Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
19-17392489-C-G c.-241C>G 5_prime_UTR_premature_start_codon_gain ANKLE1 3 40962 7.32386E-5 20481 0 NA
19-17392557-C-G c.-173C>G 5_prime_UTR_premature_start_codon_gain ANKLE1 2 42654 4.68889E-5 21327 0 2.32472E-5
19-17392569-T-C p.Met1? start_lost ANKLE1 1 42784 2.33732E-5 21392 0 7.74473E-6
19-17392578-C-A p.Pro4His missense ANKLE1 1 42868 2.33274E-5 21434 0 NA
19-17392584-G-T p.Arg6Leu missense ANKLE1 1 42862 2.33307E-5 21431 0 NA
19-17392602-T-C p.Leu12Pro missense ANKLE1 1 43316 2.30862E-5 21658 0 NA
19-17392605-G-A p.Gly13Glu missense ANKLE1 1 43296 2.30968E-5 21648 0 3.18939E-5
19-17392608-C-T p.Thr14Ile missense ANKLE1 3 43300 6.92841E-5 21650 0 9.57304E-5
19-17392616-G-C p.Gly17Arg missense ANKLE1 1 43294 2.30979E-5 21647 0 NA
19-17392624-AGAGGGGCCCCCCGAGCCGAGGG-A p.Gly21fs frameshift ANKLE1 16 43476 3.68019E-4 21738 1 4.15362E-4
19-17392625-G-A p.Glu20Lys missense ANKLE1 1 43488 2.29948E-5 21744 0 3.19346E-5
19-17392629-G-A p.Gly21Glu missense ANKLE1 4476 43220 0.103563 21610 335 0.148169
19-17392630-G-GC p.Glu24fs frameshift ANKLE1 1630 43190 0.0377402 21595 43 0.0360088
19-17392632-C-A p.Pro22His missense ANKLE1 1 43372 2.30563E-5 21686 0 NA
19-17392632-C-G p.Pro22Arg missense ANKLE1 1 43372 2.30563E-5 21686 0 NA
19-17392635-CC-AA p.Pro23Gln missense ANKLE1 1 43454 2.30128E-5 21727 0 NA
19-17392645-G-T p.Arg26Ser missense ANKLE1 1 43900 2.2779E-5 21950 0 NA
19-17392647-G-C p.Gly27Ala missense ANKLE1 1 43938 2.27593E-5 21969 0 2.69833E-4
19-17392653-C-T p.Ala29Val missense ANKLE1 2 43838 4.56225E-5 21919 0 NA
19-17392655-G-A p.Ala30Thr missense ANKLE1 1 43874 2.27925E-5 21937 0 NA
19-17392671-C-T p.Pro5Ser missense ANKLE1 33 44292 7.45056E-4 22146 0 0.00104895
19-17392672-C-T p.Pro5Leu missense ANKLE1 59 44292 0.00133207 22146 1 0.00404794
19-17392684-T-C p.Val9Ala missense ANKLE1 3 44598 6.72676E-5 22299 0 7.73063E-4
19-17392686-G-A p.Gly10Arg missense ANKLE1 1 44728 2.23574E-5 22364 0 1.52798E-5
19-17392701-A-C p.Gln45Pro missense ANKLE1 1 45062 2.21916E-5 22531 0 NA
19-17392704-C-G p.Arg16Gly missense ANKLE1 1 44966 2.2239E-5 22483 0 NA
19-17392704-C-A p.Ala46Glu missense ANKLE1 1 44966 2.2239E-5 22483 0 NA
19-17392705-G-C p.Arg16Pro missense ANKLE1 82 44998 0.0018223 22499 0 0.00634202
19-17392713-T-G p.Ser19Ala missense ANKLE1 1 45306 2.20721E-5 22653 0 NA
19-17392714-C-G p.Ser19Trp missense ANKLE1 1 45340 2.20556E-5 22670 0 1.13766E-4
19-17392715-G-A p.Gly50Arg missense ANKLE1 7 45362 1.54314E-4 22681 0 2.34881E-4
19-17392730-A-C p.Met55Leu missense ANKLE1 1 46118 2.16835E-5 23059 0 NA
19-17392734-G-T p.Cys2Phe missense ANKLE1 1 46160 2.16638E-5 23080 0 1.5154E-5
19-17392742-G-T p.Ala5Ser missense ANKLE1 1 46464 2.1522E-5 23232 0 8.30979E-5
19-17392744-C-T p.Pro29Leu missense ANKLE1 2 46620 4.29E-5 23310 0 NA
19-17392749-T-C p.Leu7Pro missense ANKLE1 1 47100 2.12314E-5 23550 0 NA
19-17392755-G-T p.Arg9Leu missense ANKLE1 1 47420 2.10881E-5 23710 0 NA
19-17392763-C-T p.Arg12Trp missense ANKLE1 177 47970 0.00368981 23985 3 0.00863422
19-17392767-A-G p.Asp13Gly missense ANKLE1 1 48502 2.06177E-5 24251 0 NA
19-17392775-C-T p.Arg16Trp missense ANKLE1 5 49052 1.01933E-4 24526 0 2.05899E-4
19-17392779-A-C p.Glu17Ala missense ANKLE1 6 49780 1.2053E-4 24890 0 1.14141E-4
19-17392781-G-A p.Glu18Lys missense ANKLE1 1 50224 1.99108E-5 25112 0 NA
19-17392799-C-T c.62+8C>T splice_region ANKLE1 2 51332 3.89621E-5 25666 0 2.29431E-4
19-17392876-G-A p.Glu25Lys missense ANKLE1 2 57334 3.48833E-5 28667 0 7.35402E-6
19-17392879-C-G p.Leu26Val missense ANKLE1 1 56880 1.75809E-5 28440 0 7.36453E-6
19-17392883-T-A p.Leu27Gln missense ANKLE1 1 56374 1.77387E-5 28187 0 6.37959E-5
19-17392890-C-A p.Cys29* stop_gained ANKLE1 17 55264 3.07614E-4 27632 1 0.00125
19-17392894-G-A p.Ala31Thr missense ANKLE1 25712 53628 0.479451 26814 6463 0.490848
19-17392900-C-T p.Pro33Ser missense ANKLE1 1 53996 1.85199E-5 26998 0 NA
19-17392904-A-G p.Asn34Ser missense ANKLE1 1 53666 1.86338E-5 26833 0 2.20258E-5
19-17392934-T-G p.Val44Gly missense ANKLE1 1 48316 2.06971E-5 24158 0 1.49142E-5
19-17392937-A-G p.His45Arg missense ANKLE1 2 47826 4.18183E-5 23913 0 1.12185E-4
19-17392944-G-A p.Ala47Ala synonymous ANKLE1 1 46432 2.15369E-5 23216 0 2.25795E-5
19-17392947-C-T p.Ala48Ala synonymous ANKLE1 1 45666 2.18981E-5 22833 0 NA
19-17392964-G-A p.Arg54His missense ANKLE1 1 43520 2.29779E-5 21760 0 NA
19-17392966-G-A p.Gly55Ser missense ANKLE1 14 43438 3.22298E-4 21719 1 0.00443038
19-17392977-C-T p.Cys58Cys synonymous ANKLE1 364 42626 0.00853939 21313 14 0.0247465
19-17392984-G-A p.Ala61Thr missense ANKLE1 1 42122 2.37406E-5 21061 0 NA
19-17392989-A-T p.Leu62Leu synonymous ANKLE1 1 41742 2.39567E-5 20871 0 8.17501E-6
19-17393001-C-G p.Gly66Gly synonymous ANKLE1 49 40752 0.00120239 20376 0 5.80295E-4
19-17393007-C-A p.Asp68Glu missense ANKLE1 2 40170 4.97884E-5 20085 0 NA
19-17393012-A-G p.Asn70Ser missense ANKLE1 1 39724 2.51737E-5 19862 0 1.24731E-4
19-17393015-C-T p.Ala71Val missense ANKLE1 26407 35678 0.740148 17839 9945 0.793098
19-17393024-A-G c.215+6A>G splice_region ANKLE1 2 37862 5.28234E-5 18931 0 3.32506E-5
19-17393435-GCAATGACCCCTCTTGCGCTGC-G c.216-28_216-8delAATGACCCCTCTTGCGCTGCC splice_region ANKLE1 5 74812 6.68342E-5 37406 0 1.47798E-5
19-17393464-G-C c.216-1G>C splice_acceptor ANKLE1 1 76650 1.30463E-5 38325 0 7.32397E-6
