
12-133313502-C-T p.Ala524Thr missense ANKLE2 2 83050 2.40819E-5 41525 0 3.18613E-5
12-133313503-G-A p.Phe523Phe synonymous ANKLE2 3 83060 3.61185E-5 41530 0 6.8612E-5
12-133313525-G-A p.Pro516Leu missense ANKLE2 8 83124 9.62418E-5 41562 0 1.27437E-4
12-133313531-C-T p.Arg514Lys missense ANKLE2 1 83118 1.20311E-5 41559 0 8.31228E-6
12-133313533-G-A p.Pro513Pro synonymous ANKLE2 2 83132 2.40581E-5 41566 0 NA
12-133313534-G-T p.Pro513His missense ANKLE2 4 83128 4.81186E-5 41564 0 1.82824E-4
12-133313537-C-T p.Ser512Asn missense ANKLE2 2 83116 2.40628E-5 41558 0 1.66193E-5
12-133313546-T-C p.Tyr509Cys missense ANKLE2 1 83134 1.20288E-5 41567 0 4.01139E-6
12-133313550-G-C p.Arg508Gly missense ANKLE2 2 83100 2.40674E-5 41550 0 6.64772E-5
12-133313550-G-A p.Arg508Cys missense ANKLE2 1 83100 1.20337E-5 41550 0 4.81406E-5
12-133313551-G-A p.Ser507Ser synonymous ANKLE2 2 83092 2.40697E-5 41546 0 2.49294E-5
12-133313556-C-T p.Val506Ile missense ANKLE2 73 83072 8.78756E-4 41536 0 6.25E-4
12-133313557-G-A p.His505His synonymous ANKLE2 1 83062 1.20392E-5 41531 0 3.32497E-5
12-133313561-G-A p.Ser504Phe missense ANKLE2 1 83086 1.20357E-5 41543 0 NA
12-133313562-A-G p.Ser504Pro missense ANKLE2 1 83080 1.20366E-5 41540 0 NA
12-133313573-G-A p.Thr500Met missense ANKLE2 5 83032 6.02177E-5 41516 0 0.0020141
12-133313579-T-C p.Asp498Gly missense ANKLE2 2 83048 2.40825E-5 41524 0 NA
12-133313596-C-T p.Gly492Gly synonymous ANKLE2 2 83024 2.40894E-5 41512 0 0.00151057
12-133313599-G-A p.Ile491Ile synonymous ANKLE2 1 83008 1.2047E-5 41504 0 2.51206E-5
12-133313607-GAGA-G p.Ser488del conservative_inframe_deletion ANKLE2 12 82950 1.44665E-4 41475 0 3.1059E-4
12-133313615-G-C p.Thr486Ser missense ANKLE2 1 82908 1.20616E-5 41454 0 NA
12-133313624-G-A p.Ala483Val missense ANKLE2 3 82778 3.62415E-5 41389 0 3.41408E-5
12-133313629-C-A p.Leu251Leu splice_region+synonymous ANKLE2 1 82744 1.20855E-5 41372 0 NA
12-133313641-G-A p.Tyr477Tyr synonymous ANKLE2 155 82498 0.00187883 41249 2 0.0125313
12-133313654-G-A c.1421-3C>T splice_region ANKLE2 4 82108 4.87163E-5 41054 0 6.36983E-5
12-133317997-C-T c.1420+8G>A splice_region ANKLE2 16 51374 3.11442E-4 25687 0 9.60885E-4
12-133318002-T-C c.1420+3A>G splice_region ANKLE2 1 83356 1.19967E-5 41678 0 3.18471E-5
12-133318005-C-A p.Gly474Cys missense+splice_region ANKLE2 3 83372 3.59833E-5 41686 0 1.60291E-5
12-133318007-T-C p.Lys473Arg missense+splice_region ANKLE2 13 83378 1.55916E-4 41689 0 1.73925E-4
12-133318009-T-C p.Leu472Leu synonymous ANKLE2 2 83374 2.39883E-5 41687 0 8.28185E-6
12-133318021-G-C p.Ile468Met missense ANKLE2 1 83380 1.19933E-5 41690 0 8.28144E-6
12-133318024-C-T p.Arg467Arg synonymous ANKLE2 1 83386 1.19924E-5 41693 0 NA
12-133318025-C-T p.Arg467Gln missense ANKLE2 26 83382 3.11818E-4 41691 1 9.93756E-5
12-133318056-T-C p.Ser457Gly missense ANKLE2 1 83368 1.1995E-5 41684 0 1.65629E-5
12-133318071-C-CAT c.1354-1_1354insAT splice_acceptor ANKLE2 1 83328 1.20008E-5 41664 0 NA
12-133318071-C-CATCTTCAGGTGTTTTATCATATTTATTCCTTGAGTTTTTTA c.1354-1_1354insTAAAAAACTCAAGGAATAAATATGATAAAACACCTGAAGAT splice_acceptor ANKLE2 1 83332 1.20002E-5 41666 0 NA
12-133318077-G-A c.1354-6C>T splice_region ANKLE2 1 83304 1.20042E-5 41652 0 4.01991E-6
