Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
5-139781419-G-T c.-134G>T 5_prime_UTR_premature_start_codon_gain ANKHD1 2 37484 5.33561E-5 18742 0 NA
5-139781459-C-T c.-94C>T 5_prime_UTR_premature_start_codon_gain ANKHD1 1 44500 2.24719E-5 22250 0 NA
5-139781484-C-G c.-69C>G 5_prime_UTR_premature_start_codon_gain ANKHD1 20 52960 3.77644E-4 26480 1 0.00187735
5-139781507-G-T c.-46G>T 5_prime_UTR_premature_start_codon_gain ANKHD1 89 59308 0.00150064 29654 0 0.00266794
5-139781523-C-T c.-30C>T 5_prime_UTR_premature_start_codon_gain ANKHD1 1 63732 1.56907E-5 31866 0 5.94106E-6
5-139781580-A-G p.Thr10Ala missense ANKHD1 1 69942 1.42976E-5 34971 0 NA
5-139781611-CTC-TTT p.AlaPro20ValSer missense ANKHD1 1 67862 1.47358E-5 33931 0 NA
5-139781614-C-T p.Pro21Leu missense ANKHD1 1 67356 1.48465E-5 33678 0 3.52518E-5
5-139781644-C-T p.Pro31Leu missense ANKHD1 4 62590 6.3908E-5 31295 0 8.07559E-6
5-139781645-G-T p.Pro31Pro synonymous ANKHD1 2 62496 3.2002E-5 31248 0 4.03493E-5
5-139781650-C-T p.Pro33Leu missense ANKHD1 1 62370 1.60333E-5 31185 0 2.50589E-5
5-139781654-G-A p.Pro34Pro synonymous ANKHD1 3 62420 4.80615E-5 31210 0 6.38814E-5
5-139781663-C-G p.Val37Val synonymous ANKHD1 1 61868 1.61634E-5 30934 0 NA
5-139781666-T-C p.Gly38Gly synonymous ANKHD1 1 61874 1.61619E-5 30937 0 NA
5-139781684-G-A p.Val44Val synonymous ANKHD1 3 62666 4.78729E-5 31333 0 3.19224E-5
5-139781693-T-C p.Phe47Phe synonymous ANKHD1 2 62664 3.19163E-5 31332 0 NA
5-139781704-G-C p.Gly51Ala missense ANKHD1 1 62732 1.59408E-5 31366 0 1.42976E-5
5-139781711-G-A p.Ala53Ala synonymous ANKHD1 1 63194 1.58243E-5 31597 0 NA
5-139781717-A-C p.Gly55Gly synonymous ANKHD1 3 63384 4.73306E-5 31692 0 3.19816E-5
5-139781719-TCGGCAGCAGCGGCGG-T p.Ser58_Gly62del conservative_inframe_deletion ANKHD1 1 63334 1.57893E-5 31667 0 NA
5-139781720-C-T p.Val56Val synonymous ANKHD1 1 63608 1.57213E-5 31804 0 NA
5-139781721-G-GGCA p.Ser59dup conservative_inframe_insertion ANKHD1 4 63766 6.27294E-5 31883 0 0.00157895
5-139781721-GGCA-G p.Ser59del conservative_inframe_deletion ANKHD1 1 63766 1.56823E-5 31883 0 6.21744E-6
5-139781727-A-AGCGGCG p.Gly62_Gly63dup conservative_inframe_insertion ANKHD1 2 64492 3.10116E-5 32246 0 2.8699E-4
5-139781727-A-AGCG p.Gly63dup conservative_inframe_insertion ANKHD1 25 64492 3.87645E-4 32246 0 3.97678E-4
5-139781727-AGCG-A p.Gly63del conservative_inframe_deletion ANKHD1 2 64446 3.10337E-5 32223 0 3.5791E-4
5-139781727-AGCGGCG-A p.Gly62_Gly63del conservative_inframe_deletion ANKHD1 1 64492 1.55058E-5 32246 0 5.96516E-5
5-139781730-G-A p.Gly60Ser missense ANKHD1 1 64170 1.55836E-5 32085 0 0.0089192
5-139781730-GGCGGCGGCGGCA-G p.Gly62_Gly65del conservative_inframe_deletion ANKHD1 3 64196 4.67319E-5 32098 0 1.00321E-4
5-139781734-G-A p.Gly61Asp missense ANKHD1 11 64772 1.69826E-4 32386 0 1.29149E-4
5-139781736-GGCGGCA-G p.Ser66_Gly67del disruptive_inframe_deletion ANKHD1 3 64734 4.63435E-5 32367 0 1.06011E-4
5-139781738-C-T p.Gly62Gly synonymous ANKHD1 1 64336 1.55434E-5 32168 0 0.00125
5-139781738-CGGCAGCGGCAGCGGT-C p.Gly63_Gly67del conservative_inframe_deletion ANKHD1 1 64336 1.55434E-5 32168 0 3.0921E-5
5-139781742-A-G p.Ser64Gly missense ANKHD1 8 64870 1.23324E-4 32435 0 0.00105152
5-139781743-G-C p.Ser64Thr missense ANKHD1 1 65050 1.53728E-5 32525 0 NA
5-139781747-C-CAGCGGT p.Ser66_Gly67dup disruptive_inframe_insertion ANKHD1 23 65184 3.52847E-4 32592 0 0.00219639
5-139781749-G-A p.Ser66Asn missense ANKHD1 1 65794 1.5199E-5 32897 0 NA
5-139781759-C-T p.Gly69Gly synonymous ANKHD1 6 67502 8.88863E-5 33751 0 6.31652E-5
5-139781761-G-T p.Gly70Val missense ANKHD1 4 68804 5.81362E-5 34402 0 NA
5-139781765-G-T p.Gly71Gly synonymous ANKHD1 4 69590 5.74795E-5 34795 0 1.06758E-4
5-139781768-C-T p.Asp72Asp synonymous ANKHD1 26 69722 3.7291E-4 34861 0 0.00659841
5-139781774-G-A p.Ala74Ala synonymous ANKHD1 1 71644 1.39579E-5 35822 0 NA
5-139781783-C-T p.Phe77Phe synonymous ANKHD1 1 73710 1.35667E-5 36855 0 NA
5-139781784-A-C p.Lys78Gln missense ANKHD1 2 73838 2.70863E-5 36919 0 7.91302E-6
5-139781792-G-A p.Ala80Ala synonymous ANKHD1 2 74638 2.6796E-5 37319 0 7.66166E-5
5-139781815-G-A p.Gly88Asp missense ANKHD1 11 76478 1.43832E-4 38239 0 1.88644E-4
5-139781822-T-G p.Gly90Gly synonymous ANKHD1 1 76684 1.30405E-5 38342 0 NA
5-139781828-C-G p.Ala92Ala synonymous ANKHD1 1 76922 1.30002E-5 38461 0 NA
5-139781836-G-A p.Ser95Asn missense ANKHD1 1 77070 1.29752E-5 38535 0 NA
5-139781846-C-G p.Asp98Glu missense ANKHD1 1 77058 1.29772E-5 38529 0 4.24439E-5
5-139781847-G-T p.Glu99* stop_gained ANKHD1 1 77120 1.29668E-5 38560 0 NA
5-139781855-C-T p.Ser101Ser synonymous ANKHD1 2 77124 2.59323E-5 38562 0 NA
5-139781864-G-A c.306+6G>A splice_region ANKHD1 2 77052 2.59565E-5 38526 0 0.00187735
5-139815730-A-C p.Pro116Pro synonymous ANKHD1 1 79914 1.25135E-5 39957 0 9.4146E-6
5-139815738-AAAC-A p.Thr121del conservative_inframe_deletion ANKHD1 3 80014 3.74934E-5 40007 0 3.1841E-5
5-139815739-A-G p.Lys119Lys synonymous ANKHD1 2 80008 2.49975E-5 40004 0 6.44176E-5
5-139815750-A-G p.Glu123Gly missense ANKHD1 1 80154 1.2476E-5 40077 0 7.20072E-5
5-139815760-A-G p.Leu126Leu synonymous ANKHD1 1 80190 1.24704E-5 40095 0 8.84111E-6
5-139815778-A-G p.Gly132Gly synonymous ANKHD1 13 80160 1.62176E-4 40080 0 3.18512E-5
5-139815780-C-G p.Ala133Gly missense ANKHD1 26 80154 3.24376E-4 40077 0 8.60256E-4
5-139815789-G-A p.Arg136His missense ANKHD1 1 80120 1.24813E-5 40060 0 3.18492E-5
5-139815801-C-G p.Pro140Arg missense ANKHD1 1 79872 1.252E-5 39936 0 4.27383E-6
5-139815803-G-C p.Glu141Gln missense ANKHD1 1 79850 1.25235E-5 39925 0 4.27434E-6
5-139815809-C-G p.Gln143Glu missense ANKHD1 403 79694 0.00505684 39847 2 0.00621762
5-139815811-G-A p.Gln143Gln synonymous ANKHD1 1 79682 1.25499E-5 39841 0 NA
5-139815813-CACG-C p.Arg145del disruptive_inframe_deletion ANKHD1 1 79672 1.25515E-5 39836 0 3.18492E-5
5-139815816-G-A p.Arg145Gln missense ANKHD1 2 79562 2.51376E-5 39781 0 9.02348E-6