19-17393467-C-A p.Ser73Tyr missense+splice_region ANKLE1 1 76728 1.30331E-5 38364 0 NA
19-17393471-C-G p.Val74Val synonymous ANKLE1 9 76778 1.17221E-4 38389 0 6.37389E-5
19-17393475-G-A p.Ala76Thr missense ANKLE1 1 76878 1.30076E-5 38439 0 NA
19-17393482-C-T p.Thr78Met missense ANKLE1 2 77058 2.59545E-5 38529 0 NA
19-17393497-C-T p.Ala83Val missense ANKLE1 9 77046 1.16813E-4 38523 0 2.54923E-4
19-17393501-C-T p.Ala84Ala synonymous ANKLE1 1 76856 1.30113E-5 38428 0 7.79059E-5
19-17393504-G-C p.Ala85Ala synonymous ANKLE1 56052 74032 0.757132 37016 21564 0.793091
19-17393513-C-T p.Cys88Cys synonymous ANKLE1 1 76770 1.30259E-5 38385 0 NA
19-17393517-C-T p.Arg90Cys missense ANKLE1 1 76730 1.30327E-5 38365 0 NA
19-17393525-G-C p.Leu92Leu synonymous ANKLE1 1 76938 1.29975E-5 38469 0 7.06794E-6
19-17393530-T-A p.Leu94Gln missense ANKLE1 36269 74276 0.4883 37138 8782 0.519121
19-17393538-A-C p.Ser97Arg missense ANKLE1 1 76844 1.30134E-5 38422 0 NA
19-17393545-G-T p.Gly99Val missense ANKLE1 2 76830 2.60315E-5 38415 0 2.75961E-5
19-17393554-CGGCGCTGCGCGACCAGGTTGGGA-C p.Leu104fs frameshift ANKLE1 2 76236 2.62343E-5 38118 0 NA
19-17393557-C-T p.Ala103Val missense ANKLE1 1 76026 1.31534E-5 38013 0 1.91168E-4
19-17393570-G-A p.Gln107Gln splice_region+synonymous ANKLE1 1 76204 1.31227E-5 38102 0 6.40418E-6
19-17393665-C-T c.322-8C>T splice_region ANKLE1 2 77134 2.59289E-5 38567 0 3.18715E-5
19-17393671-A-G c.322-2A>G splice_acceptor ANKLE1 1 77350 1.29282E-5 38675 0 1.88459E-5
19-17393676-G-T p.Gly109* stop_gained ANKLE1 1 77332 1.29313E-5 38666 0 9.7581E-6
19-17393683-G-A p.Arg111Gln missense ANKLE1 2 77286 2.58779E-5 38643 0 3.18837E-5
19-17393703-C-A p.Gln118Lys missense ANKLE1 1 77808 1.28521E-5 38904 0 NA
19-17393709-G-A p.Gly120Arg missense ANKLE1 2 77890 2.56772E-5 38945 0 7.88975E-5
19-17393710-G-T p.Gly120Val missense ANKLE1 1 77878 1.28406E-5 38939 0 1.5847E-4
19-17393718-G-T p.Glu123* stop_gained ANKLE1 1 77964 1.28264E-5 38982 0 5.4575E-6
19-17393724-G-C p.Ala125Pro missense ANKLE1 1 77686 1.28723E-5 38843 0 NA
19-17393732-C-A p.Val127Val synonymous ANKLE1 1 78340 1.27649E-5 39170 0 NA
19-17393738-G-T p.Gln129His missense ANKLE1 99 78604 0.00125948 39302 0 0.00152781
19-17393738-G-A p.Gln129Gln synonymous ANKLE1 3 78608 3.81641E-5 39304 0 6.54777E-4
19-17393741-T-A p.Asp130Glu missense ANKLE1 1 78664 1.27123E-5 39332 0 6.28141E-5
19-17393744-C-T p.Leu131Leu synonymous ANKLE1 1 78670 1.27113E-5 39335 0 9.61354E-5
19-17393755-C-G p.Thr135Ser missense ANKLE1 2 79170 2.52621E-5 39585 0 NA
19-17393757-A-AGGACCC p.Thr139_Arg140dup disruptive_inframe_insertion ANKLE1 10 79310 1.26087E-4 39655 0 1.00361E-4
19-17393759-G-A p.Arg136Arg synonymous ANKLE1 12 79326 1.51274E-4 39663 0 4.464E-4
19-17393760-A-G p.Thr137Ala missense ANKLE1 1 79294 1.26113E-5 39647 0 3.18979E-5
19-17393762-C-G p.Thr137Thr synonymous ANKLE1 1 79476 1.25824E-5 39738 0 NA
19-17393762-C-T p.Thr137Thr synonymous ANKLE1 1 79476 1.25824E-5 39738 0 NA
19-17393763-C-T p.Arg138Trp missense ANKLE1 2 79506 2.51553E-5 39753 0 0.00101112
19-17393769-C-T p.Arg140Trp missense ANKLE1 17 79732 2.13214E-4 39866 0 2.50054E-4
19-17393772-A-G p.Ile141Val missense ANKLE1 8 79942 1.00073E-4 39971 0 7.85643E-5
19-17393773-TC-T p.Ile141fs frameshift ANKLE1 2 79972 2.50088E-5 39986 0 NA
19-17393774-C-A p.Ile141Ile synonymous ANKLE1 2 80016 2.4995E-5 40008 0 1.44907E-4
19-17393775-G-C p.Gly142Arg missense ANKLE1 1 80096 1.2485E-5 40048 0 1.12042E-5
19-17393778-G-A p.Ala143Thr missense ANKLE1 11 80200 1.37157E-4 40100 0 1.59449E-4
19-17393787-C-T p.Gln146* stop_gained ANKLE1 4 80538 4.9666E-5 40269 0 0.00100908
19-17393790-G-A p.Glu147Lys missense ANKLE1 1 80566 1.24122E-5 40283 0 NA
19-17393793-C-T p.Pro148Ser missense ANKLE1 1 80544 1.24156E-5 40272 0 NA
19-17393795-C-T p.Pro148Pro synonymous ANKLE1 1 80634 1.24017E-5 40317 0 NA
19-17393802-G-A p.Ala151Thr missense ANKLE1 3 80900 3.70828E-5 40450 0 3.99425E-5
19-17393805-C-T p.Pro152Ser missense ANKLE1 13 80912 1.60668E-4 40456 0 1.75939E-5
19-17393984-G-A n.534G>A splice_region ANKLE1 6 80414 7.46139E-5 40207 0 3.55114E-5
19-17394032-A-G c.461-2A>G splice_acceptor ANKLE1 4 81100 4.93218E-5 40550 0 3.2781E-5
19-17394051-C-T p.Pro160Ser missense ANKLE1 404 81474 0.00495864 40737 5 0.00987827
19-17394053-T-C p.Pro160Pro synonymous ANKLE1 1 81536 1.22645E-5 40768 0 NA
19-17394057-G-C p.Asp162His missense ANKLE1 2 81644 2.44966E-5 40822 0 8.44623E-6
19-17394064-C-T p.Thr164Met missense ANKLE1 1 81742 1.22336E-5 40871 0 8.40251E-6
19-17394065-G-A p.Thr164Thr synonymous ANKLE1 169 81708 0.00206834 40854 2 0.00385596
19-17394081-C-T p.Leu170Phe missense ANKLE1 1 81904 1.22094E-5 40952 0 3.18512E-5
19-17394087-A-T p.Lys172* stop_gained ANKLE1 5 81996 6.09786E-5 40998 0 8.31352E-6
19-17394098-C-G p.Cys175Trp missense ANKLE1 59 82028 7.19267E-4 41014 0 0.00232573
19-17394103-G-T p.Gly177Val missense ANKLE1 1 82050 1.21877E-5 41025 0 NA
19-17394109-A-G p.Asn179Ser missense ANKLE1 2 82102 2.43599E-5 41051 0 3.18654E-5
19-17394110-C-T p.Asn179Asn synonymous ANKLE1 1 82108 1.21791E-5 41054 0 NA
19-17394113-G-A p.Arg180Arg synonymous ANKLE1 6 82112 7.30709E-5 41056 0 4.97768E-5
19-17394118-T-C p.Ile182Thr missense ANKLE1 1 82126 1.21764E-5 41063 0 8.31878E-6
19-17394120-G-A p.Gly183Ser missense ANKLE1 1 82126 1.21764E-5 41063 0 NA