12-133318079-A-G c.1354-8T>C splice_region ANKLE2 2 83296 2.40108E-5 41648 0 8.30096E-6
12-133318392-A-G c.42+3T>C splice_region ANKLE2 1 10088 9.91277E-5 5044 0 NA
12-133318406-G-T p.Pro11Thr missense ANKLE2 660 9202 0.0717235 4601 22 0.112156
12-133318419-T-TA p.Ser7fs frameshift ANKLE2 3 8916 3.36474E-4 4458 0 5.41367E-4
12-133318422-A-T p.Pro5Pro synonymous ANKLE2 1 8844 1.13071E-4 4422 0 0.00111317
12-133319737-T-C c.1353+3A>G splice_region ANKLE2 3 83246 3.60378E-5 41623 0 3.36576E-5
12-133319746-A-C p.Pro449Pro synonymous ANKLE2 3 83264 3.603E-5 41632 0 4.09283E-6
12-133319749-T-C p.Thr448Thr synonymous ANKLE2 691 83272 0.00829811 41636 17 0.0166498
12-133319753-T-C p.Lys447Arg missense ANKLE2 1 83280 1.20077E-5 41640 0 NA
12-133319768-CTTGAGTTTT-C p.Lys439_Ser441del disruptive_inframe_deletion ANKLE2 1 83308 1.20036E-5 41654 0 NA
12-133319789-T-C p.His435Arg missense ANKLE2 1 83304 1.20042E-5 41652 0 NA
12-133319797-C-T p.Ser432Ser synonymous ANKLE2 2 83292 2.40119E-5 41646 0 6.25E-4
12-133319798-G-A p.Ser432Leu missense ANKLE2 2 83302 2.4009E-5 41651 0 2.48785E-5
12-133319806-G-A c.-108C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 2 83308 2.40073E-5 41654 0 1.65782E-5
12-133319807-T-C p.Asn429Ser missense ANKLE2 1 83302 1.20045E-5 41651 0 NA
12-133319811-C-T p.Val428Ile missense ANKLE2 1 83304 1.20042E-5 41652 0 4.03161E-6
12-133319817-C-T p.Asp426Asn missense ANKLE2 458 83290 0.00549886 41645 12 0.0127348
12-133319824-T-C p.Gly423Gly synonymous ANKLE2 1 83312 1.20031E-5 41656 0 NA
12-133319825-C-G p.Gly423Ala missense ANKLE2 1 83312 1.20031E-5 41656 0 8.28803E-6
12-133319832-T-G p.Lys421Gln missense ANKLE2 1 83318 1.20022E-5 41659 0 NA
12-133319845-C-T p.Leu416Leu synonymous ANKLE2 2 83326 2.40021E-5 41663 0 NA
12-133319848-C-T p.Pro415Pro synonymous ANKLE2 3 83332 3.60006E-5 41666 0 9.5584E-5
12-133319858-T-C p.Tyr412Cys missense ANKLE2 2 83320 2.40038E-5 41660 0 1.22605E-5
12-133319863-C-CATCTTGTCGGGGGTGT c.1231-2_1231-1insACACCCCCGACAAGAT splice_acceptor ANKLE2 1 83314 1.20028E-5 41657 0 8.31172E-6
12-133319865-G-GA c.1231-4_1231-3insT splice_region ANKLE2 1 83264 1.201E-5 41632 0 NA
12-133324413-C-T c.1230+5G>A splice_region ANKLE2 3 82610 3.63152E-5 41305 0 1.91241E-4
12-133324414-G-A c.1230+4C>T splice_region ANKLE2 1 82604 1.2106E-5 41302 0 2.48694E-5
12-133324421-C-T p.Lys409Lys synonymous ANKLE2 1 82730 1.20875E-5 41365 0 3.03106E-5
12-133324427-G-A c.-174C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 1 82710 1.20904E-5 41355 0 3.31428E-5
12-133324430-G-A p.Thr406Thr synonymous ANKLE2 1 82742 1.20858E-5 41371 0 2.48517E-5
12-133324431-G-T p.Thr406Asn missense ANKLE2 2 82758 2.41668E-5 41379 0 4.1691E-6
12-133324433-G-A p.Asn405Asn synonymous ANKLE2 3 82718 3.62678E-5 41359 0 NA
12-133324439-G-A p.Tyr403Tyr synonymous ANKLE2 1 82802 1.2077E-5 41401 0 5.03525E-4
12-133324442-C-T p.Leu402Leu synonymous ANKLE2 1 82830 1.20729E-5 41415 0 NA
12-133324453-C-T p.Val399Met missense ANKLE2 8 82926 9.64716E-5 41463 0 6.37267E-5
12-133324458-C-T p.Arg397His missense ANKLE2 6 83008 7.22822E-5 41504 0 1.59317E-4
12-133324463-A-C p.Arg395Arg synonymous ANKLE2 4 83088 4.81417E-5 41544 0 3.23921E-5
12-133324464-C-T p.Arg395His missense ANKLE2 1 83086 1.20357E-5 41543 0 6.25E-4