5-139815826-A-G p.Ala148Ala synonymous ANKHD1 1 79172 1.26307E-5 39586 0 1.85472E-5
5-139818050-T-C p.Ile155Ile synonymous ANKHD1 1 81968 1.21999E-5 40984 0 NA
5-139818057-T-C p.Leu158Leu synonymous ANKHD1 1 82050 1.21877E-5 41025 0 8.33083E-6
5-139818063-A-G p.Thr160Ala missense ANKHD1 1 82196 1.2166E-5 41098 0 8.30606E-6
5-139818063-A-C p.Thr160Pro missense ANKHD1 1 82196 1.2166E-5 41098 0 NA
5-139818075-A-G p.Lys164Glu missense ANKHD1 2 82372 2.42801E-5 41186 0 NA
5-139818090-C-T p.Pro155Ser missense+splice_region ANKHD1 1 82528 1.21171E-5 41264 0 NA
5-139818095-G-A p.Glu170Glu synonymous ANKHD1 2 82568 2.42225E-5 41284 0 NA
5-139818103-G-A p.Arg173Gln missense ANKHD1 9 82680 1.08853E-4 41340 0 1.81318E-4
5-139818116-C-G p.Ser177Ser synonymous ANKHD1 2 82742 2.41715E-5 41371 0 NA
5-139818160-G-A p.Arg192Gln missense ANKHD1 8 82590 9.6864E-5 41295 0 1.59449E-4
5-139818164-G-A p.Met193Ile missense ANKHD1 1 82546 1.21145E-5 41273 0 4.94764E-5
5-139818174-A-G p.Asn197Asp missense ANKHD1 1 82318 1.2148E-5 41159 0 NA
5-139818189-G-A p.Gly202Arg missense ANKHD1 5 81982 6.0989E-5 40991 0 8.25328E-6
5-139818200-C-T p.Asp205Asp splice_region+synonymous ANKHD1 1 81384 1.22874E-5 40692 0 6.37146E-5
5-139819703-G-C c.618-1G>C splice_acceptor ANKHD1 2 79880 2.50376E-5 39940 0 NA
5-139819722-T-C p.Ala212Ala synonymous ANKHD1 2 80284 2.49116E-5 40142 0 8.24429E-6
5-139819730-A-C p.Asp215Ala missense ANKHD1 2 80342 2.48936E-5 40171 0 8.24171E-6
5-139819762-G-A p.Asp226Asn missense ANKHD1 1 80414 1.24356E-5 40207 0 8.23818E-5
5-139819787-A-G p.His234Arg missense ANKHD1 2 80400 2.48756E-5 40200 0 9.55353E-5
5-139819802-A-G p.Glu239Gly missense ANKHD1 1 80396 1.24384E-5 40198 0 NA
5-139819812-G-T p.Leu242Leu synonymous ANKHD1 55 80382 6.84233E-4 40191 0 0.00259336
5-139819813-T-C p.Cys243Arg missense ANKHD1 2 80372 2.48843E-5 40186 0 NA
5-139819830-A-G p.Ala248Ala synonymous ANKHD1 1 80348 1.24459E-5 40174 0 5.18672E-4
5-139819841-A-ATAAATTATATTAAATAT p.Glu252fs frameshift ANKHD1 1 80260 1.24595E-5 40130 0 NA
5-139819842-A-G p.Glu252Glu synonymous ANKHD1 1 80222 1.24654E-5 40111 0 4.1376E-6
5-139819853-T-TATTGCTTGCTATGCATGCTAATGTTGAAGATCGAGGGAATA c.765+2_765+3insATTGCTTGCTATGCATGCTAATGTTGAAGATCGAGGGAATA splice_region ANKHD1 4 80152 4.99052E-5 40076 2 NA
5-139820573-T-C c.766-7T>C splice_region ANKHD1 2 79810 2.50595E-5 39905 0 NA
5-139820579-G-A c.766-1G>A splice_acceptor ANKHD1 1 79882 1.25185E-5 39941 0 NA
5-139820589-G-A p.Ala259Thr missense ANKHD1 1 80072 1.24888E-5 40036 0 NA
5-139820603-T-G p.Asn263Lys missense ANKHD1 1 80202 1.24685E-5 40101 0 3.18593E-5
5-139820609-A-T p.Glu265Asp missense ANKHD1 1 80226 1.24648E-5 40113 0 NA
5-139820625-G-A p.Gly271Arg missense ANKHD1 7 80278 8.7197E-5 40139 0 0.005625
5-139820630-C-T p.Asp272Asp synonymous ANKHD1 1 80278 1.24567E-5 40139 0 3.18573E-5
5-139820639-C-T p.Pro275Pro synonymous ANKHD1 2 80304 2.49054E-5 40152 0 NA
5-139820672-T-C p.Asp286Asp synonymous ANKHD1 1 80238 1.24629E-5 40119 0 3.18674E-5
5-139820674-T-C p.Ile287Thr missense ANKHD1 1 80222 1.24654E-5 40111 0 NA
5-139820683-T-C p.Leu290Ser missense ANKHD1 1 80240 1.24626E-5 40120 0 8.37535E-6
5-139820688-C-A p.Leu292Ile missense ANKHD1 2 80214 2.49333E-5 40107 0 NA
5-139820710-A-G p.Asn299Ser missense ANKHD1 2 80088 2.49725E-5 40044 0 3.43699E-5
5-139820714-C-G p.Ser300Ser synonymous ANKHD1 2 79910 2.50282E-5 39955 0 NA
5-139820727-G-A p.Gly305Arg missense+splice_region ANKHD1 1 79684 1.25496E-5 39842 0 9.13993E-6
5-139825319-C-A c.914-8C>A splice_region ANKHD1 1 77208 1.2952E-5 38604 0 NA
5-139825337-G-A p.Ala308Ala synonymous ANKHD1 5 78748 6.34937E-5 39374 0 5.18135E-4
5-139825374-G-A p.Val321Ile missense ANKHD1 5 79994 6.25047E-5 39997 0 4.13483E-5
5-139825382-G-C p.Val323Val synonymous ANKHD1 1 79998 1.25003E-5 39999 0 8.26515E-6
5-139825385-C-G p.Leu324Leu synonymous ANKHD1 1 80026 1.24959E-5 40013 0 4.02327E-6
5-139825388-T-A p.Leu325Leu synonymous ANKHD1 4 80040 4.9975E-5 40020 0 3.62022E-5
5-139825395-G-A p.Gly328Ser missense ANKHD1 1 80056 1.24913E-5 40028 0 NA
5-139825397-T-C p.Gly328Gly synonymous ANKHD1 1 80058 1.24909E-5 40029 0 NA
5-139825424-T-C p.Asn337Asn synonymous ANKHD1 2 80170 2.4947E-5 40085 0 1.64959E-5
5-139825505-C-A p.Ile364Ile synonymous ANKHD1 4 80142 4.99114E-5 40071 0 6.37714E-5
5-139825507-A-G p.Asn365Ser missense ANKHD1 1 80142 1.24779E-5 40071 0 NA
5-139825539-C-T p.Leu376Leu synonymous ANKHD1 3 79684 3.76487E-5 39842 0 NA
5-139825550-T-C p.Ala379Ala synonymous ANKHD1 11 79280 1.38749E-4 39640 0 9.55657E-5
5-139825550-T-G p.Ala379Ala synonymous ANKHD1 2 79280 2.5227E-5 39640 0 NA
5-139825556-C-T p.Tyr381Tyr synonymous ANKHD1 1 79140 1.26358E-5 39570 0 6.25E-4
5-139825563-A-G c.1147+3A>G splice_region ANKHD1 2 78704 2.54117E-5 39352 0 6.25E-4
5-139825566-T-TA c.1147+6_1147+7insA splice_region ANKHD1 1 78766 1.26958E-5 39383 0 NA
5-139825567-A-C c.1147+7A>C splice_region ANKHD1 8 78760 1.01574E-4 39380 0 9.55657E-5
5-139828793-A-G c.1148-3A>G splice_region ANKHD1 1 79734 1.25417E-5 39867 0 4.13131E-6
5-139828797-C-T p.Gly383Gly splice_region+synonymous ANKHD1 27 79756 3.38533E-4 39878 0 0.00311526
5-139828806-T-C p.Asp386Asp synonymous ANKHD1 2 79830 2.50532E-5 39915 0 1.09471E-5
5-139828814-G-A p.Arg389His missense ANKHD1 49 79854 6.1362E-4 39927 0 0.00181644
5-139828842-A-G p.Gln398Gln synonymous ANKHD1 1 79960 1.25063E-5 39980 0 4.01939E-6
5-139828869-T-A p.Thr407Thr synonymous ANKHD1 1 79930 1.25109E-5 39965 0 NA
5-139838205-T-C c.1243-5T>C splice_region ANKHD1 2 78354 2.55252E-5 39177 0 3.18857E-5
5-139838230-A-G p.Ala421Ala synonymous ANKHD1 2 78956 2.53306E-5 39478 0 3.19326E-5
5-139838231-C-T p.Arg422Cys missense ANKHD1 2 78968 2.53267E-5 39484 0 NA
5-139838232-G-A p.Arg422His missense ANKHD1 3 78990 3.79795E-5 39495 0 3.20041E-5
5-139838251-T-G p.Gly428Gly synonymous ANKHD1 1 79636 1.25571E-5 39818 0 2.02468E-5
5-139838269-T-G p.Pro434Pro synonymous ANKHD1 1 79818 1.25285E-5 39909 0 4.0331E-6