19-17394124-T-G p.Leu184Trp missense ANKLE1 40443 81202 0.498054 40601 10157 0.510332
19-17394136-C-T p.Pro188Leu missense ANKLE1 1 82076 1.21838E-5 41038 0 3.99259E-6
19-17394138-G-A p.Gly189Arg missense ANKLE1 7 82070 8.5293E-5 41035 0 1.23772E-4
19-17394142-C-A p.Pro190His missense ANKLE1 2 82122 2.4354E-5 41061 0 NA
19-17394149-C-T p.Ser192Ser synonymous ANKLE1 2 82120 2.43546E-5 41060 0 8.30758E-6
19-17394153-C-T p.Pro194Ser missense ANKLE1 1 82166 1.21705E-5 41083 0 3.99119E-6
19-17394170-T-C p.Thr199Thr synonymous ANKLE1 1 82176 1.2169E-5 41088 0 NA
19-17394176-C-A p.Asp201Glu missense ANKLE1 1 82180 1.21684E-5 41090 0 1.66022E-5
19-17394183-G-A p.Gly204Arg missense ANKLE1 1 82140 1.21743E-5 41070 0 NA
19-17394190-C-T p.Ser206Leu missense ANKLE1 1 82062 1.21859E-5 41031 0 2.49103E-5
19-17394193-C-T p.Ala207Val missense ANKLE1 1 81994 1.2196E-5 40997 0 8.30261E-6
19-17394194-G-A p.Ala207Ala synonymous ANKLE1 3 81994 3.6588E-5 40997 0 6.25E-4
19-17394199-C-G p.Pro209Arg missense ANKLE1 35 81962 4.27027E-4 40981 0 1.27918E-4
19-17394207-C-T p.His212Tyr missense ANKLE1 1 81866 1.22151E-5 40933 0 NA
19-17394220-G-A p.Ser216Asn missense ANKLE1 1 81694 1.22408E-5 40847 0 NA
19-17394227-C-T p.Asp218Asp synonymous ANKLE1 8 81524 9.81306E-5 40762 0 6.37024E-5
19-17394228-G-A p.Ala219Thr missense ANKLE1 77 81502 9.44762E-4 40751 1 0.00207059
19-17394228-G-C p.Ala219Pro missense ANKLE1 1 81504 1.22693E-5 40752 0 NA
19-17394236-C-G p.Phe221Leu missense ANKLE1 1 81358 1.22914E-5 40679 0 8.30937E-6
19-17394237-G-A p.Val222Ile missense ANKLE1 60 81272 7.38262E-4 40636 0 0.00130623
19-17394240-A-C p.Thr223Pro missense ANKLE1 8 81286 9.84179E-5 40643 0 5.41746E-4
19-17394241-C-G p.Thr223Arg missense ANKLE1 2 81262 2.46117E-5 40631 0 NA
19-17394244-C-T p.Ala224Val missense ANKLE1 1 81126 1.23265E-5 40563 0 2.49356E-5
19-17394256-C-T p.Ser228Phe missense ANKLE1 4 81024 4.93681E-5 40512 0 1.2461E-4
19-17394259-G-A p.Gly229Glu missense ANKLE1 1 80966 1.23509E-5 40483 0 NA
19-17394261-G-A p.Ala230Thr missense ANKLE1 1 80908 1.23597E-5 40454 0 5.03525E-4
19-17394274-C-T p.Ala234Val missense ANKLE1 1 80836 1.23707E-5 40418 0 3.18593E-5
19-17394277-C-T p.Ser235Leu missense ANKLE1 2 80810 2.47494E-5 40405 0 1.66157E-5
19-17394278-G-A p.Ser235Ser synonymous ANKLE1 1 80756 1.2383E-5 40378 0 1.66091E-5
19-17394287-C-T p.Pro238Pro synonymous ANKLE1 1 80962 1.23515E-5 40481 0 3.99581E-6
19-17394310-C-T p.Pro246Leu missense ANKLE1 1 81072 1.23347E-5 40536 0 3.99565E-5
19-17394311-G-A p.Pro246Pro synonymous ANKLE1 4 81042 4.93571E-5 40521 0 5.03525E-4
19-17394312-A-G p.Thr247Ala missense ANKLE1 1 81088 1.23323E-5 40544 0 NA
19-17394321-G-C p.Gly250Arg missense ANKLE1 25 81160 3.08034E-4 40580 0 6.68918E-4
19-17394322-GA-G p.Leu251fs frameshift ANKLE1 39 81166 4.80497E-4 40583 0 0.00105142
19-17394322-G-A p.Gly250Glu missense ANKLE1 1 81166 1.23204E-5 40583 0 NA
19-17394324-C-T p.Leu251Phe missense ANKLE1 1 81160 1.23213E-5 40580 0 NA
19-17394339-C-T p.His256Tyr missense ANKLE1 1 81154 1.23223E-5 40577 0 3.32486E-5
19-17394354-G-A p.Val261Ile missense ANKLE1 3 80938 3.70654E-5 40469 0 1.91217E-4
19-17394373-C-T p.Thr267Met missense ANKLE1 16 80774 1.98084E-4 40387 1 9.56267E-5
19-17394374-G-A p.Thr267Thr synonymous ANKLE1 1 80778 1.23796E-5 40389 0 9.56328E-5
19-17394375-G-C p.Glu268Gln missense ANKLE1 962 80728 0.0119166 40364 13 0.0131859
19-17394378-G-A p.Ala269Thr missense ANKLE1 1 80712 1.23897E-5 40356 0 7.99731E-6
19-17394386-GA-G p.Asn272fs frameshift ANKLE1 2 80782 2.4758E-5 40391 0 0.00100705
19-17394386-G-A p.Leu271Leu synonymous ANKLE1 1 80782 1.2379E-5 40391 0 NA
19-17394393-C-T p.Arg274Cys missense ANKLE1 5 80780 6.18965E-5 40390 0 0.00100705
19-17394394-G-A p.Arg274His missense ANKLE1 8 80780 9.90344E-5 40390 0 1.0002E-4
19-17394401-G-A p.Gln276Gln synonymous ANKLE1 2 80804 2.47513E-5 40402 0 3.99904E-6
19-17394402-G-A p.Ala277Thr missense ANKLE1 1 80776 1.23799E-5 40388 0 NA
19-17394410-T-G p.Thr279Thr synonymous ANKLE1 1 80876 1.23646E-5 40438 0 NA
19-17394434-C-T p.Gly287Gly synonymous ANKLE1 3 81118 3.69832E-5 40559 0 4.00038E-6
19-17394454-C-G p.Ser294Cys missense ANKLE1 2 81498 2.45405E-5 40749 0 2.39511E-5
19-17394454-C-A p.Ser294Tyr missense ANKLE1 1 81498 1.22702E-5 40749 0 NA
19-17394457-T-C p.Met295Thr missense ANKLE1 2 81518 2.45345E-5 40759 0 8.30772E-6
19-17394462-C-T p.Leu297Phe missense ANKLE1 1 81664 1.22453E-5 40832 0 NA
19-17394462-C-G p.Leu297Val missense ANKLE1 2 81664 2.44906E-5 40832 0 2.49128E-5
19-17394470-C-G p.Asp299Glu missense ANKLE1 1 81768 1.22297E-5 40884 0 3.98832E-6
19-17394485-T-C p.His304His synonymous ANKLE1 1 81918 1.22073E-5 40959 0 NA
19-17394487-G-GC p.Arg308fs frameshift ANKLE1 1 81970 1.21996E-5 40985 0 NA
19-17394488-C-T p.Ser305Ser synonymous ANKLE1 2 81982 2.43956E-5 40991 0 3.58972E-5
19-17394495-C-T p.Arg308Trp missense ANKLE1 2 82044 2.43772E-5 41022 0 3.98692E-6
19-17394496-G-A p.Arg308Gln missense ANKLE1 12 82016 1.46313E-4 41008 0 6.61835E-5
19-17394502-CAA-TAC p.ProThr310LeuPro missense ANKLE1 6 82064 7.31137E-5 41032 0 NA
19-17394502-C-T p.Pro310Leu missense ANKLE1 4 82064 4.87424E-5 41032 0 2.55116E-4
19-17394504-A-C p.Thr311Pro missense ANKLE1 62296 81484 0.764518 40742 24220 0.7931
19-17394507-C-G p.Pro312Ala missense ANKLE1 22 82120 2.67901E-4 41060 0 2.31179E-4