12-133324481-CTCG-C p.Asp388del disruptive_inframe_deletion ANKLE2 1 83200 1.20192E-5 41600 0 NA
12-133324483-C-T p.Glu389Lys missense ANKLE2 7 83190 8.41447E-5 41595 0 2.89869E-4
12-133324484-G-A c.-231C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 3 83198 3.60586E-5 41599 0 1.65629E-5
12-133324490-A-T p.Asp386Glu missense ANKLE2 1 83236 1.2014E-5 41618 0 8.28157E-6
12-133324518-G-A p.Pro377Leu missense ANKLE2 8 83280 9.60615E-5 41640 0 9.5584E-5
12-133324519-G-C p.Pro377Ala missense ANKLE2 4 83278 4.80319E-5 41639 0 1.65642E-5
12-133324532-G-A c.-279C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 1 83274 1.20085E-5 41637 0 1.27399E-5
12-133324538-A-T p.Thr370Thr synonymous ANKLE2 1 83278 1.2008E-5 41639 0 6.37714E-5
12-133324565-C-T p.Glu361Glu synonymous ANKLE2 3 83250 3.6036E-5 41625 0 4.15234E-5
12-133324569-T-C p.Lys360Arg missense ANKLE2 1 83244 1.20129E-5 41622 0 4.31388E-6
12-133324573-C-A p.Ala359Ser missense ANKLE2 2 83232 2.40292E-5 41616 0 NA
12-133324576-C-T p.Ala358Thr missense ANKLE2 1 83220 1.20163E-5 41610 0 NA
12-133324588-C-A p.Val354Leu missense ANKLE2 9 83192 1.08183E-4 41596 0 6.25E-4
12-133324589-G-A c.-336C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 1397 83168 0.0167973 41584 15 0.0177206
12-133324591-T-C p.Asn353Asp missense ANKLE2 1 83168 1.20239E-5 41584 0 4.19526E-6
12-133324605-TCCTGAAAGAGAACCGCATGCTCTGAGCTTCCTATCTGATGTGTGGACACGCCCTGTGCGAGTGCTGCGATGGAACGGCCGGGACCGCACACCTGCCCGAGGGAACCGCCGAGACCTA-T p.Glu348fs frameshift ANKLE2 2 83108 2.40651E-5 41554 0 1.0915E-4
12-133324609-G-C c.-356C>G 5_prime_UTR_premature_start_codon_gain ANKLE2 1 83100 1.20337E-5 41550 0 NA
12-133324717-G-T c.1041+7C>A splice_region ANKLE2 1 82940 1.20569E-5 41470 0 NA
12-133324719-C-A c.1041+5G>T splice_region ANKLE2 5 82952 6.02758E-5 41476 0 1.37385E-4
12-133324729-C-T p.Val346Met missense ANKLE2 1 83054 1.20404E-5 41527 0 6.37471E-5
12-133324764-C-T p.Arg334Gln missense ANKLE2 1 83228 1.20152E-5 41614 0 1.69045E-5
12-133324765-G-C p.Arg334Gly missense ANKLE2 1 83234 1.20143E-5 41617 0 NA
12-133324765-G-A p.Arg334Trp missense ANKLE2 2 83234 2.40286E-5 41617 0 8.44752E-6
12-133324769-G-T p.Asn332Lys missense ANKLE2 1 83238 1.20137E-5 41619 0 NA
12-133324789-A-G p.Ser326Pro missense ANKLE2 1 83286 1.20068E-5 41643 0 NA
12-133324790-A-G p.Phe325Phe synonymous ANKLE2 1 83292 1.2006E-5 41646 0 NA
12-133324798-C-T p.Asp323Asn missense ANKLE2 1 83298 1.20051E-5 41649 0 NA
12-133324804-C-T p.Glu321Lys missense ANKLE2 3 83330 3.60014E-5 41665 0 NA
12-133324808-C-T p.Lys319Lys synonymous ANKLE2 4 83332 4.80008E-5 41666 0 NA
12-133324820-T-G p.Lys315Asn missense ANKLE2 2 83340 2.39981E-5 41670 0 8.30289E-6
12-133324826-A-T p.Leu313Leu synonymous ANKLE2 3 83350 3.59928E-5 41675 0 3.18492E-5
12-133324829-C-T p.Lys312Lys synonymous ANKLE2 1 83354 1.1997E-5 41677 0 NA
12-133324834-C-T p.Ala311Thr missense ANKLE2 1 83348 1.19979E-5 41674 0 1.65917E-5
12-133324835-G-A c.-133C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 5 83348 5.99894E-5 41674 0 4.14793E-5
12-133324844-C-T p.Gln307Gln synonymous ANKLE2 2 83348 2.39958E-5 41674 0 3.18431E-5
12-133324847-C-T p.Thr306Thr synonymous ANKLE2 6 83346 7.19891E-5 41673 0 9.12288E-5