5-139838272-A-G p.Ala435Ala synonymous ANKHD1 1 79864 1.25213E-5 39932 0 NA
5-139838290-A-G p.Pro441Pro synonymous ANKHD1 3 79970 3.75141E-5 39985 0 3.20533E-5
5-139838296-G-T p.Thr443Thr synonymous ANKHD1 17 80020 2.12447E-4 40010 0 0.001875
5-139838314-A-T p.Gly449Gly synonymous ANKHD1 1 80112 1.24825E-5 40056 0 4.02055E-6
5-139838323-A-G p.Glu452Glu synonymous ANKHD1 6 80140 7.4869E-5 40070 0 5.18135E-4
5-139838335-A-G p.Leu456Leu synonymous ANKHD1 1 80158 1.24754E-5 40079 0 NA
5-139838339-A-C p.Ile458Leu missense ANKHD1 2 80168 2.49476E-5 40084 0 8.25532E-6
5-139838340-T-C p.Ile458Thr missense ANKHD1 2 80176 2.49451E-5 40088 0 1.65079E-5
5-139838356-T-C p.Asn463Asn synonymous ANKHD1 1 80210 1.24673E-5 40105 0 4.01978E-6
5-139838357-C-T p.Leu464Phe missense ANKHD1 1 80210 1.24673E-5 40105 0 3.21582E-5
5-139838377-A-G p.Glu470Glu synonymous ANKHD1 3 80232 3.73916E-5 40116 0 4.01819E-6
5-139838387-C-T p.Pro474Ser missense ANKHD1 5 80232 6.23193E-5 40116 0 3.21295E-5
5-139838394-T-C p.Met476Thr missense ANKHD1 1 80236 1.24632E-5 40118 0 NA
5-139838404-C-G p.Ala479Ala synonymous ANKHD1 4 80226 4.98591E-5 40113 0 6.47375E-5
5-139838415-A-G p.His483Arg missense ANKHD1 1 80210 1.24673E-5 40105 0 3.23102E-5
5-139838756-T-C p.Asn496Asn synonymous ANKHD1 39 79370 4.9137E-4 39685 0 2.25399E-4
5-139838790-G-C p.Ala508Pro missense ANKHD1 1 79890 1.25172E-5 39945 0 NA
5-139838796-A-T p.Thr510Ser missense ANKHD1 1 79934 1.25103E-5 39967 0 3.2113E-5
5-139838798-T-G p.Thr510Thr synonymous ANKHD1 1 79960 1.25063E-5 39980 0 8.33056E-6
5-139838853-G-T p.Ala4Ser missense ANKHD1 1 79990 1.25016E-5 39995 0 8.24892E-6
5-139838858-T-C p.Asp5Asp synonymous ANKHD1 24 79984 3.0006E-4 39992 0 6.25E-4
5-139838860-T-C p.Ile6Thr missense ANKHD1 4 79988 5.00075E-5 39994 0 6.25E-4
5-139838886-A-G p.Met15Val missense ANKHD1 1 79738 1.25411E-5 39869 0 NA
5-139838901-G-GGTAATTTATCATCA p.Glu20fs frameshift ANKHD1 1 79482 1.25815E-5 39741 0 NA
5-139838918-G-A p.Leu25Leu synonymous ANKHD1 3 79070 3.79411E-5 39535 0 3.19366E-5
5-139838944-T-G c.97+4T>G splice_region ANKHD1 9 78608 1.14492E-4 39304 0 0.00375469
5-139838945-G-GTGGCTTTAAGA c.97+5_97+6insTGGCTTTAAGA splice_region ANKHD1 1 78544 1.27317E-5 39272 0 NA
5-139838948-G-T c.97+8G>T splice_region ANKHD1 2 78402 2.55096E-5 39201 0 NA
5-139844253-C-T p.Gly33Gly splice_region+synonymous ANKHD1 7 78868 8.87559E-5 39434 0 3.18674E-5
5-139844286-C-T p.Asp44Asp synonymous ANKHD1 1 79802 1.2531E-5 39901 0 4.02765E-6
5-139844291-C-T p.Ala46Val missense ANKHD1 1 79944 1.25088E-5 39972 0 NA
5-139844301-T-C p.Tyr49Tyr synonymous ANKHD1 2 79970 2.50094E-5 39985 0 1.64951E-5
5-139844302-G-A p.Ala50Thr missense ANKHD1 1 79968 1.2505E-5 39984 0 4.01926E-6
5-139844322-G-A p.Thr56Thr synonymous ANKHD1 3 80054 3.74747E-5 40027 0 4.82528E-5
5-139844328-T-A p.Val58Val synonymous ANKHD1 1 80028 1.24956E-5 40014 0 1.65262E-5
5-139851819-C-T c.208-5C>T splice_region ANKHD1 4 82978 4.82055E-5 41489 0 2.48769E-5
5-139851820-G-A c.208-4G>A splice_region ANKHD1 4 82972 4.8209E-5 41486 0 3.67155E-5
5-139851824-G-A p.Asp70Asn missense+splice_region ANKHD1 2 83002 2.40958E-5 41501 0 NA
5-139851841-G-T p.Met75Ile missense ANKHD1 1 83122 1.20305E-5 41561 0 4.02791E-6
5-139851858-G-A p.Gly81Asp missense ANKHD1 1 83168 1.20239E-5 41584 0 NA
5-139851860-A-G p.Ile82Val missense ANKHD1 4 83178 4.80896E-5 41589 0 1.20544E-5
5-139851861-T-C p.Ile82Thr missense ANKHD1 2 83182 2.40437E-5 41591 0 NA
5-139851867-C-T p.Pro84Leu missense ANKHD1 2 83188 2.40419E-5 41594 0 9.55901E-5
5-139851868-G-A p.Pro84Pro synonymous ANKHD1 2 83186 2.40425E-5 41593 0 1.206E-5
5-139851869-G-A p.Ala85Thr missense ANKHD1 3 83182 3.60655E-5 41591 0 NA
5-139851876-A-G p.His87Arg missense ANKHD1 1 83200 1.20192E-5 41600 0 2.48567E-5
5-139851910-A-G p.Leu612Leu synonymous ANKHD1 1 83158 1.20253E-5 41579 0 NA
5-139851914-C-T p.Arg614Cys missense ANKHD1 2 83152 2.40523E-5 41576 0 5.27426E-5
5-139851915-G-A p.Arg614His missense ANKHD1 15 83154 1.80388E-4 41577 0 6.36983E-5
5-139851922-A-T p.Glu616Asp missense ANKHD1 1 83130 1.20294E-5 41565 0 3.18451E-5
5-139851923-T-C p.Ter617Glnext*? stop_lost ANKHD1 4 83126 4.81197E-5 41563 0 6.37064E-5
5-139862197-G-A p.Leu99Leu synonymous ANKHD1 1 83068 1.20383E-5 41534 0 1.19693E-5
5-139862226-G-A p.Cys109Tyr missense ANKHD1 1 83004 1.20476E-5 41502 0 NA
5-139862229-CTG-C p.Val111fs frameshift ANKHD1 1 82988 1.20499E-5 41494 0 NA
5-139862230-T-C p.Thr110Thr synonymous ANKHD1 2 82968 2.41057E-5 41484 0 NA
5-139862247-G-A p.Ser116Asn missense ANKHD1 2 82860 2.41371E-5 41430 0 NA
5-139862254-TAAAG-T c.352+3_352+6delAAAG splice_region ANKHD1 1 82796 1.20779E-5 41398 0 3.19142E-5
5-139862258-G-A c.352+6G>A splice_region ANKHD1 2 82776 2.41616E-5 41388 0 3.19509E-5
5-139862259-A-G c.352+7A>G splice_region ANKHD1 1 82746 1.20852E-5 41373 0 4.02745E-6
5-139864701-C-T c.353-5C>T splice_region ANKHD1 1 80084 1.24869E-5 40042 0 NA
5-139864712-A-G p.Asn120Ser missense ANKHD1 3 80092 3.74569E-5 40046 0 6.36983E-5
5-139864747-G-A p.Val132Ile missense ANKHD1 1 80036 1.24944E-5 40018 0 NA
5-139864755-G-A p.Ser134Ser synonymous ANKHD1 1 79972 1.25044E-5 39986 0 8.24865E-6
5-139864776-C-T p.His141His synonymous ANKHD1 2 79996 2.50013E-5 39998 0 8.25341E-6
5-139864782-A-T p.Ala143Ala synonymous ANKHD1 4 79998 5.00013E-5 39999 0 3.30218E-5
5-139864834-G-GATGGTTCAACAATGCTCATTGAAGCTGCAAAGGGTGGCCA c.480+1_480+2insATGGTTCAACAATGCTCATTGAAGCTGCAAAGGGTGGCCA splice_donor ANKHD1 2 79824 2.50551E-5 39912 1 NA
5-139864834-G-GA c.480+1_480+2insA splice_donor ANKHD1 5 79828 6.26347E-5 39914 2 NA
5-139865205-A-G p.Lys171Arg missense ANKHD1 1 80296 1.24539E-5 40148 0 1.08504E-4
5-139865207-G-T p.Gly172Cys missense ANKHD1 1 80296 1.24539E-5 40148 0 4.01823E-6
5-139865212-C-T p.Gly173Gly synonymous ANKHD1 1 80304 1.24527E-5 40152 0 4.0181E-6
5-139865258-C-T p.Leu189Leu synonymous ANKHD1 1 80340 1.24471E-5 40170 0 NA
5-139865268-C-T p.Pro192Leu missense ANKHD1 1 80314 1.24511E-5 40157 0 NA