19-17394515-TTC-T p.Ser315fs frameshift ANKLE1 1 82172 1.21696E-5 41086 0 NA
19-17394523-G-A p.Cys317Tyr missense ANKLE1 94 82174 0.00114391 41087 0 6.25E-4
19-17394528-T-G p.Cys319Gly missense ANKLE1 1 82194 1.21663E-5 41097 0 NA
19-17394531-C-T p.Leu320Leu synonymous ANKLE1 1 82206 1.21646E-5 41103 0 NA
19-17394539-G-A p.Glu322Glu synonymous ANKLE1 2 82182 2.43362E-5 41091 0 NA
19-17394545-G-C p.Gln324His missense ANKLE1 1 82204 1.21649E-5 41102 0 2.47615E-5
19-17394552-A-G p.Ile327Val missense ANKLE1 6 82208 7.29856E-5 41104 0 5.03525E-4
19-17394572-G-A p.Thr333Thr synonymous ANKLE1 1 82162 1.21711E-5 41081 0 8.26078E-6
19-17394578-G-T p.Trp335Cys missense ANKLE1 1 82160 1.21714E-5 41080 0 NA
19-17394585-G-A p.Glu338Lys missense ANKLE1 1 82154 1.21723E-5 41077 0 NA
19-17394594-G-A p.Ala341Thr missense ANKLE1 119 82080 0.00144981 41040 1 0.00162462
19-17394606-G-A p.Gly345Ser missense ANKLE1 4 82002 4.87793E-5 41001 0 3.18573E-5
19-17394606-G-T p.Gly345Cys missense ANKLE1 5 82002 6.09741E-5 41001 0 1.59569E-5
19-17394610-G-A p.Gly346Asp missense ANKLE1 1 81918 1.22073E-5 40959 0 NA
19-17394610-G-T p.Gly346Val missense ANKLE1 2 81918 2.44147E-5 40959 0 3.30945E-5
19-17394615-G-A p.Glu348Lys missense ANKLE1 5 81924 6.10322E-5 40962 0 6.25E-4
19-17394619-C-A p.Pro349His missense ANKLE1 1 81876 1.22136E-5 40938 0 3.99291E-6
19-17394623-C-T p.Val350Val synonymous ANKLE1 7 81798 8.55767E-5 40899 0 1.27969E-4
19-17394624-G-A p.Gly351Ser missense ANKLE1 2 81784 2.44547E-5 40892 0 8.2982E-6
19-17394633-C-T p.Arg354Trp missense ANKLE1 122 81644 0.00149429 40822 0 0.00136099
19-17394634-G-A p.Arg354Gln missense ANKLE1 8 81696 9.7924E-5 40848 0 1.24836E-4
19-17394638-C-T p.His355His synonymous ANKLE1 1 82034 1.21901E-5 41017 0 NA
19-17394656-G-T p.Val361Val synonymous ANKLE1 5 82060 6.0931E-5 41030 0 4.96204E-5
19-17394671-G-A p.Leu366Leu synonymous ANKLE1 1 81996 1.21957E-5 40998 0 3.18451E-5
19-17394677-G-C p.Lys368Asn missense ANKLE1 1 81982 1.21978E-5 40991 0 NA
19-17394687-G-A p.Ala372Thr missense ANKLE1 1 81814 1.22228E-5 40907 0 3.98591E-6
19-17394693-G-A p.Gly396Ser missense+splice_region ANKLE1 3 81778 3.66847E-5 40889 0 3.18552E-5
19-17394700-A-C p.Asn376Thr missense ANKLE1 103 81634 0.00126173 40817 1 0.00302115
19-17394702-C-G p.Pro377Ala missense ANKLE1 1 81618 1.22522E-5 40809 0 NA
19-17394753-G-T p.Glu394* stop_gained ANKLE1 1 81154 1.23223E-5 40577 0 NA
19-17394760-A-G p.Gln396Arg missense ANKLE1 1 81154 1.23223E-5 40577 0 NA
19-17394761-G-T p.Gln396His missense ANKLE1 2 81136 2.465E-5 40568 0 6.37186E-5
19-17394770-T-G p.Pro399Pro splice_region+synonymous ANKLE1 2 81166 2.46409E-5 40583 0 6.37308E-5
19-17394770-T-C p.Pro399Pro splice_region+synonymous ANKLE1 1 81166 1.23204E-5 40583 0 NA
19-17394777-T-C c.1198+6T>C splice_region ANKLE1 1 81222 1.23119E-5 40611 0 NA
19-17394903-G-A p.Glu402Lys missense ANKLE1 3 82374 3.64193E-5 41187 0 1.27478E-4
19-17394927-C-T p.Leu410Leu synonymous ANKLE1 1 82378 1.21392E-5 41189 0 3.9932E-6
19-17394942-C-T p.Arg415Trp missense ANKLE1 50 82376 6.06973E-4 41188 0 0.00105129
19-17394947-G-A p.Thr416Thr synonymous ANKLE1 2 82360 2.42836E-5 41180 0 3.18613E-5
19-17394962-T-A p.Asp421Glu missense ANKLE1 2 82360 2.42836E-5 41180 0 NA
19-17394969-G-A p.Ala424Thr missense ANKLE1 1 82334 1.21457E-5 41167 0 NA
19-17394980-C-T p.Asp427Asp synonymous ANKLE1 1 82322 1.21474E-5 41161 0 3.18654E-5
19-17394981-G-A p.Ala428Thr missense ANKLE1 152 82322 0.00184641 41161 2 0.00385522
19-17394982-C-T p.Ala428Val missense ANKLE1 3 82322 3.64423E-5 41161 0 5.03525E-4
19-17394982-C-G p.Ala428Gly missense ANKLE1 6 82322 7.28845E-5 41161 0 4.15193E-5
19-17394983-G-A p.Ala428Ala synonymous ANKLE1 4 82330 4.8585E-5 41165 0 5.03525E-4
19-17394990-C-T p.Gln431* stop_gained ANKLE1 2 82354 2.42854E-5 41177 0 NA
19-17394999-G-A p.Glu434Lys missense ANKLE1 1 82342 1.21445E-5 41171 0 NA
19-17395002-C-T p.Gln435* stop_gained ANKLE1 1 82340 1.21448E-5 41170 0 0.00125
19-17395002-CA-TG p.Gln435Trp missense ANKLE1 1 82340 1.21448E-5 41170 0 NA
19-17395003-A-G p.Gln435Arg missense ANKLE1 61688 81018 0.761411 40509 23843 0.792861
19-17395008-G-C p.Asp437His missense ANKLE1 1 82364 1.21412E-5 41182 0 3.18715E-5
19-17395015-C-T p.Ala439Val missense ANKLE1 1 82374 1.21398E-5 41187 0 8.27883E-6
19-17395022-G-A p.Arg441Arg synonymous ANKLE1 46 82364 5.58496E-4 41182 0 3.18674E-4
19-17395024-G-A p.Trp442* stop_gained ANKLE1 1 82356 1.21424E-5 41178 0 NA
19-17395027-G-A p.Arg443Gln missense ANKLE1 2 82354 2.42854E-5 41177 0 6.37227E-5
19-17395029-G-T p.Glu444* stop_gained ANKLE1 20 82362 2.4283E-4 41181 0 6.37146E-5
19-17395033-G-A p.Gly445Glu missense ANKLE1 1 82360 1.21418E-5 41180 0 3.18634E-5
19-17395034-G-T p.Gly445Gly synonymous ANKLE1 6 82366 7.28456E-5 41183 0 2.48414E-5
19-17395037-C-T p.Val446Val synonymous ANKLE1 10 82342 1.21445E-4 41171 0 1.91452E-4
19-17395037-C-G p.Val446Val synonymous ANKLE1 1 82342 1.21445E-5 41171 0 NA
19-17395038-G-A p.Val447Met missense ANKLE1 701 82326 0.00851493 41163 16 0.0161301
19-17395054-C-T p.Thr452Ile missense ANKLE1 3 82276 3.64626E-5 41138 0 6.37064E-5
19-17395055-C-G p.Thr452Thr synonymous ANKLE1 61266 80546 0.760634 40273 23663 0.792999
19-17395055-C-A p.Thr452Thr synonymous ANKLE1 5 82246 6.07932E-5 41123 0 1.65399E-5
19-17395056-T-C p.Tyr453His missense ANKLE1 2 82252 2.43155E-5 41126 0 5.59289E-5