12-133324848-G-A p.Thr306Met missense ANKLE2 2 83350 2.39952E-5 41675 0 3.18471E-5
12-133324851-C-T p.Arg305His missense ANKLE2 6 83346 7.19891E-5 41673 0 0.00125
12-133324852-G-A p.Arg305Cys missense ANKLE2 15 83352 1.7996E-4 41676 0 5.03525E-4
12-133324862-G-A p.Tyr301Tyr synonymous ANKLE2 1 83368 1.1995E-5 41684 0 6.37227E-5
12-133324867-T-C p.Ser300Gly missense ANKLE2 1 83364 1.19956E-5 41682 0 NA
12-133324871-C-T p.Ala298Ala synonymous ANKLE2 2 83368 2.399E-5 41684 0 NA
12-133324875-C-T p.Arg297Gln missense ANKLE2 4 83364 4.79823E-5 41682 0 8.29036E-6
12-133324879-C-G p.Glu296Gln missense ANKLE2 1 83362 1.19959E-5 41681 0 NA
12-133324881-T-G p.Lys295Thr missense ANKLE2 1 83362 1.19959E-5 41681 0 NA
12-133324889-T-C p.Thr292Thr synonymous ANKLE2 2 83334 2.39998E-5 41667 0 NA
12-133324901-C-T p.Ser288Ser synonymous ANKLE2 4 83298 4.80204E-5 41649 0 6.37024E-5
12-133324902-G-A p.Ser288Leu missense ANKLE2 54 83300 6.48259E-4 41650 0 0.001115
12-133324914-C-T p.Gly284Asp missense ANKLE2 1 83230 1.20149E-5 41615 0 NA
12-133324917-T-TCTTTCAAC c.848-1_848insGTTGAAAG splice_acceptor ANKLE2 1 83192 1.20204E-5 41596 0 NA
12-133324922-C-T c.848-5G>A splice_region ANKLE2 2 83164 2.40489E-5 41582 0 8.32445E-6
12-133327221-T-A c.847+8A>T splice_region ANKLE2 1 83242 1.20132E-5 41621 0 NA
12-133327224-T-C c.847+5A>G splice_region ANKLE2 2 83252 2.40234E-5 41626 0 8.29655E-6
12-133327232-T-C p.Lys282Glu missense ANKLE2 1 83310 1.20034E-5 41655 0 NA
12-133327246-C-G p.Ser277Thr missense ANKLE2 1 83336 1.19996E-5 41668 0 NA
12-133327270-G-T p.Pro269His missense ANKLE2 1 83374 1.19941E-5 41687 0 3.18492E-5
12-133327276-A-G p.Leu267Pro missense ANKLE2 1 83378 1.19936E-5 41689 0 NA
12-133327280-G-GT p.Pro266fs frameshift ANKLE2 2 83380 2.39866E-5 41690 0 9.55292E-5
12-133327283-A-C p.Leu265Val missense ANKLE2 8 83386 9.59394E-5 41693 0 3.20533E-5
12-133327288-G-A p.Thr263Met missense ANKLE2 1 83380 1.19933E-5 41690 0 1.20203E-5
12-133327299-A-G p.Ser259Ser synonymous ANKLE2 2 83382 2.3986E-5 41691 0 NA
12-133327302-A-C p.Pro258Pro synonymous ANKLE2 1 83382 1.1993E-5 41691 0 NA
12-133327305-G-A p.Phe257Phe synonymous ANKLE2 3 83382 3.5979E-5 41691 0 5.20892E-5
12-133327309-T-C p.Tyr256Cys missense ANKLE2 7 83386 8.39469E-5 41693 0 6.41103E-5
12-133327334-T-G p.Lys248Gln missense ANKLE2 1 83386 1.19924E-5 41693 0 1.60274E-5
12-133327340-C-T p.Ala246Thr missense ANKLE2 1 83388 1.19921E-5 41694 0 8.28089E-6
12-133327341-G-A p.Asp245Asp synonymous ANKLE2 1 83388 1.19921E-5 41694 0 2.48427E-5
12-133327350-G-A p.Thr242Thr synonymous ANKLE2 1 83386 1.19924E-5 41693 0 2.00353E-5
12-133327370-G-A p.Arg236* stop_gained ANKLE2 1 83378 1.19936E-5 41689 0 8.28199E-6
12-133327387-T-C p.Lys230Arg missense ANKLE2 1 83360 1.19962E-5 41680 0 NA
12-133327390-A-T p.Val229Asp missense ANKLE2 1 83352 1.19973E-5 41676 0 NA
12-133327391-C-G p.Val229Leu missense ANKLE2 1 83352 1.19973E-5 41676 0 3.18451E-5
12-133327398-C-T p.Leu226Leu synonymous ANKLE2 1 83332 1.20002E-5 41666 0 NA
12-133327402-G-T p.Ala225Glu missense ANKLE2 1 83322 1.20016E-5 41661 0 8.2861E-6
12-133327403-C-T p.Ala225Thr missense ANKLE2 2 83322 2.40033E-5 41661 0 4.00786E-6
12-133327407-C-T p.Lys223Lys synonymous ANKLE2 1 83282 1.20074E-5 41641 0 8.28858E-6