5-139865302-T-C p.Ser203Ser synonymous ANKHD1 1 80202 1.24685E-5 40101 0 NA
5-139866540-T-C c.2143-3T>C splice_region ANKHD1 5 80144 6.23877E-5 40072 0 1.59246E-4
5-139866542-G-A c.2143-1G>A splice_acceptor ANKHD1 4 80172 4.98927E-5 40086 0 1.54566E-4
5-139866544-T-C p.Val715Ala missense+splice_region ANKHD1 1 80192 1.24701E-5 40096 0 3.18552E-5
5-139866560-G-A p.Thr720Thr synonymous ANKHD1 1 80298 1.24536E-5 40149 0 6.37552E-5
5-139866562-A-G p.His721Arg missense ANKHD1 1 80304 1.24527E-5 40152 0 3.18573E-5
5-139866573-A-G p.Met725Val missense ANKHD1 1 80308 1.24521E-5 40154 0 2.47602E-5
5-139866610-A-G p.Gln215Arg missense ANKHD1 1 80314 1.24511E-5 40157 0 1.65166E-5
5-139866612-G-A p.Glu216Lys missense ANKHD1 2 80304 2.49054E-5 40152 0 1.20564E-5
5-139866618-T-G p.Ser218Ala missense ANKHD1 10 80298 1.24536E-4 40149 0 6.25E-4
5-139866625-C-T p.Ala220Val missense ANKHD1 2 80294 2.49085E-5 40147 0 NA
5-139866636-G-A p.Val224Met missense ANKHD1 1 80248 1.24614E-5 40124 0 3.19448E-5
5-139866637-T-G p.Val224Gly missense ANKHD1 1 80236 1.24632E-5 40118 0 NA
5-139866638-G-A p.Val224Val synonymous ANKHD1 1 80224 1.24651E-5 40112 0 3.20369E-5
5-139876097-G-T c.2246-8G>T splice_region ANKHD1 1 70942 1.4096E-5 35471 0 6.33577E-6
5-139876117-A-G p.Gln753Arg missense ANKHD1 1 78968 1.26634E-5 39484 0 NA
5-139876126-G-A p.Ser756Asn missense ANKHD1 1 79566 1.25682E-5 39783 0 NA
5-139876132-T-G p.Leu758Arg missense ANKHD1 1 79756 1.25382E-5 39878 0 NA
5-139876144-A-C p.Asp762Ala missense ANKHD1 9 80022 1.12469E-4 40011 0 2.64323E-4
5-139876149-G-A p.Asp764Asn missense ANKHD1 5 80094 6.24266E-5 40047 0 6.53083E-5
5-139876156-TG-CT p.Leu766Pro missense ANKHD1 3 80162 3.74242E-5 40081 0 NA
5-139876158-C-T p.Pro767Ser missense ANKHD1 1 80174 1.24729E-5 40087 0 1.65829E-5
5-139876167-C-G p.His770Asp missense ANKHD1 1 80214 1.24667E-5 40107 0 NA
5-139876180-C-T p.Pro774Leu missense ANKHD1 1 80264 1.24589E-5 40132 0 NA
5-139876187-G-A p.Glu776Glu synonymous ANKHD1 1 80278 1.24567E-5 40139 0 4.01823E-6
5-139876190-C-T p.Cys777Cys synonymous ANKHD1 2 80278 2.49134E-5 40139 0 4.01774E-6
5-139876233-AG-A p.Arg792fs frameshift ANKHD1 1 80258 1.24598E-5 40129 0 NA
5-139876245-A-G p.Ile796Val missense ANKHD1 2 80202 2.4937E-5 40101 0 NA
5-139876290-C-A p.Pro811Thr missense ANKHD1 3 80034 3.74841E-5 40017 0 8.28816E-6
5-139876316-A-T p.Glu819Asp missense ANKHD1 1 79890 1.25172E-5 39945 0 4.0373E-6
5-139876325-G-C p.Lys822Asn missense ANKHD1 1 79818 1.25285E-5 39909 0 1.21179E-5
5-139876328-C-G p.Asn823Lys missense ANKHD1 3 79818 3.75855E-5 39909 0 NA
5-139876352-G-A p.Lys831Lys synonymous ANKHD1 3 79720 3.76317E-5 39860 0 2.49356E-5
5-139876379-A-G p.Lys840Lys synonymous ANKHD1 2 79770 2.50721E-5 39885 0 5.8126E-5
5-139876390-A-G p.Gln844Arg missense ANKHD1 1 79768 1.25364E-5 39884 0 NA
5-139876397-G-A p.Gln846Gln synonymous ANKHD1 5 79772 6.26786E-5 39886 0 8.29242E-6
5-139876404-A-G p.Thr849Ala missense ANKHD1 2 79780 2.50689E-5 39890 0 0.0025
5-139876415-A-G p.Gln852Gln synonymous ANKHD1 3 79770 3.76081E-5 39885 0 1.65717E-5
5-139876427-A-G p.Glu856Glu synonymous ANKHD1 1 79808 1.25301E-5 39904 0 NA
5-139876438-C-A p.Thr860Asn missense ANKHD1 1 79798 1.25316E-5 39899 0 NA
5-139876458-G-A p.Val867Met missense ANKHD1 1 79782 1.25342E-5 39891 0 NA
5-139876466-A-G p.Leu869Leu synonymous ANKHD1 1 79756 1.25382E-5 39878 0 NA
5-139876471-A-G p.Gln871Arg missense ANKHD1 1 79744 1.25401E-5 39872 0 NA
5-139876483-A-G p.His875Arg missense ANKHD1 9 79744 1.12861E-4 39872 0 4.02346E-5
5-139876484-T-C p.His875His synonymous ANKHD1 17 79754 2.13155E-4 39877 0 3.82385E-4
5-139876485-A-G p.Arg876Gly missense ANKHD1 1 79758 1.25379E-5 39879 0 8.25996E-6
5-139876488-G-C p.Gly877Arg missense ANKHD1 1 79788 1.25332E-5 39894 0 8.25818E-6
5-139876492-T-A p.Val878Asp missense ANKHD1 2 79778 2.50696E-5 39889 0 4.12807E-5
5-139876493-C-T p.Val878Val synonymous ANKHD1 3 79788 3.75996E-5 39894 0 1.65101E-5
5-139876514-T-C p.Asp885Asp synonymous ANKHD1 5 79856 6.26127E-5 39928 0 2.47386E-5
5-139876516-G-A p.Gly886Asp missense ANKHD1 1 79862 1.25216E-5 39931 0 1.07195E-4
5-139876531-AT-A p.His892fs frameshift ANKHD1 3 79928 3.75338E-5 39964 0 2.47235E-5
5-139876533-C-G p.His892Asp missense ANKHD1 3 79934 3.7531E-5 39967 0 2.47219E-5
5-139876536-TTTTCAGAGTTA-T p.Phe893fs frameshift ANKHD1 3 79942 3.75272E-5 39971 0 2.47219E-5
5-139876551-C-A p.Gln898Lys missense ANKHD1 2 80000 2.5E-5 40000 0 NA
5-139876560-A-C p.Thr901Pro missense ANKHD1 1 80060 1.24906E-5 40030 0 5.6266E-5
5-139876582-A-G p.Asp908Gly missense ANKHD1 1 80208 1.24676E-5 40104 0 4.41991E-5
5-139876592-T-C p.Asp911Asp synonymous ANKHD1 2 80272 2.49153E-5 40136 0 NA
5-139876601-G-T p.Gln914His missense ANKHD1 4 80296 4.98157E-5 40148 0 3.29522E-5
5-139876604-T-C p.Ser915Ser synonymous ANKHD1 12 80316 1.4941E-4 40158 0 5.18135E-4
5-139876612-C-T p.Ser918Leu missense ANKHD1 5 80342 6.2234E-5 40171 0 1.91083E-4
5-139876621-A-G p.Gln921Arg missense ANKHD1 1 80356 1.24446E-5 40178 0 1.60707E-5
5-139876636-C-A p.Pro926Gln missense ANKHD1 1 80376 1.24415E-5 40188 0 3.18512E-5
5-139876662-T-G p.Cys935Gly missense ANKHD1 1 80374 1.24418E-5 40187 0 6.46877E-4
5-139876684-G-C p.Gly942Ala missense ANKHD1 4 80334 4.97921E-5 40167 0 6.09857E-4
5-139876709-A-G p.Glu950Glu synonymous ANKHD1 2 80262 2.49184E-5 40131 0 8.0349E-6
5-139876716-A-C p.Lys953Gln missense ANKHD1 7 80246 8.72318E-5 40123 0 3.18492E-5
5-139876775-T-G p.Asp972Glu missense ANKHD1 1 80080 1.24875E-5 40040 0 NA
5-139876781-G-T p.Gly974Gly synonymous ANKHD1 2 79996 2.50013E-5 39998 0 2.42273E-5
5-139876785-T-C p.Leu976Leu synonymous ANKHD1 1 79932 1.25106E-5 39966 0 8.35659E-6
5-139876794-G-A p.Glu979Lys missense ANKHD1 2 79736 2.50828E-5 39868 0 3.18552E-5
5-139876810-T-C p.Met984Thr missense ANKHD1 1 79326 1.26062E-5 39663 0 NA
5-139876819-C-T p.Thr987Ile missense ANKHD1 1 79042 1.26515E-5 39521 0 5.18135E-4