19-17395062-C-T p.Leu455Leu synonymous ANKLE1 7 82188 8.51706E-5 41094 0 NA
19-17395081-C-T c.1376+6C>T splice_region ANKLE1 2 81994 2.4392E-5 40997 0 4.01339E-6
19-17396241-G-T p.Glu460* stop_gained ANKLE1 1 82532 1.21165E-5 41266 0 NA
19-17396247-C-G p.Gln462Glu missense ANKLE1 1 82596 1.21071E-5 41298 0 3.18939E-5
19-17396252-C-A p.Asp463Glu missense ANKLE1 1 82610 1.21051E-5 41305 0 3.18959E-5
19-17396255-G-A p.Cys379Tyr missense ANKLE1 2 82616 2.42084E-5 41308 0 NA
19-17396257-C-T p.Gln380* stop_gained ANKLE1 14 82632 1.69426E-4 41316 0 4.46656E-4
19-17396260-C-T p.Ala466Val missense ANKLE1 2 82638 2.42019E-5 41319 0 NA
19-17396262-C-T p.Arg467* stop_gained ANKLE1 4 82640 4.84027E-5 41320 0 6.37836E-5
19-17396263-G-A p.Arg467Gln missense ANKLE1 14 82640 1.69409E-4 41320 0 1.15512E-4
19-17396272-C-T p.Ser470Leu missense ANKLE1 19 82666 2.29841E-4 41333 0 0.00100705
19-17396289-C-T p.Arg476Cys missense ANKLE1 26 82662 3.14534E-4 41331 1 0.0020141
19-17396290-G-A p.Arg476His missense ANKLE1 4 82664 4.83887E-5 41332 0 6.25E-4
19-17396307-C-T p.Arg482Cys missense ANKLE1 4 82664 4.83887E-5 41332 0 1.59418E-4
19-17396308-G-A p.Arg482His missense ANKLE1 9 82670 1.08867E-4 41335 0 5.77101E-5
19-17396322-G-A p.Val487Met missense ANKLE1 5 82648 6.04975E-5 41324 1 0.00100806
19-17396324-G-A p.Val487Val synonymous ANKLE1 1 82656 1.20983E-5 41328 0 NA
19-17396332-G-C p.Gly490Ala missense ANKLE1 2 82638 2.42019E-5 41319 0 3.18674E-5
19-17396332-G-A p.Gly490Glu missense ANKLE1 1 82638 1.2101E-5 41319 0 3.18674E-5
19-17396333-G-A p.Gly490Gly synonymous ANKLE1 546 82626 0.00660809 41313 8 0.01268
19-17396335-C-T p.Thr491Met missense ANKLE1 1 82628 1.21024E-5 41314 0 3.58357E-5
19-17396336-G-A p.Thr491Thr synonymous ANKLE1 5 82634 6.05078E-5 41317 0 3.1855E-5
19-17396337-A-T p.Arg492Trp missense ANKLE1 1 82638 1.2101E-5 41319 0 NA
19-17396338-G-A p.Arg492Lys missense ANKLE1 2 82646 2.41996E-5 41323 0 NA
19-17396339-G-A p.Arg492Arg synonymous ANKLE1 1 82634 1.21016E-5 41317 0 NA
19-17396342-C-T p.Ala493Ala synonymous ANKLE1 2 82624 2.4206E-5 41312 0 3.18532E-5
19-17396343-C-T p.Arg494Trp missense ANKLE1 16 82612 1.93676E-4 41306 0 0.00100705
19-17396344-G-A p.Arg494Gln missense ANKLE1 1560 82612 0.0188835 41306 23 0.0174844
19-17396348-A-G p.Pro495Pro synonymous ANKLE1 1 82590 1.2108E-5 41295 0 NA
19-17396349-T-C p.Tyr496His missense ANKLE1 1 82592 1.21077E-5 41296 0 2.47329E-5
19-17396351-T-A p.Tyr496* stop_gained ANKLE1 1 82588 1.21083E-5 41294 0 NA
19-17396370-C-G p.Leu503Val missense ANKLE1 20 82574 2.42207E-4 41287 0 5.09846E-4
19-17396372-T-C p.Leu503Leu synonymous ANKLE1 1 82568 1.21112E-5 41284 0 7.16926E-5
19-17396378-C-T p.His505His synonymous ANKLE1 6 82560 7.26744E-5 41280 0 9.55657E-5
19-17396382-G-C p.Gly507Arg missense ANKLE1 74 82548 8.96448E-4 41274 3 0.00503525
19-17396382-GGGC-G p.Arg508del conservative_inframe_deletion ANKLE1 2 82548 2.42283E-5 41274 0 5.77348E-5
19-17396385-C-T p.Arg508Trp missense ANKLE1 10 82544 1.21148E-4 41272 0 5.03525E-4
19-17396386-G-A p.Arg508Gln missense ANKLE1 4 82552 4.84543E-5 41276 0 3.29957E-5
19-17396390-A-G p.Ser509Ser synonymous ANKLE1 5 82534 6.05811E-5 41267 0 8.36507E-5
19-17396393-A-G p.Arg510Arg synonymous ANKLE1 9 82528 1.09054E-4 41264 0 7.58813E-4
19-17396394-AAAC-A p.Gln512del disruptive_inframe_deletion ANKLE1 2 82532 2.4233E-5 41266 0 6.59859E-5
19-17396397-CAGGTGTGAGGACAGGGATCAGGGTTCAGCGAGGGCAGTCGGGCCATGGGCAGGGGAGGGTATTGGGGGTGCTGACTCCTGATTCTGCCCT-C p.Gln512fs frameshift ANKLE1 1 82516 1.21189E-5 41258 0 NA
19-17396486-C-G c.1537-4C>G splice_region ANKLE1 1 82424 1.21324E-5 41212 0 1.65503E-5
19-17396488-AG-A c.1537-1delG splice_acceptor ANKLE1 1 82410 1.21345E-5 41205 0 NA
19-17396493-C-T p.His514Tyr missense ANKLE1 2 82416 2.42671E-5 41208 0 NA
19-17396504-C-T p.Cys517Cys synonymous ANKLE1 2 82418 2.42665E-5 41209 0 1.99354E-5
19-17396510-G-A p.Lys519Lys synonymous ANKLE1 1 82430 1.21315E-5 41215 0 NA
19-17396515-G-A p.Arg521His missense ANKLE1 2 82446 2.42583E-5 41223 0 3.18654E-5
19-17396523-T-G p.Leu524Val missense ANKLE1 251 82440 0.00304464 41220 3 0.00560831
19-17396540-T-C p.Ser529Ser synonymous ANKLE1 1 82442 1.21297E-5 41221 0 NA
19-17396542-G-A p.Gly530Asp missense ANKLE1 17 82442 2.06206E-4 41221 0 2.91154E-4
19-17396545-G-A p.Cys531Tyr missense ANKLE1 1 82430 1.21315E-5 41215 0 3.98839E-6
19-17396546-C-T p.Cys531Cys synonymous ANKLE1 9 82428 1.09186E-4 41214 0 1.27453E-4
19-17396548-GT-AC p.Gly532Asp missense ANKLE1 2 82418 2.42665E-5 41209 0 NA
19-17396549-T-C p.Gly532Gly synonymous ANKLE1 62801 82186 0.764133 41093 24400 0.793278
19-17396549-TG-CA p.GlyVal532GlyIle missense ANKLE1 31 82406 3.76186E-4 41203 0 NA
19-17396550-G-A p.Val533Ile missense ANKLE1 56 82404 6.79579E-4 41202 0 0.00223353
19-17396551-T-C p.Val533Ala missense ANKLE1 1 82414 1.21339E-5 41207 0 NA
19-17396553-G-T p.Val534Leu missense ANKLE1 1 82424 1.21324E-5 41212 0 3.98832E-6
19-17396557-C-G p.Ser535Cys missense ANKLE1 34 82420 4.12521E-4 41210 1 0.00108301
19-17396563-A-G p.His537Arg missense ANKLE1 2 82424 2.42648E-5 41212 0 6.63086E-5
19-17396567-C-T p.Cys538Cys synonymous ANKLE1 1 82436 1.21306E-5 41218 0 NA
19-17396567-C-A p.Cys538* stop_gained ANKLE1 1 82436 1.21306E-5 41218 0 8.29174E-6
19-17396570-C-T p.Phe539Phe synonymous ANKLE1 2 82430 2.4263E-5 41215 0 3.18532E-5