12-133327436-C-CA c.641-2_641-1insT splice_acceptor ANKLE2 2 82692 2.41861E-5 41346 1 2.5005E-5
12-133327439-G-A c.641-4C>T splice_region ANKLE2 1 82554 1.21133E-5 41277 0 NA
12-133327441-T-C c.-56A>G 5_prime_UTR_premature_start_codon_gain ANKLE2 1 82522 1.2118E-5 41261 0 NA
12-133327444-G-C c.-59C>G 5_prime_UTR_premature_start_codon_gain ANKLE2 1 82430 1.21315E-5 41215 0 9.55475E-5
12-133327526-C-T c.-141G>A 5_prime_UTR_premature_start_codon_gain ANKLE2 1 73840 1.35428E-5 36920 0 NA
12-133327598-T-C c.-213A>G 5_prime_UTR_premature_start_codon_gain ANKLE2 4 51832 7.71724E-5 25916 0 NA
12-133327600-G-C c.-215C>G 5_prime_UTR_premature_start_codon_gain ANKLE2 99 51356 0.00192772 25678 0 0.00299688
12-133327742-A-G c.-357T>C 5_prime_UTR_premature_start_codon_gain ANKLE2 1 4948 2.02102E-4 2474 0 NA
12-133331260-C-T c.640+1G>A splice_donor ANKLE2 1 82342 1.21445E-5 41171 0 4.14914E-6
12-133331268-C-G p.Ala211Ala synonymous ANKLE2 1 82380 1.21389E-5 41190 0 NA
12-133331269-G-A p.Ala211Val missense ANKLE2 5 82344 6.07209E-5 41172 0 1.91107E-4
12-133331274-G-A p.Val209Val synonymous ANKLE2 1 82462 1.21268E-5 41231 0 6.25782E-4
12-133331276-C-T p.Val209Ile missense ANKLE2 2 82464 2.4253E-5 41232 0 1.70019E-5
12-133331277-G-A p.Asp208Asp synonymous ANKLE2 1 82500 1.21212E-5 41250 0 8.47601E-6
12-133331283-A-G p.Tyr206Tyr synonymous ANKLE2 2 82680 2.41896E-5 41340 0 3.18512E-5
12-133331288-C-G p.Val205Leu missense ANKLE2 1 82766 1.20823E-5 41383 0 NA
12-133331290-G-A p.Pro204Leu missense ANKLE2 1 82810 1.20758E-5 41405 0 NA
12-133331311-G-C p.Pro197Arg missense ANKLE2 2 82986 2.41005E-5 41493 0 NA
12-133331313-C-T p.Pro196Pro synonymous ANKLE2 2 82992 2.40987E-5 41496 0 4.15752E-5
12-133331325-C-T p.Ala192Ala synonymous ANKLE2 7 83068 8.42683E-5 41534 0 5.03525E-4
12-133331326-G-A p.Ala192Val missense ANKLE2 7 83064 8.42724E-5 41532 0 6.3678E-5
12-133331331-C-T p.Ala190Ala synonymous ANKLE2 3 83082 3.61089E-5 41541 0 2.00492E-5
12-133331332-G-A p.Ala190Val missense ANKLE2 5 83074 6.01873E-5 41537 0 4.14883E-5
12-133331351-C-T p.Asp184Asn missense ANKLE2 22 83184 2.64474E-4 41592 0 5.03525E-4
12-133331352-G-A p.Thr183Thr synonymous ANKLE2 1 83200 1.20192E-5 41600 0 1.65854E-5
12-133331358-A-G p.Ser181Ser synonymous ANKLE2 1 83220 1.20163E-5 41610 0 NA
12-133331360-TA-T p.Ser181fs frameshift ANKLE2 1 83224 1.20158E-5 41612 0 8.29064E-6
12-133331360-T-C p.Ser181Gly missense ANKLE2 1 83224 1.20158E-5 41612 0 1.65813E-5
12-133331361-A-G p.Pro180Pro synonymous ANKLE2 1 83232 1.20146E-5 41616 0 5.03525E-4
12-133331362-G-T p.Pro180His missense ANKLE2 1 83232 1.20146E-5 41616 0 NA
12-133331364-G-A p.Pro179Pro synonymous ANKLE2 3725 83186 0.0447792 41593 96 0.05
12-133331370-C-T p.Ser177Ser synonymous ANKLE2 1 83248 1.20123E-5 41624 0 2.00377E-5
12-133331371-G-A p.Ser177Leu missense ANKLE2 74 83246 8.88932E-4 41623 1 7.62347E-4
12-133331408-G-T p.Pro165Thr missense ANKLE2 2 83334 2.39998E-5 41667 0 3.18532E-5
12-133331414-G-A p.Leu163Leu synonymous ANKLE2 7 83334 8.39993E-5 41667 0 5.03525E-4
12-133331416-C-T p.Gly162Asp missense ANKLE2 1 83334 1.19999E-5 41667 0 1.65623E-5
12-133331421-A-C p.Ser160Arg missense ANKLE2 1 83356 1.19967E-5 41678 0 NA