5-139876831-C-T p.Thr991Met missense ANKHD1 1 78722 1.27029E-5 39361 0 6.00931E-5
5-139876836-A-C p.Thr993Pro missense ANKHD1 3 78616 3.81602E-5 39308 0 NA
5-139884422-G-C p.Val232Val synonymous ANKHD1 1 80266 1.24586E-5 40133 0 3.18471E-5
5-139884427-C-G p.Thr234Ser missense ANKHD1 12 80264 1.49507E-4 40132 0 5.18135E-4
5-139884439-GTTC-G p.Ser240del conservative_inframe_deletion ANKHD1 1 80282 1.24561E-5 40141 0 NA
5-139884459-T-C p.Cys245Arg missense ANKHD1 1 80294 1.24542E-5 40147 0 4.01784E-6
5-139884478-G-C p.Cys251Ser missense ANKHD1 29 80292 3.61182E-4 40146 0 0.00138595
5-139884482-G-A p.Ser252Ser synonymous ANKHD1 5 80280 6.2282E-5 40140 0 2.22902E-4
5-139884533-A-T p.Ser269Ser synonymous ANKHD1 2 80186 2.4942E-5 40093 0 NA
5-139884533-A-G p.Ser269Ser synonymous ANKHD1 6 80186 7.4826E-5 40093 0 9.06573E-5
5-139884551-T-TACTGAGAGCAATCATGACACAGCATTAACACTAGCTTGTGCAG c.825_825+1insACTGAGAGCAATCATGACACAGCATTAACACTAGCTTGTGCAG splice_donor ANKHD1 5 80138 6.23924E-5 40069 2 NA
5-139884551-TGTGAGTAGATTGCTTTATTTAAACTTATTTTGCACATTCTGATCTTCTTTGGAAAGGAAAATTATTCTGCATTTATTGTGAAAAGAAATATTATTTGCTCTTAAATTGATAACTTCTGTTAAAAAAAATTTTAACTTATTTTTTTCTTCTCCTAG-T c.825+1_826-1del splice_acceptor ANKHD1 1 80138 1.24785E-5 40069 0 NA
5-139884556-G-A c.825+5G>A splice_region ANKHD1 1 80124 1.24807E-5 40062 0 NA
5-139884699-TCTC-T c.826-7_826-5delCTC splice_region ANKHD1 1 79654 1.25543E-5 39827 0 2.09901E-5
5-139884717-A-G p.Asn279Ser missense ANKHD1 1 79696 1.25477E-5 39848 0 8.29641E-6
5-139884724-C-T p.Asp281Asp synonymous ANKHD1 2 79688 2.50979E-5 39844 0 3.18532E-5
5-139884752-G-A p.Gly291Ser missense ANKHD1 1 79800 1.25313E-5 39900 0 NA
5-139884762-A-C p.Glu294Ala missense ANKHD1 1 79850 1.25235E-5 39925 0 8.27363E-6
5-139884768-TA-CT p.Val296Ala missense ANKHD1 1 79906 1.25147E-5 39953 0 NA
5-139884778-C-T p.Leu299Leu synonymous ANKHD1 6 79966 7.50319E-5 39983 0 1.91083E-4
5-139884782-G-A p.Ala301Thr missense ANKHD1 1 79992 1.25013E-5 39996 0 NA
5-139884784-A-G p.Ala301Ala synonymous ANKHD1 1 79990 1.25016E-5 39995 0 NA
5-139885325-C-A p.Ile318Ile synonymous ANKHD1 1 80238 1.24629E-5 40119 0 3.18431E-5
5-139885334-A-T p.Ala321Ala synonymous ANKHD1 1 80266 1.24586E-5 40133 0 8.22044E-6
5-139885343-G-T p.Gly324Gly synonymous ANKHD1 1 80276 1.2457E-5 40138 0 NA
5-139885378-G-A p.Gly336Asp missense ANKHD1 1 80302 1.2453E-5 40151 0 NA
5-139885385-T-C p.Asp338Asp synonymous ANKHD1 2 80302 2.4906E-5 40151 0 4.03672E-6
5-139885405-G-A p.Arg345Gln missense ANKHD1 1 80270 1.2458E-5 40135 0 4.09524E-6
5-139885421-G-A p.Pro350Pro synonymous ANKHD1 9 80238 1.12166E-4 40119 0 1.27413E-4
5-139885430-G-A p.Leu353Leu synonymous ANKHD1 2 80242 2.49246E-5 40121 0 NA
5-139885433-A-G p.Ala354Ala synonymous ANKHD1 5 80252 6.23037E-5 40126 0 1.30312E-5
5-139885446-C-A p.Arg359Ser missense ANKHD1 1 80250 1.24611E-5 40125 0 3.18512E-5
5-139885446-C-T p.Arg359Cys missense ANKHD1 1 80250 1.24611E-5 40125 0 NA
5-139885457-G-GGTAGACTTGCTGCTGGCTCGAGGTGCAAATAAAGAACATAGGAACGTATCTGAT c.1083+3_1083+4insGTAGACTTGCTGCTGGCTCGAGGTGCAAATAAAGAACATAGGAACGTATCTGAT splice_region ANKHD1 2 80202 2.4937E-5 40101 1 NA
5-139885457-G-GGTAGACTTGCTGCTGGCTCGAGGTGCAAATAAAGAACATAGGAACGTATC c.1083+3_1083+4insGTAGACTTGCTGCTGGCTCGAGGTGCAAATAAAGAACATAGGAACGTATC splice_region ANKHD1 4 80200 4.98753E-5 40100 2 NA
5-139885457-GTGTTAA-G c.1083+4_1083+9delTGTTAA splice_region ANKHD1 1 80202 1.24685E-5 40101 0 NA
5-139886439-C-G p.Ala368Gly missense ANKHD1 1 80302 1.2453E-5 40151 0 NA
5-139886467-C-T p.Asn377Asn synonymous ANKHD1 9 80324 1.12046E-4 40162 0 1.27429E-4
5-139886468-G-A p.Val378Ile missense ANKHD1 1 80336 1.24477E-5 40168 0 2.00856E-5
5-139886479-T-C p.Tyr381Tyr synonymous ANKHD1 1 80344 1.24465E-5 40172 0 NA
5-139886493-T-TA p.Ala387fs frameshift ANKHD1 1 80336 1.24477E-5 40168 0 NA
5-139886494-A-G p.Leu386Leu synonymous ANKHD1 1 80336 1.24477E-5 40168 0 NA
5-139886500-G-A p.Ala388Ala synonymous ANKHD1 15 80336 1.86716E-4 40168 0 4.13986E-4
5-139886509-A-T p.Gly391Gly synonymous ANKHD1 1 80334 1.2448E-5 40167 0 NA
5-139886512-T-C p.Tyr392Tyr synonymous ANKHD1 1 80338 1.24474E-5 40169 0 3.29484E-5
5-139886531-C-G p.Leu399Val missense ANKHD1 1 80336 1.24477E-5 40168 0 NA
5-139886536-T-C p.Leu400Leu synonymous ANKHD1 10 80338 1.24474E-4 40169 0 1.59246E-4
5-139887385-A-G p.Leu414Leu synonymous ANKHD1 1 80432 1.24329E-5 40216 0 3.18451E-5
5-139887448-C-T p.Leu435Leu synonymous ANKHD1 1 80420 1.24347E-5 40210 0 6.37105E-5
5-139887449-G-A p.Asp436Asn missense ANKHD1 2 80416 2.48707E-5 40208 0 4.01581E-6
5-139887455-G-A p.Gly438Ser missense ANKHD1 1 80410 1.24363E-5 40205 0 4.01574E-6
5-139887477-T-C p.Ile445Thr missense ANKHD1 1 80376 1.24415E-5 40188 0 NA
5-139887496-G-A p.Thr451Thr synonymous ANKHD1 3 80320 3.73506E-5 40160 0 3.18492E-5
5-139887527-G-A p.Ala462Thr missense ANKHD1 1 80242 1.24623E-5 40121 0 NA
5-139887559-A-G p.Lys472Lys synonymous ANKHD1 1 80106 1.24835E-5 40053 0 NA
5-139887564-A-G p.Asn474Ser missense ANKHD1 12 80074 1.49861E-4 40037 0 6.25E-4
5-139887565-T-C p.Asn474Asn synonymous ANKHD1 269 80064 0.00335981 40032 3 0.0041396
5-139887567-T-TGCTTAGAAAATTAAAATAATA p.Val475_Glu476insLeuArgLysLeuLysTerTyr stop_gained ANKHD1 1 80044 1.24931E-5 40022 0 NA
5-139887582-A-AGACG p.His477fs frameshift ANKHD1 3 79846 3.75723E-5 39923 1 NA
5-139887590-A-G c.1440+7A>G splice_region ANKHD1 12 79626 1.50705E-4 39813 0 6.25E-4
5-139889219-C-T c.1441-3C>T splice_region ANKHD1 2 79578 2.51326E-5 39789 0 NA
5-139889220-A-C c.1441-2A>C splice_acceptor ANKHD1 1 79620 1.25597E-5 39810 0 NA
5-139889223-C-T p.Thr481Met missense+splice_region ANKHD1 1 79652 1.25546E-5 39826 0 8.4558E-6
5-139889224-G-A p.Thr481Thr splice_region+synonymous ANKHD1 9 79606 1.13057E-4 39803 0 1.59215E-4
5-139889232-C-A p.Thr484Asn missense ANKHD1 1 80090 1.2486E-5 40045 0 1.34043E-5
5-139889254-T-C n.632T>C splice_region ANKHD1 1 80220 1.24657E-5 40110 0 NA
5-139889276-A-G p.Arg499Gly missense ANKHD1 4 80304 4.98107E-5 40152 0 6.25E-4