19-17396576-C-A p.His541Gln missense ANKLE1 6 82432 7.27873E-5 41216 0 7.47012E-5
19-17396576-C-T p.His541His synonymous ANKLE1 6 82432 7.27873E-5 41216 1 4.98008E-5
19-17396577-G-A p.Val542Met missense ANKLE1 588 82424 0.00713384 41212 3 0.0075
19-17396582-C-T p.Val543Val synonymous ANKLE1 3 82426 3.63963E-5 41213 0 5.03525E-4
19-17396583-G-A p.Ala544Thr missense ANKLE1 1 82424 1.21324E-5 41212 0 3.32099E-5
19-17396584-C-T p.Ala544Val missense ANKLE1 17 82426 2.06246E-4 41213 0 2.22987E-4
19-17396597-T-C p.Tyr548Tyr synonymous ANKLE1 5 82402 6.06781E-5 41201 0 6.37186E-5
19-17396601-C-T p.Arg550Trp missense ANKLE1 3 82408 3.64042E-5 41204 0 9.14168E-5
19-17396602-G-A p.Arg550Gln missense ANKLE1 8 82406 9.70803E-5 41203 0 6.37349E-5
19-17396608-C-T p.Ala552Val missense ANKLE1 3 82396 3.64095E-5 41198 0 1.1975E-5
19-17396609-G-A p.Ala552Ala synonymous ANKLE1 4 82396 4.8546E-5 41198 0 6.25E-4
19-17396614-T-C p.Ile554Thr missense ANKLE1 1 82398 1.21362E-5 41199 0 NA
19-17396616-G-A p.Val555Met missense ANKLE1 1 82392 1.21371E-5 41196 0 NA
19-17396623-C-A p.Ala557Asp missense ANKLE1 24 82384 2.91319E-4 41192 0 0.00105149
19-17396624-C-T p.Ala557Ala synonymous ANKLE1 2 82376 2.42789E-5 41188 0 1.66814E-5
19-17396629-G-GGATCCAGACGCTCACCAACCAGAAGCAAGGGCACTGCTA c.1675+1_1675+2insGATCCAGACGCTCACCAACCAGAAGCAAGGGCACTGCTA splice_donor ANKLE1 2 82370 2.42807E-5 41185 1 NA
19-17397185-C-G c.1676-4C>G splice_region ANKLE1 1 78018 1.28176E-5 39009 0 9.27128E-6
19-17397198-C-T p.Thr562Met missense ANKLE1 5 78434 6.37479E-5 39217 0 7.99495E-5
19-17397199-G-A p.Arg490His missense ANKLE1 10 78458 1.27457E-4 39229 0 9.56023E-5
19-17397208-C-T p.Thr493Ile missense ANKLE1 5 78816 6.34389E-5 39408 0 1.27453E-4
19-17397214-G-A p.Ser495Asn missense ANKLE1 1 78894 1.26752E-5 39447 0 1.7853E-5
19-17397231-G-C p.Gly573Ala missense ANKLE1 1 79124 1.26384E-5 39562 0 NA
19-17397235-G-A p.Trp502* stop_gained ANKLE1 1 79130 1.26374E-5 39565 0 NA
19-17397239-G-T p.Ala576Ser missense ANKLE1 1 79114 1.264E-5 39557 0 1.22072E-5
19-17397244-C-T p.Ala505Val missense ANKLE1 12084 78740 0.153467 39370 1010 0.171837
19-17397255-C-G p.Ala581Gly missense ANKLE1 3 79290 3.78358E-5 39645 0 2.57697E-5
19-17397257-C-T p.Arg582Cys missense ANKLE1 1 79300 1.26103E-5 39650 0 8.60748E-6
19-17397258-G-A p.Arg582His missense ANKLE1 3 79286 3.78377E-5 39643 0 6.37471E-5
19-17397261-G-A p.Arg583His missense ANKLE1 2 79284 2.52258E-5 39642 0 3.18613E-5
19-17397263-C-T p.Arg584Trp missense ANKLE1 8 79376 1.00786E-4 39688 0 3.64845E-5
19-17397264-G-A p.Arg584Gln missense ANKLE1 3 79362 3.78015E-5 39681 1 7.78978E-5
19-17397266-C-T p.Arg585Cys missense ANKLE1 1 79368 1.25995E-5 39684 0 3.18613E-5
19-17397267-G-A p.Arg585His missense ANKLE1 3 79408 3.77796E-5 39704 0 9.55901E-5
19-17397267-G-C p.Arg585Pro missense ANKLE1 1 79408 1.25932E-5 39704 0 1.73433E-5
19-17397275-G-A p.Val588Met missense ANKLE1 1 79646 1.25556E-5 39823 0 8.7405E-6
19-17397277-G-A p.Cys516Tyr missense ANKLE1 5 79616 6.28014E-5 39808 0 4.05288E-6
19-17397283-GCTGCACCGTGCCCTCCTTGTCTTCCT-G p.Leu591fs frameshift ANKLE1 3 79884 3.75545E-5 39942 0 NA
19-17397288-A-AC p.Arg593fs frameshift ANKLE1 1 80042 1.24934E-5 40021 0 2.70246E-5
19-17397289-C-A p.His592Gln missense ANKLE1 3 80076 3.74644E-5 40038 0 4.53153E-5
19-17397290-C-T p.Arg593Cys missense ANKLE1 1 80148 1.24769E-5 40074 0 NA
19-17397291-G-A p.Arg593His missense ANKLE1 5 80180 6.23597E-5 40090 0 6.37471E-5
19-17397299-C-T p.Leu596Phe missense ANKLE1 1 80522 1.2419E-5 40261 0 1.88118E-5
19-17397301-T-G p.Leu524Trp missense ANKLE1 5 80528 6.20902E-5 40264 0 5.03525E-4
19-17397311-GCT-G p.Ala600fs frameshift ANKLE1 3 80584 3.72282E-5 40292 0 NA
19-17397315-AAGG-A p.Glu601_Gly602delinsAsp disruptive_inframe_deletion ANKLE1 3 80654 3.71959E-5 40327 0 NA
19-17397319-C-T p.Ala530Val missense ANKLE1 8 80590 9.92679E-5 40295 0 0.0020141
19-17397320-G-A p.Glu603Lys missense ANKLE1 12 80632 1.48824E-4 40316 0 1.91205E-4
19-17397324-G-A p.Arg604Gln missense ANKLE1 2 80668 2.4793E-5 40334 0 3.34777E-5
19-17397329-C-T p.Leu606Phe missense ANKLE1 1 80742 1.23851E-5 40371 0 1.23868E-5
19-17397333-A-C p.His607Pro missense ANKLE1 1 80778 1.23796E-5 40389 0 NA
19-17397353-C-G p.Arg614Gly missense ANKLE1 192 80696 0.0023793 40348 0 0.00539669
19-17397353-C-T p.Arg614Trp missense ANKLE1 20 80702 2.47825E-4 40351 0 9.55657E-4
19-17397354-G-A p.Arg614Gln missense ANKLE1 10 80686 1.23937E-4 40343 0 0.00100806
19-17397370-G-C p.Gly547Ala missense ANKLE1 1 80348 1.24459E-5 40174 0 NA
19-17397372-G-T p.Val548Phe missense ANKLE1 6 80248 7.47682E-5 40124 0 NA
19-17397375-G-A p.Gly549Ser missense ANKLE1 1 80264 1.24589E-5 40132 0 NA
19-17397381-C-A p.Pro551Thr missense ANKLE1 685 80072 0.0085548 40036 14 0.0161002
19-17397381-C-T p.Pro551Ser missense ANKLE1 1 80098 1.24847E-5 40049 0 6.32218E-5
19-17397384-G-T p.Ala552Ser missense ANKLE1 13 79984 1.62533E-4 39992 0 9.56084E-5
19-17397397-T-C p.Met556Thr missense ANKLE1 1 79396 1.25951E-5 39698 0 NA
19-17397398-G-A p.Met556Ile missense ANKLE1 1 79354 1.26018E-5 39677 0 1.68995E-5
19-17397416-C-T p.Cys562Cys synonymous ANKLE1 1 77804 1.28528E-5 38902 0 NA
19-17397420-A-G p.Met564Val missense ANKLE1 2 77542 2.57925E-5 38771 0 NA
19-17397427-C-G p.Thr566Arg missense ANKLE1 1 76542 1.30647E-5 38271 0 NA
19-17397435-C-G p.Pro569Ala missense ANKLE1 3 75078 3.99584E-5 37539 0 1.59714E-4