12-133331422-C-A p.Ser160Ile missense ANKLE2 2 83360 2.39923E-5 41680 0 3.18512E-5
12-133331423-T-C p.Ser160Gly missense ANKLE2 1 83358 1.19964E-5 41679 0 NA
12-133331433-A-G p.Asp156Asp synonymous ANKLE2 7 83376 8.3957E-5 41688 0 9.56755E-5
12-133331434-T-C p.Asp156Gly missense ANKLE2 1 83376 1.19939E-5 41688 0 3.18837E-5
12-133331436-T-C p.Arg155Arg synonymous ANKLE2 1 83374 1.19941E-5 41687 0 2.48423E-5
12-133331451-A-G p.Gly150Gly synonymous ANKLE2 1 83372 1.19944E-5 41686 0 4.00725E-6
12-133331459-G-C p.Gln148Glu missense ANKLE2 6734 83290 0.08085 41645 440 0.104902
12-133331479-G-A p.Ala141Val missense ANKLE2 5 83348 5.99894E-5 41674 0 3.18492E-5
12-133331483-G-C p.Pro140Ala missense ANKLE2 1 83356 1.19967E-5 41678 0 NA
12-133331491-A-C p.Ile137Ser missense ANKLE2 2 83354 2.3994E-5 41677 0 5.03525E-4
12-133331514-A-T p.Ala129Ala synonymous ANKLE2 227 83336 0.00272391 41668 3 0.0161128
12-133331529-C-T p.Glu124Glu synonymous ANKLE2 1 83358 1.19964E-5 41679 0 1.65629E-5
12-133331531-C-G p.Glu124Gln missense ANKLE2 1 83358 1.19964E-5 41679 0 4.00741E-6
12-133331535-G-A p.His122His synonymous ANKLE2 1 83356 1.19967E-5 41678 0 4.00734E-6
12-133331537-G-A p.His122Tyr missense ANKLE2 27970 83148 0.336388 41574 5092 0.350625
12-133331537-G-T p.His122Asn missense ANKLE2 1 83358 1.19964E-5 41679 0 NA
12-133331539-T-G p.Tyr121Ser missense ANKLE2 5 83362 5.99794E-5 41681 0 NA
12-133331554-C-A p.Arg116Met missense ANKLE2 3 83358 3.59893E-5 41679 0 8.01436E-6
12-133331556-T-TC p.Arg116fs frameshift ANKLE2 1 83340 1.1999E-5 41670 0 NA
12-133331558-C-T p.Gly115Arg missense ANKLE2 1 83342 1.19988E-5 41671 0 4.00721E-6
12-133331585-A-T p.Leu106Met missense ANKLE2 1 83302 1.20045E-5 41651 0 4.00705E-6
12-133331591-T-C p.Lys104Glu missense ANKLE2 6 83302 7.20271E-5 41651 0 3.18735E-5
12-133331621-T-C p.Ile94Val missense ANKLE2 10 83246 1.20126E-4 41623 0 4.80873E-5
12-133331624-G-A p.Pro93Ser missense ANKLE2 5 83240 6.00673E-5 41620 0 3.18695E-5
12-133331639-C-T p.Gly88Arg missense ANKLE2 6 83236 7.20842E-5 41618 0 9.56084E-5
12-133331640-G-C p.Ala87Ala synonymous ANKLE2 30 83240 3.60404E-4 41620 0 6.69003E-4
12-133331640-G-A p.Ala87Ala synonymous ANKLE2 1 83240 1.20135E-5 41620 0 8.02008E-6
12-133331649-G-A p.Ile84Ile synonymous ANKLE2 7 83234 8.41002E-5 41617 0 1.59418E-4
12-133331662-A-G p.Leu80Pro missense ANKLE2 1 83224 1.20158E-5 41612 0 NA
12-133331668-T-C p.Asp78Gly missense ANKLE2 19 83216 2.28321E-4 41608 0 2.54777E-4
12-133331671-G-A p.Pro77Leu missense ANKLE2 11 83206 1.32202E-4 41603 0 2.23072E-4
12-133331681-G-T p.Leu74Ile missense ANKLE2 1 83192 1.20204E-5 41596 0 8.46367E-6
12-133331685-C-G p.Leu72Phe missense ANKLE2 2 83180 2.40442E-5 41590 0 NA
12-133331687-A-G p.Leu72Leu synonymous ANKLE2 4 83174 4.8092E-5 41587 0 2.54859E-5
12-133331689-C-T p.Arg71Gln missense ANKLE2 7 83172 8.41629E-5 41586 0 5.28091E-4
12-133331699-G-A p.Leu68Leu synonymous ANKLE2 1 83134 1.20288E-5 41567 0 NA
12-133331701-G-C p.Ala67Gly missense ANKLE2 1 83110 1.20322E-5 41555 0 NA
12-133331702-C-A p.Ala67Ser missense ANKLE2 4 83110 4.8129E-5 41555 0 3.79609E-5
12-133331708-T-C p.Met65Val missense ANKLE2 38 83074 4.57424E-4 41537 0 1.90764E-4
12-133331709-T-G p.Thr64Thr synonymous ANKLE2 1 83064 1.20389E-5 41532 0 8.67905E-6