5-139889279-G-A p.Val500Ile missense ANKHD1 3 80306 3.73571E-5 40153 0 1.27389E-4
5-139889312-C-A p.Pro511Thr missense ANKHD1 25 80298 3.1134E-4 40149 0 9.55475E-5
5-139889320-G-T p.Val513Val synonymous ANKHD1 3 80296 3.73618E-5 40148 0 3.18552E-5
5-139889326-C-T p.Ser515Ser synonymous ANKHD1 2 80294 2.49085E-5 40147 0 8.24294E-6
5-139889359-C-T p.Asp526Asp synonymous ANKHD1 2 80234 2.49271E-5 40117 1 NA
5-139889370-A-G p.Tyr530Cys missense ANKHD1 1 80222 1.24654E-5 40111 0 NA
5-139889394-A-T p.His538Leu missense ANKHD1 5 80162 6.23737E-5 40081 0 3.28628E-5
5-139889604-G-A p.Arg539Arg splice_region+synonymous ANKHD1 2 83126 2.40599E-5 41563 0 NA
5-139889609-C-G p.Ala541Gly missense ANKHD1 1 83146 1.2027E-5 41573 0 NA
5-139889615-T-C p.Ile543Thr missense ANKHD1 2 83196 2.40396E-5 41598 0 7.96591E-6
5-139889619-T-C p.Asp544Asp synonymous ANKHD1 1 83208 1.20181E-5 41604 0 NA
5-139889624-G-A p.Arg546His missense ANKHD1 4 83214 4.80688E-5 41607 0 3.30322E-5
5-139889642-C-T p.Thr552Met missense ANKHD1 1 83278 1.2008E-5 41639 0 1.19389E-5
5-139889643-G-A p.Thr552Thr synonymous ANKHD1 2 83284 2.40142E-5 41642 0 NA
5-139889663-A-G p.Asn559Ser missense ANKHD1 1 83364 1.19956E-5 41682 0 3.18634E-5
5-139889664-T-C p.Asn559Asn synonymous ANKHD1 3 83360 3.59885E-5 41680 0 3.18573E-5
5-139889669-G-C p.Gly561Ala missense ANKHD1 1 83360 1.19962E-5 41680 0 NA
5-139889669-G-A p.Gly561Asp missense ANKHD1 1 83360 1.19962E-5 41680 0 NA
5-139889680-G-A p.Val565Ile missense ANKHD1 1 83380 1.19933E-5 41690 0 8.239E-6
5-139889682-T-G p.Val565Val synonymous ANKHD1 13 83378 1.55916E-4 41689 0 6.25E-4
5-139889684-T-C p.Val566Ala missense ANKHD1 22 83384 2.6384E-4 41692 0 9.55475E-5
5-139889692-C-T p.Leu569Leu synonymous ANKHD1 2 83382 2.3986E-5 41691 0 3.97766E-6
5-139889707-G-A p.Ala574Thr missense ANKHD1 1 83386 1.19924E-5 41693 0 NA
5-139889739-C-G p.Ile584Met missense ANKHD1 1 83356 1.19967E-5 41678 0 3.98944E-6
5-139892407-T-C c.1780-6T>C splice_region ANKHD1 1 79644 1.25559E-5 39822 0 NA
5-139892417-A-G p.His595Arg missense ANKHD1 4 79726 5.01718E-5 39863 0 1.65068E-5
5-139892433-A-G p.Gln600Gln synonymous ANKHD1 16 79832 2.00421E-4 39916 0 0.00103734
5-139892470-A-G p.Ile613Val missense ANKHD1 7 79734 8.77919E-5 39867 0 8.25123E-5
5-139892479-A-T p.Met616Leu missense ANKHD1 1 79682 1.25499E-5 39841 0 NA
5-139892482-A-G p.Arg617Gly missense ANKHD1 1 79634 1.25575E-5 39817 0 NA
5-139892967-A-AAAATAGT p.His632fs frameshift ANKHD1 1 80332 1.24483E-5 40166 0 NA
5-139892971-A-G p.Gln633Gln synonymous ANKHD1 1 80334 1.2448E-5 40167 0 NA
5-139892977-C-T p.Val635Val synonymous ANKHD1 8 80352 9.95619E-5 40176 0 6.3649E-4
5-139892981-A-G p.Thr637Ala missense ANKHD1 1 80366 1.24431E-5 40183 0 3.1841E-5
5-139892985-T-C p.Ile638Thr missense ANKHD1 2 80366 2.48861E-5 40183 0 NA
5-139893031-G-A p.Ala653Ala synonymous ANKHD1 7 80366 8.71015E-5 40183 0 1.61423E-5
5-139893033-G-A p.Ser654Asn missense ANKHD1 1 80366 1.24431E-5 40183 0 NA
5-139893064-G-GTCAAGAGAAGAGAGCAGAAAGCAGGCTCTTGCTGCTAAAAGA c.1992_1992+1insTCAAGAGAAGAGAGCAGAAAGCAGGCTCTTGCTGCTAAAAGA splice_donor ANKHD1 2 80322 2.48998E-5 40161 1 NA
5-139893064-G-A p.Lys664Lys splice_region+synonymous ANKHD1 1 80322 1.24499E-5 40161 0 NA
5-139893070-TG-T c.1992+7delG splice_region ANKHD1 1 80264 1.24589E-5 40132 0 3.35289E-5
5-139903643-A-G c.1993-8A>G splice_region ANKHD1 1 79068 1.26473E-5 39534 0 8.4749E-5
5-139903712-G-GA p.Lys1463fs frameshift ANKHD1 3 79978 3.75103E-5 39989 0 NA
5-139903746-GGAA-G p.Glu1473del disruptive_inframe_deletion ANKHD1 4 80202 4.98741E-5 40101 0 8.47091E-5
5-139903746-G-C p.Gln1471His missense ANKHD1 2 80202 2.4937E-5 40101 0 NA
5-139903751-AAGATG-A p.Asp1474fs frameshift ANKHD1 2 80214 2.49333E-5 40107 0 NA
5-139903760-A-T p.Glu1476Val missense ANKHD1 2 80236 2.49265E-5 40118 0 NA
5-139903762-A-C p.Asn1477His missense ANKHD1 1 80242 1.24623E-5 40121 0 NA
5-139903764-C-A p.Asn1477Lys missense ANKHD1 1 80240 1.24626E-5 40120 0 NA
5-139903781-C-G p.Ser1483Trp missense ANKHD1 1 80242 1.24623E-5 40121 0 4.3546E-6
5-139903781-C-T p.Ser1483Leu missense ANKHD1 1 80242 1.24623E-5 40121 0 2.75756E-5
5-139903783-G-T p.Glu1484* stop_gained ANKHD1 1 80244 1.2462E-5 40122 0 NA
5-139903791-A-G p.Pro1486Pro synonymous ANKHD1 12 80232 1.49566E-4 40116 0 7.41386E-5
5-139903800-AGATGAAGAGGAGAAT-A p.Glu1492_Glu1496del disruptive_inframe_deletion ANKHD1 1 80226 1.24648E-5 40113 0 3.18471E-5
5-139903806-AGAG-A p.Glu1493del conservative_inframe_deletion ANKHD1 2 80196 2.49389E-5 40098 0 5.18135E-4
5-139903823-A-G p.Asp1497Gly missense+splice_region ANKHD1 1 80106 1.24835E-5 40053 0 3.18573E-5
5-139903824-TG-T p.Asn1494fs frameshift ANKHD1 8 80098 9.98777E-5 40049 4 NA
5-139905574-A-G c.4493-7A>G splice_region ANKHD1 1 80196 1.24694E-5 40098 0 NA
5-139905574-A-C c.4493-7A>C splice_region ANKHD1 7 80194 8.72883E-5 40097 0 9.55962E-5
5-139905622-A-T p.Thr1512Ser missense ANKHD1 1 80426 1.24338E-5 40213 0 3.18492E-5
5-139905632-T-C p.Ile1515Thr missense ANKHD1 1 80448 1.24304E-5 40224 0 8.27472E-6
5-139905651-T-G p.Ser1521Ser synonymous ANKHD1 2 80456 2.48583E-5 40228 0 NA
5-139905667-G-A p.Val1527Met missense ANKHD1 1 80458 1.24288E-5 40229 0 4.02246E-6
5-139905687-C-G p.Ala1533Ala synonymous ANKHD1 1 80446 1.24307E-5 40223 0 8.23832E-6
5-139905689-A-G p.Asn1534Ser missense ANKHD1 1 80442 1.24313E-5 40221 0 4.01926E-6
5-139905717-G-T p.Arg1543Arg synonymous ANKHD1 1 80426 1.24338E-5 40213 0 NA
5-139905729-G-A p.Lys1547Lys synonymous ANKHD1 1 80432 1.24329E-5 40216 0 NA
5-139905738-A-C p.Thr1550Thr synonymous ANKHD1 2 80422 2.48688E-5 40211 0 NA
5-139905749-C-T p.Pro1554Leu missense ANKHD1 1 80404 1.24372E-5 40202 0 NA
5-139905758-C-A p.Ala1557Glu missense ANKHD1 1 80386 1.244E-5 40193 0 NA
5-139905785-T-C p.Met1566Thr missense ANKHD1 17 80330 2.11627E-4 40165 0 4.12541E-4
5-139905786-G-GTGAA p.Ser1567fs frameshift ANKHD1 1 80334 1.2448E-5 40167 0 NA
5-139905804-G-A p.Lys1572Lys synonymous ANKHD1 1 80316 1.24508E-5 40158 0 NA