19-17397443-T-C p.Ser571Ser synonymous ANKLE1 1 73640 1.35796E-5 36820 0 3.19836E-5
19-17397446-T-C p.Gly572Gly synonymous ANKLE1 2 72464 2.75999E-5 36232 0 0.00107023
19-17397453-AGG-A p.Gly576fs frameshift ANKLE1 3 69684 4.30515E-5 34842 0 1.62177E-4
19-17397454-GGGGTGT-G p.Gly576_Val577del conservative_inframe_deletion ANKLE1 5 69456 7.1988E-5 34728 0 1.69193E-4
19-17397454-GGGGTGTGT-G p.Gly576fs frameshift ANKLE1 1 69456 1.43976E-5 34728 0 7.34657E-6
19-17397455-G-T p.Arg575Ser missense ANKLE1 2 69432 2.88052E-5 34716 0 8.93921E-5
19-17397456-GGTGTGTGTGTGTGTGTGT-G p.Val585_Cys590del conservative_inframe_deletion ANKLE1 391 68766 0.00568595 34383 57 0.0151243
19-17397456-GGTGTGT-G p.Val589_Cys590del conservative_inframe_deletion ANKLE1 162 69026 0.00234694 34513 7 0.00883187
19-17397456-GGTGTGTGT-G p.Cys588fs frameshift ANKLE1 201 69246 0.00290269 34623 2 0.0092908
19-17397456-GGTGTGTGTGTGTGTGTGTGT-G p.Cys584fs frameshift ANKLE1 892 67940 0.0131292 33970 91 0.0768194
19-17397456-GGTGT-G p.Leu591fs frameshift ANKLE1 718 68192 0.0105291 34096 15 0.0390106
19-17397456-GGTGTGTGTGTGTGT-G p.Cys586fs frameshift ANKLE1 20 69406 2.8816E-4 34703 1 NA
19-17397456-GGT-G p.Cys590fs frameshift ANKLE1 300 68040 0.00440917 34020 19 0.0398852
19-17397456-GGTGTGTGTGTGTGTGTGTGTGT-G p.Leu591fs frameshift ANKLE1 1 69420 1.44051E-5 34710 0 0.0333932
19-17397456-GGTGTGTGTGT-G p.Leu591fs frameshift ANKLE1 17 69384 2.45013E-4 34692 0 NA
19-17397456-GGTGTGTGTGTGT-G p.Val587_Cys590del conservative_inframe_deletion ANKLE1 96 69352 0.00138424 34676 2 0.00619271
19-17397456-G-GGT p.Leu591fs frameshift ANKLE1 19 69260 2.74329E-4 34630 1 0.00934154
19-17397456-G-T p.Gly576Cys missense ANKLE1 3 69420 4.32152E-5 34710 0 NA
19-17397456-G-GGTGT p.Leu591fs frameshift ANKLE1 22 69384 3.17076E-4 34692 0 NA
19-17397456-G-GGTGTGT p.Val589_Cys590dup conservative_inframe_insertion ANKLE1 2 69418 2.8811E-5 34709 0 NA
19-17397456-GGTGTGTGTGTGTGTGT-G p.Leu591fs frameshift ANKLE1 2 69416 2.88118E-5 34708 0 NA
19-17397456-G-GGTGTGTGT p.Leu591fs frameshift ANKLE1 1 69414 1.44063E-5 34707 0 NA
19-17397456-G-GGTGTGTGTGTGTGTGTGTGTGTTTGT p.Leu591fs frameshift ANKLE1 1 69420 1.44051E-5 34710 0 NA
19-17397456-G-GT p.Gly576fs frameshift ANKLE1 1 69420 1.44051E-5 34710 0 NA
19-17397458-T-G p.Gly576Gly synonymous ANKLE1 10 68086 1.46873E-4 34043 0 2.45658E-4
19-17397459-GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTT-G p.Cys584_Val597del disruptive_inframe_deletion ANKLE1 3 68814 4.35958E-5 34407 0 4.3399E-5
19-17397459-G-T p.Val577Leu missense ANKLE1 2 68812 2.90647E-5 34406 0 0.001002
19-17397461-G-C p.Val577Val synonymous ANKLE1 1 68616 1.45739E-5 34308 0 0.00421348
19-17397469-GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTT-G p.Cys588fs frameshift ANKLE1 3 65856 4.55539E-5 32928 0 0.014818
19-17397471-GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTT-G p.Cys588_Val597del disruptive_inframe_deletion ANKLE1 7 65030 1.07643E-4 32515 0 0.0114213
19-17397471-G-GTGTGTGTGTT p.Cys584fs frameshift ANKLE1 1 65036 1.53761E-5 32518 0 NA
19-17397471-G-GTGTGTGTT p.Leu591fs frameshift ANKLE1 1 65036 1.53761E-5 32518 0 2.0024E-4
19-17397473-GTGTGTGTGTGTGTGTGTGTGTGTGTGTT-G p.Val589fs frameshift ANKLE1 9 64186 1.40217E-4 32093 0 5.97991E-4
19-17397473-G-T p.Val581Val synonymous ANKLE1 3 64188 4.67377E-5 32094 0 1.19598E-4
19-17397475-G-T p.Cys582Phe missense ANKLE1 59 63220 9.33249E-4 31610 0 0.0186722
19-17397475-G-GTT p.Val583fs frameshift ANKLE1 1 63266 1.58063E-5 31633 0 4.09277E-5
19-17397475-G-GTGTT p.Leu591fs frameshift ANKLE1 9 63252 1.42288E-4 31626 0 0.0016605
19-17397475-GTGTGTGTGTGTGTGTGTGTGTGTGTT-G p.Cys590fs frameshift ANKLE1 2 63262 3.16146E-5 31631 0 0.00207469
19-17397475-G-GTGTGTT p.Val583_Cys584insPheVal disruptive_inframe_insertion ANKLE1 11 63230 1.73968E-4 31615 0 0.00341588
19-17397476-TG-T p.Val583fs frameshift ANKLE1 1 62882 1.59028E-5 31441 0 NA
19-17397477-G-T p.Val583Leu missense ANKLE1 99 61056 0.00162146 30528 1 0.0165542
19-17397477-G-GTGTT p.Cys584fs frameshift ANKLE1 90 61858 0.00145495 30929 0 0.0208213
19-17397477-GTG-TTT p.Val583Phe missense ANKLE1 2 62188 3.21605E-5 31094 0 NA
19-17397477-G-GTT p.Leu591fs frameshift ANKLE1 33 62220 5.30376E-4 31110 3 0.0104685
19-17397477-GTGTGTGTGTGTGTGTGTGTGTGTT-G p.Cys590_Val597del disruptive_inframe_deletion ANKLE1 1 62284 1.60555E-5 31142 0 5.78369E-5
19-17397478-TG-T p.Cys584fs frameshift ANKLE1 2 61814 3.23551E-5 30907 0 9.34579E-4
19-17397479-G-T p.Val583Val synonymous ANKLE1 5575 54708 0.101905 27354 77 0.258461
19-17397479-GTGTGTGTGTGTGTGTGTGTGTT-G p.Leu591fs frameshift ANKLE1 9 61000 1.47541E-4 30500 0 3.11391E-4
19-17397479-G-GTT p.Cys584fs frameshift ANKLE1 85 60736 0.0013995 30368 1 0.0126382
19-17397479-G-GTGTT p.Val585fs frameshift ANKLE1 1 61006 1.63918E-5 30503 0 NA
19-17397479-GTG-TTT p.ValCys583ValPhe missense ANKLE1 16 60908 2.62691E-4 30454 0 NA
19-17397479-GTGTG-TTTTT p.ValCysVal583ValPheLeu missense ANKLE1 6 60982 9.83897E-5 30491 0 NA
19-17397480-TGTGTGTGTGTGTGTGTGTGTTTGTGTG-T p.Cys584_Val593delinsLeu disruptive_inframe_deletion ANKLE1 1 60804 1.64463E-5 30402 0 NA
19-17397480-TGTG-T p.Cys584_Val585delinsLeu disruptive_inframe_deletion ANKLE1 1 60804 1.64463E-5 30402 0 NA
19-17397480-TGTGTGTGTGTGTGTGTGTGTTTG-T p.Cys584fs frameshift ANKLE1 1 60804 1.64463E-5 30402 0 NA