12-133331716-T-C p.Glu62Gly missense ANKLE2 1 82962 1.20537E-5 41481 0 4.32492E-6
12-133331719-C-T p.Gly61Asp missense+splice_region ANKLE2 1 82894 1.20636E-5 41447 0 2.63792E-5
12-133331721-T-TG c.182-3_182-2insC splice_region ANKLE2 1 82866 1.20677E-5 41433 0 NA
12-133331742-A-C c.-28T>G 5_prime_UTR_premature_start_codon_gain ANKLE2 1 82528 1.21171E-5 41264 0 1.90893E-5
12-133331743-A-G c.-29T>C 5_prime_UTR_premature_start_codon_gain ANKLE2 1 82514 1.21192E-5 41257 0 NA
12-133331789-T-C c.-75A>G 5_prime_UTR_premature_start_codon_gain ANKLE2 1 80626 1.24029E-5 40313 0 3.18532E-5
12-133331838-T-A c.-124A>T 5_prime_UTR_premature_start_codon_gain ANKLE2 2 72784 2.74786E-5 36392 0 NA
12-133331858-G-A c.-144C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 3 61386 4.88711E-5 30693 0 0.00230769
12-133331881-G-A c.-167C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 1 50746 1.9706E-5 25373 0 NA
12-133331901-G-A c.-187C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 3 43540 6.89022E-5 21770 0 3.20513E-5
12-133331905-G-A c.-191C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 6 41594 1.44252E-4 20797 0 1.92258E-4
12-133331928-G-A c.-214C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 1 32934 3.03638E-5 16467 0 NA
12-133331939-G-A c.-225C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 1 28344 3.52808E-5 14172 0 NA
12-133331959-G-A c.-245C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 1 19428 5.14721E-5 9714 0 6.44081E-5
12-133332000-G-A c.-286C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 58 5802 0.00999655 2901 0 0.0251959
12-133332007-T-A c.-293A>T 5_prime_UTR_premature_start_codon_gain ANKLE2 28 5446 0.00514139 2723 0 0.00622782
12-133332063-G-A c.-349C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 1 850 0.00117647 425 0 2.02484E-4
12-133333602-T-C c.-1888A>G 5_prime_UTR_premature_start_codon_gain ANKLE2 10 148 0.0675676 74 0 0.0849901
12-133335266-C-T c.-3552G>A 5_prime_UTR_premature_start_codon_gain ANKLE2 9 130 0.0692308 65 0 0.0633097
12-133335595-C-T c.-3881G>A 5_prime_UTR_premature_start_codon_gain ANKLE2 1 236 0.00423729 118 0 4.33902E-4
12-133335673-C-T c.-3959G>A 5_prime_UTR_premature_start_codon_gain ANKLE2 1 120 0.00833333 60 0 0.00513196
12-133336049-G-A c.-4335C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 7 152 0.0460526 76 0 0.0970112
12-133336157-G-A c.-4443C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 4 114 0.0350877 57 0 0.0487523
12-133336395-G-C c.-4681C>G 5_prime_UTR_premature_start_codon_gain ANKLE2 5 154 0.0324675 77 1 0.109044
12-133336916-C-G c.-5202G>C 5_prime_UTR_premature_start_codon_gain ANKLE2 1 158 0.00632911 79 0 0.00162514
12-133337166-C-A c.-5452G>T 5_prime_UTR_premature_start_codon_gain ANKLE2 1 152 0.00657895 76 0 0.00786775
12-133337805-A-G c.-6091T>C 5_prime_UTR_premature_start_codon_gain ANKLE2 165 208 0.793269 104 64 0.818628
12-133337946-G-A c.-6232C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 2 9134 2.18962E-4 4567 0 3.18756E-5
12-133337989-G-A c.-6275C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 1 13056 7.65931E-5 6528 0 NA
12-133338014-G-A c.-6300C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 2 18066 1.10705E-4 9033 0 NA