5-139905805-G-A p.Ala1573Thr missense ANKHD1 1 80314 1.24511E-5 40157 0 2.47721E-5
5-139905810-T-A p.Asp1574Glu missense ANKHD1 1 80302 1.2453E-5 40151 0 NA
5-139905810-T-C p.Asp1574Asp synonymous ANKHD1 1 80302 1.2453E-5 40151 0 3.18715E-5
5-139905824-A-G p.Asn1579Ser missense ANKHD1 1 80276 1.2457E-5 40138 0 NA
5-139905829-G-A p.Glu1581Lys missense ANKHD1 1 80268 1.24583E-5 40134 0 NA
5-139905844-G-A p.Gly1586Ser missense ANKHD1 1129 80260 0.0140668 40130 7 0.0191058
5-139905862-G-C p.Asp1592His missense ANKHD1 1 80264 1.24589E-5 40132 0 NA
5-139905880-A-G p.Ser1598Gly missense ANKHD1 1 80240 1.24626E-5 40120 0 6.3678E-5
5-139905882-C-G p.Ser1598Arg missense ANKHD1 1 80236 1.24632E-5 40118 0 8.26556E-6
5-139905926-A-C p.Glu1613Ala missense ANKHD1 3 80282 3.73683E-5 40141 0 3.18532E-5
5-139905939-G-A p.Val1617Val synonymous ANKHD1 7 80310 8.71622E-5 40155 0 1.91119E-4
5-139905948-G-A p.Val1620Val synonymous ANKHD1 39 80320 4.85558E-4 40160 0 0.00875
5-139905953-C-T p.Ser1622Phe missense ANKHD1 1 80334 1.2448E-5 40167 0 8.28514E-6
5-139905972-G-A p.Leu1628Leu synonymous ANKHD1 1 80352 1.24452E-5 40176 0 NA
5-139905988-G-C p.Glu1634Gln missense ANKHD1 2 80356 2.48892E-5 40178 0 1.66772E-5
5-139905996-G-C p.Lys1636Asn missense ANKHD1 1 80350 1.24456E-5 40175 0 NA
5-139906014-C-A p.Ser1642Ser synonymous ANKHD1 83 80328 0.00103326 40164 0 8.42676E-4
5-139906016-A-C p.Lys1643Thr missense ANKHD1 1 80312 1.24514E-5 40156 0 2.30903E-4
5-139906032-A-C c.4940+4A>C splice_region ANKHD1 2 80198 2.49383E-5 40099 0 NA
5-139906530-C-T p.Thr1653Ile missense ANKHD1 1 80250 1.24611E-5 40125 0 2.8327E-5
5-139906551-G-A p.Ser1660Asn missense ANKHD1 2 80284 2.49116E-5 40142 0 6.3674E-5
5-139906562-G-C p.Val1664Leu missense ANKHD1 2 80324 2.48992E-5 40162 0 1.20633E-5
5-139906567-A-G p.Ser1665Ser synonymous ANKHD1 2 80328 2.48979E-5 40164 0 3.1837E-5
5-139906586-A-G p.Asn1672Asp missense ANKHD1 4 80328 4.97958E-5 40164 0 2.4719E-5
5-139906590-T-A p.Ile1673Lys missense ANKHD1 6 80332 7.469E-5 40166 0 9.06439E-5
5-139906608-G-A p.Ser1679Asn missense ANKHD1 1 80330 1.24486E-5 40165 0 NA
5-139906617-G-T p.Arg1682Met missense ANKHD1 1 80322 1.24499E-5 40161 0 NA
5-139906629-GAGA-G p.Glu1688del disruptive_inframe_deletion ANKHD1 2 80314 2.49023E-5 40157 0 8.25805E-6
5-139906665-T-C c.5087+6T>C splice_region ANKHD1 3 80216 3.7399E-5 40108 0 3.50385E-4
5-139907451-T-C c.5088-7T>C splice_region ANKHD1 2 80158 2.49507E-5 40079 0 NA
5-139907452-T-A c.5088-6T>A splice_region ANKHD1 1 80180 1.24719E-5 40090 0 NA
5-139907455-T-C c.5088-3T>C splice_region ANKHD1 8 80194 9.97581E-5 40097 0 6.43154E-4
5-139907494-G-A p.Ser1708Ser synonymous ANKHD1 1 80342 1.24468E-5 40171 0 1.20652E-5
5-139907495-A-C p.Arg1709Arg synonymous ANKHD1 1 80342 1.24468E-5 40171 0 8.40958E-6
5-139907509-A-G p.Arg1713Arg synonymous ANKHD1 1 80354 1.24449E-5 40177 0 NA
5-139907544-C-G p.Thr1725Ser missense ANKHD1 1 80342 1.24468E-5 40171 0 NA
5-139907575-AGAT-A p.Asp1736del conservative_inframe_deletion ANKHD1 1 80330 1.24486E-5 40165 0 4.02356E-6
5-139907761-T-C c.5238-8T>C splice_region ANKHD1 3 78124 3.84005E-5 39062 0 6.52358E-5
5-139907772-T-C p.Gly1747Gly synonymous ANKHD1 1 77894 1.2838E-5 38947 0 NA
5-139907805-A-G p.Leu1758Leu synonymous ANKHD1 2 79766 2.50733E-5 39883 0 2.48558E-5
5-139907810-A-G p.Asn1760Ser missense ANKHD1 66 79866 8.26384E-4 39933 0 0.00236598
5-139907817-C-T p.Leu1762Leu synonymous ANKHD1 1 80014 1.24978E-5 40007 0 4.02094E-6
5-139907847-C-T p.Asp1772Asp synonymous ANKHD1 1 80288 1.24552E-5 40144 0 NA
5-139907875-C-T p.Pro1782Ser missense ANKHD1 6 80360 7.4664E-5 40180 0 1.04416E-4
5-139907878-G-T p.Ala1783Ser missense ANKHD1 2 80368 2.48855E-5 40184 0 8.23655E-6
5-139907885-C-G p.Thr1785Ser missense ANKHD1 1 80398 1.24381E-5 40199 0 NA
5-139907893-A-G p.Ile1788Val missense ANKHD1 2 80404 2.48744E-5 40202 0 8.23642E-6
5-139907926-A-G p.Thr1799Ala missense ANKHD1 6 80454 7.45768E-5 40227 0 2.47097E-5
5-139907934-T-C p.Ala1801Ala synonymous ANKHD1 1 80458 1.24288E-5 40229 0 8.23642E-6
5-139907939-G-A p.Ser1803Asn missense ANKHD1 3 80456 3.72875E-5 40228 0 NA
5-139907949-A-G p.Ala1806Ala synonymous ANKHD1 1 80462 1.24282E-5 40231 0 4.01577E-6
5-139907951-T-G p.Phe1807Cys missense ANKHD1 2 80460 2.48571E-5 40230 0 8.23669E-6
5-139907961-T-G p.Gly1810Gly synonymous ANKHD1 1 80468 1.24273E-5 40234 0 3.18532E-5
5-139907962-G-A p.Ala1811Thr missense ANKHD1 1 80470 1.2427E-5 40235 0 NA
5-139907968-A-C p.Thr1813Pro missense ANKHD1 1 80472 1.24267E-5 40236 0 NA
5-139907982-A-C p.Ser1817Ser synonymous ANKHD1 3 80482 3.72754E-5 40241 0 4.11828E-5
5-139908002-C-T p.Thr1824Met missense ANKHD1 2 80478 2.48515E-5 40239 1 6.37349E-5
5-139908003-G-A p.Thr1824Thr synonymous ANKHD1 2 80478 2.48515E-5 40239 0 3.18959E-5
5-139908012-C-T p.Pro1827Pro synonymous ANKHD1 15 80478 1.86386E-4 40239 0 1.64731E-4
5-139908013-G-A p.Ala1828Thr missense ANKHD1 3 80476 3.72782E-5 40238 0 8.03103E-6
5-139908013-G-T p.Ala1828Ser missense ANKHD1 3 80476 3.72782E-5 40238 0 3.19081E-5
5-139908015-T-A p.Ala1828Ala synonymous ANKHD1 13 80478 1.61535E-4 40239 0 1.27445E-4
5-139908017-ATAAACT-A p.Lys1830_Leu1831del disruptive_inframe_deletion ANKHD1 13 80474 1.61543E-4 40237 0 9.88386E-5
5-139908063-A-C p.Pro1844Pro synonymous ANKHD1 2 80476 2.48521E-5 40238 0 3.19163E-5
5-139908133-C-G p.Arg1868Gly missense ANKHD1 1 80466 1.24276E-5 40233 0 4.01552E-6
5-139908135-G-A p.Arg1868Arg synonymous ANKHD1 4 80468 4.97092E-5 40234 0 3.18776E-5
5-139908136-C-T p.His1869Tyr missense ANKHD1 1 80468 1.24273E-5 40234 0 NA
5-139908141-T-C p.Pro1870Pro synonymous ANKHD1 1 80460 1.24285E-5 40230 0 4.9421E-5
5-139908143-G-A p.Arg1871His missense ANKHD1 2 80462 2.48565E-5 40231 0 4.01568E-6
5-139908178-CCTT-C p.Ser1884del conservative_inframe_deletion ANKHD1 2 80456 2.48583E-5 40228 0 8.23669E-6
5-139908182-C-T p.Ser1884Phe missense ANKHD1 2 80450 2.48602E-5 40225 0 1.20468E-5