19-17397481-GTGTGTGTGTGTGTGTGTGTT-G p.Leu591fs frameshift ANKLE1 73 59758 0.00122159 29879 0 0.00293394
19-17397481-G-T p.Cys584Phe missense ANKLE1 6492 50476 0.128616 25238 67 0.328175
19-17397481-GTG-TTT p.CysVal584PheLeu missense ANKLE1 9 59728 1.50683E-4 29864 0 NA
19-17397481-G-GTT p.Val585fs frameshift ANKLE1 4 59826 6.68606E-5 29913 0 6.15181E-4
19-17397481-G-GTGTGTGTT p.Val587fs frameshift ANKLE1 1 59830 1.6714E-5 29915 0 NA
19-17397482-TG-T p.Val585fs frameshift ANKLE1 5 59704 8.37465E-5 29852 0 0.0108959
19-17397483-G-T p.Val585Leu missense ANKLE1 6894 52536 0.131224 26268 86 0.28434
19-17397483-GTGTGTGTGTGTGTGTGTT-G p.Leu591_Cys596del conservative_inframe_deletion ANKLE1 143 58562 0.00244186 29281 2 0.0115448
19-17397483-G-GTT p.Leu591fs frameshift ANKLE1 1 58774 1.70143E-5 29387 0 7.85361E-4
19-17397483-G-C p.Val585Leu missense ANKLE1 1 58786 1.70109E-5 29393 0 5.93824E-4
19-17397483-G-A p.Val585Met missense ANKLE1 1 58788 1.70103E-5 29394 0 NA
19-17397484-TGTGTGTG-T p.Cys586fs frameshift ANKLE1 6 58406 1.02729E-4 29203 0 0.0149007
19-17397484-TG-T p.Cys586fs frameshift ANKLE1 1 58410 1.71204E-5 29205 0 4.25894E-5
19-17397485-GTGTGTGTGTGTGTGTT-G p.Leu591fs frameshift ANKLE1 251 54622 0.00459522 27311 1 0.0410811
19-17397485-G-T p.Val585Val synonymous ANKLE1 39 57586 6.77248E-4 28793 0 0.00247988
19-17397485-G-GTGTGTGTGTGTGTGTT p.Cys596fs frameshift ANKLE1 1 57644 1.73479E-5 28822 0 NA
19-17397485-G-GTGTGTGTGTGTGTGTGTGTT p.Leu591fs frameshift ANKLE1 1 57644 1.73479E-5 28822 0 NA
19-17397485-G-GTGTGTGTGTGTGTGTGTGTGTT p.Leu591fs frameshift ANKLE1 1 57644 1.73479E-5 28822 0 NA
19-17397486-TG-T p.Cys586fs frameshift ANKLE1 1 56796 1.76069E-5 28398 0 NA
19-17397486-TGTGTG-T p.Cys586fs frameshift ANKLE1 1 56796 1.76069E-5 28398 0 2.85796E-5
19-17397487-GTGTGTGTGTGTGTT-G p.Leu591fs frameshift ANKLE1 3373 51938 0.0649428 25969 13 0.204941
19-17397487-G-GTT p.Val587fs frameshift ANKLE1 13 55998 2.32151E-4 27999 1 2.54691E-4
19-17397487-G-T p.Cys586Phe missense ANKLE1 4 55994 7.14362E-5 27997 0 7.64072E-4
19-17397488-TGTG-T p.Val587del conservative_inframe_deletion ANKLE1 1 53844 1.85722E-5 26922 0 NA
19-17397489-GTGTGTGTGTGTT-G p.Leu591_Cys594del conservative_inframe_deletion ANKLE1 59 53174 0.00110956 26587 1 0.00572738
19-17397489-G-T p.Val587Leu missense ANKLE1 25 53300 4.69043E-4 26650 0 6.69792E-4
19-17397491-G-T p.Val587Val synonymous ANKLE1 128 51146 0.00250264 25573 3 0.0100806
19-17397491-GTGTGTGTGTT-G p.Leu591fs frameshift ANKLE1 96 51722 0.00185608 25861 1 0.00956368
19-17397491-GTG-TTT p.ValCys587ValPhe missense ANKLE1 8 51906 1.54125E-4 25953 0 NA
19-17397493-G-T p.Cys588Phe missense ANKLE1 3098 48474 0.0639106 24237 36 0.0887875
19-17397493-GTGTGTGTT-G p.Leu591fs frameshift ANKLE1 375 49570 0.00756506 24785 14 0.0186908
19-17397493-GTG-TTT p.CysVal588PheLeu missense ANKLE1 1 50728 1.9713E-5 25364 0 NA
19-17397495-GTGTGTT-G p.Leu591_Cys592del conservative_inframe_deletion ANKLE1 1630 44840 0.0363515 22420 48 0.0943148
19-17397495-G-T p.Val589Leu missense ANKLE1 270 47596 0.00567275 23798 0 0.0790355
19-17397497-GTGTT-G p.Leu591fs frameshift ANKLE1 4141 40476 0.102308 20238 118 0.154972
19-17397497-G-T p.Val589Val synonymous ANKLE1 62 45436 0.00136456 22718 1 0.0119153
19-17397499-GTT-G p.Leu591fs frameshift ANKLE1 1944 34788 0.0558813 17394 47 0.145954
19-17397499-GTT-TTG p.CysLeu590PheVal missense ANKLE1 4 40210 9.94777E-5 20105 0 NA
19-17397500-T-TG p.Leu591fs frameshift ANKLE1 19 36788 5.16473E-4 18394 1 0.00227566
19-17397501-T-TTGTG p.Ter598fs frameshift ANKLE1 26 35746 7.27354E-4 17873 3 NA
19-17397501-T-G p.Leu591Val missense ANKLE1 4201 29638 0.141744 14819 162 0.25645
19-17397501-T-TTG p.Ter598fs frameshift ANKLE1 20 35704 5.60161E-4 17852 5 NA
19-17397501-T-TTGTGTGTGTGTGTGTGTGTG p.Ter598fs frameshift ANKLE1 27 35738 7.55498E-4 17869 8 NA
19-17397501-T-TTGTGTGTGTGTGTG p.Ter598fs frameshift ANKLE1 3 35750 8.39161E-5 17875 1 NA
19-17397501-T-TTGTGTGTGTGTGTGTG p.Ter598fs frameshift ANKLE1 8 35752 2.23764E-4 17876 2 NA
19-17397501-T-TTGTGTGTGTGTGTGTGTG p.Cys592_Val597dup disruptive_inframe_insertion ANKLE1 13 35748 3.63657E-4 17874 3 NA
19-17397501-TTG-T p.Ter598fs frameshift ANKLE1 2 35740 5.59597E-5 17870 0 NA
19-17397501-T-TGTG p.Leu591delinsCysVal disruptive_inframe_insertion ANKLE1 3 35754 8.39067E-5 17877 0 NA
19-17397501-T-TTGTGTG p.Cys596_Val597dup disruptive_inframe_insertion ANKLE1 2 35752 5.59409E-5 17876 1 NA
19-17397501-T-TG p.Leu591fs frameshift ANKLE1 7 35750 1.95804E-4 17875 0 NA
19-17397501-T-TTGTGTGTGTGTGTGTGTGTGTGTG p.Val597_Ter598insCysValCysValCysValCysVal disruptive_inframe_insertion ANKLE1 3 35752 8.39114E-5 17876 1 NA
19-17397501-T-TTGTGTGTGTGTGTGTGTGTGTG p.Ter598fs frameshift ANKLE1 4 35754 1.11876E-4 17877 1 NA
19-17397501-TTGTG-T p.Val597fs frameshift ANKLE1 1 35754 2.79689E-5 17877 0 NA
19-17397501-T-TTGTGTGTGTGTGTGTGTGTGTGTGTG p.Ter598fs frameshift ANKLE1 2 35752 5.59409E-5 17876 0 NA
19-17397501-T-TGTTTG p.Leu591fs frameshift ANKLE1 4 35740 1.11919E-4 17870 0 NA
19-17397501-T-TGTGTGTTTG p.Leu591delinsCysValPheVal disruptive_inframe_insertion ANKLE1 1 35754 2.79689E-5 17877 0 NA
19-17397501-T-TGTGTGTGTG p.Leu591delinsCysValCysVal disruptive_inframe_insertion ANKLE1 2 35754 5.59378E-5 17877 1 NA
19-17397662-G-A c.*301G>A splice_region ANKLE1 1 33210 3.01114E-5 16605 0 3.18796E-5