12-133338023-A-G c.-6309T>C 5_prime_UTR_premature_start_codon_gain ANKLE2 4 20334 1.96715E-4 10167 0 6.37918E-5
12-133338140-G-C c.-6426C>G 5_prime_UTR_premature_start_codon_gain ANKLE2 1 29104 3.43595E-5 14552 0 NA
12-133338205-T-A c.-6491A>T 5_prime_UTR_premature_start_codon_gain ANKLE2 2 31284 6.39304E-5 15642 0 9.70622E-5
12-133338206-G-A p.Ser60Leu missense+splice_region ANKLE2 1 31384 3.18634E-5 15692 0 NA
12-133338215-G-C p.Ala57Gly missense ANKLE2 1 31478 3.17682E-5 15739 0 NA
12-133338215-G-A p.Ala57Val missense ANKLE2 1 31478 3.17682E-5 15739 0 NA
12-133338217-G-A c.-6503C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 2 31472 6.35485E-5 15736 0 NA
12-133338220-G-C p.Ala55Ala synonymous ANKLE2 1 31568 3.16776E-5 15784 0 NA
12-133338232-C-G p.Pro51Pro synonymous ANKLE2 1 32096 3.11565E-5 16048 0 NA
12-133338233-G-A p.Pro51Leu missense ANKLE2 1 32190 3.10655E-5 16095 0 3.17763E-4
12-133338237-G-A p.Pro50Ser missense ANKLE2 2 32756 6.10575E-5 16378 0 3.28084E-5
12-133338245-G-A p.Thr47Ile missense ANKLE2 5 33034 1.51359E-4 16517 0 NA
12-133338248-C-T p.Gly46Glu missense ANKLE2 1 33150 3.01659E-5 16575 0 NA
12-133338250-G-A p.Ser45Ser synonymous ANKLE2 1 33214 3.01078E-5 16607 0 0.00135135
12-133338268-C-A c.-6554G>T 5_prime_UTR_premature_start_codon_gain ANKLE2 1 34666 2.88467E-5 17333 0 NA
12-133338275-G-C p.Pro37Arg missense ANKLE2 4 34756 1.15088E-4 17378 0 7.69231E-4
12-133338277-G-T p.Gly36Gly synonymous ANKLE2 1 34808 2.8729E-5 17404 0 NA
12-133338278-CCCAGCCGCCGCA-C p.Val32_Leu35del disruptive_inframe_deletion ANKLE2 1 34840 2.87026E-5 17420 0 NA
12-133338286-C-T p.Arg33Arg synonymous ANKLE2 4 34904 1.146E-4 17452 0 NA
12-133338286-C-CA p.Arg34fs frameshift ANKLE2 1 34904 2.865E-5 17452 0 NA
12-133338324-C-T p.Ala21Thr missense ANKLE2 1 33060 3.0248E-5 16530 0 NA
12-133338325-G-A p.Gly20Gly synonymous ANKLE2 1 32976 3.03251E-5 16488 0 NA
12-133338331-C-T p.Leu18Leu synonymous ANKLE2 1 32774 3.0512E-5 16387 0 NA
12-133338336-C-A p.Glu17* stop_gained ANKLE2 2 32348 6.18276E-5 16174 0 2.73943E-5
12-133338340-G-C p.Ala15Ala synonymous ANKLE2 2 31910 6.26763E-5 15955 0 NA
12-133338340-G-A c.-6626C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 3 31910 9.40144E-5 15955 0 NA
12-133338349-C-T p.Ala12Ala synonymous ANKLE2 1 30114 3.32071E-5 15057 0 NA
12-133338355-C-T c.-6641G>A 5_prime_UTR_premature_start_codon_gain ANKLE2 8 29832 2.68168E-4 14916 0 9.12825E-4
12-133338357-C-T p.Glu10Lys missense ANKLE2 1 29728 3.36383E-5 14864 0 NA
12-133338362-G-A p.Ala8Val missense ANKLE2 1 29374 3.40437E-5 14687 0 8.25083E-4
12-133338362-G-GCCGCCAGCCGCGGCCA p.Ala8fs frameshift ANKLE2 1 29374 3.40437E-5 14687 0 NA
12-133338366-C-T p.Ala7Thr missense ANKLE2 20 29262 6.8348E-4 14631 0 0.00158479
12-133338374-G-C p.Pro4Arg missense ANKLE2 2 28710 6.96621E-5 14355 0 3.83759E-5
12-133338381-G-A c.-6667C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 1 28326 3.53033E-5 14163 0 NA
12-133338383-A-C p.Met1? start_lost ANKLE2 1 28066 3.56303E-5 14033 0 NA
12-133338410-G-A c.-26C>T 5_prime_UTR_premature_start_codon_gain ANKLE2 4 20892 1.91461E-4 10446 0 NA
12-133338449-C-A c.-65G>T 5_prime_UTR_premature_start_codon_gain ANKLE2 574 6516 0.0880909 3258 19 0.13186