5-139908184-C-T p.Pro1885Ser missense ANKHD1 2 80450 2.48602E-5 40225 0 NA
5-139908193-T-G p.Trp1888Gly missense ANKHD1 2 80452 2.48595E-5 40226 0 NA
5-139908194-G-T p.Trp1888Leu missense ANKHD1 3 80450 3.72902E-5 40225 0 NA
5-139908205-C-T p.Pro1892Ser missense ANKHD1 1 80446 1.24307E-5 40223 0 NA
5-139908216-T-C p.Pro1895Pro synonymous ANKHD1 5 80442 6.21566E-5 40221 0 NA
5-139908236-A-G p.Asn1902Ser missense ANKHD1 2 80434 2.48651E-5 40217 0 4.11841E-5
5-139908251-A-G p.His1907Arg missense ANKHD1 3 80414 3.73069E-5 40207 0 6.82753E-5
5-139908255-T-C p.Asn1908Asn synonymous ANKHD1 27 80406 3.35796E-4 40203 0 2.16892E-4
5-139908266-G-A p.Arg1912His missense ANKHD1 3 80380 3.73227E-5 40190 0 6.58957E-5
5-139908278-A-G p.Gln1916Arg missense ANKHD1 1 80370 1.24425E-5 40185 0 NA
5-139908279-G-A p.Gln1916Gln synonymous ANKHD1 1 80366 1.24431E-5 40183 0 8.2371E-6
5-139908282-C-T p.Asn1917Asn synonymous ANKHD1 3 80358 3.73329E-5 40179 0 9.55597E-5
5-139908301-G-C p.Glu1924Gln missense ANKHD1 2 80262 2.49184E-5 40131 0 8.03471E-6
5-139908309-T-C p.Ala1926Ala synonymous ANKHD1 1 80206 1.24679E-5 40103 0 NA
5-139908339-T-C p.Thr1936Thr synonymous ANKHD1 1 80092 1.24856E-5 40046 0 8.0349E-6
5-139908342-C-G p.Val1937Val synonymous ANKHD1 2 80078 2.49756E-5 40039 0 8.03523E-6
5-139908342-C-T p.Val1937Val synonymous ANKHD1 1 80078 1.24878E-5 40039 0 NA
5-139908361-A-C p.Ser1944Arg missense ANKHD1 1 80008 1.24988E-5 40004 0 NA
5-139908380-C-G p.Thr1950Ser missense ANKHD1 5 79982 6.25141E-5 39991 0 6.36821E-5
5-139908388-C-T p.Arg1953Trp missense ANKHD1 4 79966 5.00213E-5 39983 0 2.47101E-5
5-139908389-G-A p.Arg1953Gln missense ANKHD1 1 79966 1.25053E-5 39983 0 NA
5-139908392-C-G p.Thr1954Ser missense ANKHD1 1 79994 1.25009E-5 39997 0 NA
5-139908395-C-T p.Pro1955Leu missense ANKHD1 2 80012 2.49963E-5 40006 0 4.01774E-6
5-139908415-T-C p.Leu1962Leu synonymous ANKHD1 2 80022 2.49931E-5 40011 0 8.23655E-6
5-139908417-G-T p.Leu1962Phe missense ANKHD1 1 80016 1.24975E-5 40008 0 6.25E-4
5-139908434-A-C p.Lys1968Thr missense ANKHD1 1 80064 1.249E-5 40032 0 NA
5-139908441-T-A p.Ser1970Arg missense ANKHD1 1 80068 1.24894E-5 40034 0 NA
5-139908449-C-T p.Ala1973Val missense ANKHD1 2 80074 2.49769E-5 40037 0 8.23669E-6
5-139908470-C-T p.Thr1980Ile missense ANKHD1 5 80178 6.23612E-5 40089 0 3.18471E-5
5-139908477-T-C p.Thr1982Thr synonymous ANKHD1 1 80210 1.24673E-5 40105 0 NA
5-139908480-T-C p.Cys1983Cys synonymous ANKHD1 2 80236 2.49265E-5 40118 0 NA
5-139908496-G-T p.Val1989Phe missense ANKHD1 1 80334 1.2448E-5 40167 0 3.1841E-5
5-139908498-C-T p.Val1989Val synonymous ANKHD1 2 80348 2.48917E-5 40174 0 8.23696E-6
5-139908511-A-G p.Ile1994Val missense ANKHD1 10 80366 1.24431E-4 40183 0 6.37064E-5
5-139908517-A-G p.Ser1996Gly missense ANKHD1 3 80376 3.73246E-5 40188 0 6.37024E-5
5-139908519-C-T p.Ser1996Ser synonymous ANKHD1 5 80370 6.22123E-5 40185 0 6.25E-4
5-139908520-G-A p.Gly1997Arg missense ANKHD1 2 80366 2.48861E-5 40183 0 8.23778E-6
5-139908525-A-G p.Gln1998Gln synonymous ANKHD1 1 80376 1.24415E-5 40188 0 NA
5-139908529-C-T p.Pro2000Ser missense ANKHD1 2 80376 2.4883E-5 40188 0 NA
5-139908538-T-G p.Phe2003Val missense ANKHD1 1 80368 1.24428E-5 40184 0 NA
5-139908543-A-G p.Leu2004Leu synonymous ANKHD1 2 80350 2.48911E-5 40175 0 6.25E-4
5-139908563-C-G p.Ala2011Gly missense ANKHD1 1 80332 1.24483E-5 40166 0 NA
5-139908638-A-G p.Gln2036Arg missense ANKHD1 2 80250 2.49221E-5 40125 0 1.64883E-5
5-139908643-A-C p.Met2038Leu missense ANKHD1 1 80226 1.24648E-5 40113 0 5.18135E-4
5-139908656-G-A p.Cys2042Tyr missense ANKHD1 1 80178 1.24722E-5 40089 0 NA
5-139908686-G-T p.Ser2052Ile missense ANKHD1 1 80108 1.24831E-5 40054 0 NA
5-139908692-C-T p.Ser2054Phe missense ANKHD1 1 80082 1.24872E-5 40041 0 3.1841E-5
5-139908704-C-A p.Thr2058Asn missense ANKHD1 13 80068 1.62362E-4 40034 0 4.82629E-5
5-139908707-C-T p.Pro2059Leu missense ANKHD1 6 80048 7.4955E-5 40024 0 2.54761E-4
5-139908745-CCT-C p.Pro2072fs frameshift ANKHD1 1 79770 1.2536E-5 39885 0 NA
5-139908748-A-C p.Thr2073Pro missense ANKHD1 1 79684 1.25496E-5 39842 0 NA
5-139908748-ACTTC-A p.Ser2074fs frameshift ANKHD1 1 79684 1.25496E-5 39842 0 NA
5-139908754-A-G p.Ser2075Gly missense ANKHD1 2 79590 2.51288E-5 39795 0 3.18471E-5
5-139908769-G-A p.Glu2080Lys missense ANKHD1 1 79294 1.26113E-5 39647 0 6.36821E-5
5-139908784-A-G p.Ser2085Gly missense ANKHD1 1 79126 1.26381E-5 39563 0 1.60729E-5
5-139908855-A-G p.Thr2108Thr synonymous ANKHD1 21 79754 2.6331E-4 39877 2 3.21463E-5
5-139908865-A-G p.Met2112Val missense ANKHD1 1 79930 1.25109E-5 39965 0 0.00125
5-139908867-G-A p.Met2112Ile missense ANKHD1 1 79960 1.25063E-5 39980 0 4.01942E-6
5-139908906-G-C p.Gln2125His missense ANKHD1 1 80340 1.24471E-5 40170 0 NA
5-139908914-T-C p.Val2128Ala missense ANKHD1 1 80372 1.24421E-5 40186 0 NA
5-139908922-C-T p.Pro2131Ser missense ANKHD1 4 80392 4.97562E-5 40196 0 3.18451E-5
5-139908925-C-G p.Arg2132Gly missense ANKHD1 1 80396 1.24384E-5 40198 0 3.18431E-5
5-139908926-G-A p.Arg2132Gln missense ANKHD1 44 80398 5.47277E-4 40199 0 0.00101937
5-139908931-T-G p.Ser2134Ala missense ANKHD1 2 80406 2.48738E-5 40203 0 NA
5-139908938-G-A p.Arg2136Gln missense ANKHD1 8 80416 9.94827E-5 40208 0 2.81084E-5
5-139908956-C-T p.Ser2142Phe missense ANKHD1 3 80442 3.7294E-5 40221 0 8.03058E-6
5-139908973-C-T p.Pro2148Ser missense ANKHD1 1 80462 1.24282E-5 40231 0 NA
5-139908982-A-G p.Thr2151Ala missense ANKHD1 1 80466 1.24276E-5 40233 0 2.47093E-5
5-139908999-C-T p.Pro2156Pro synonymous ANKHD1 1 80472 1.24267E-5 40236 0 NA
5-139909017-G-A p.Thr2162Thr synonymous ANKHD1 13 80472 1.61547E-4 40236 0 9.8837E-5
5-139909022-C-T p.Pro2164Leu missense ANKHD1 1 80474 1.24264E-5 40237 0 8.23642E-6
5-139909033-A-G p.Thr2168Ala missense ANKHD1 2 80470 2.4854E-5 40235 0 NA
5-139909034-C-T p.Thr2168Ile missense ANKHD1 1 80470 1.2427E-5 40235 0 8.03129E-6
5-139909036-C-T p.Pro2169Ser missense ANKHD1 152 80472 0.00188886 40236 0 0.00334374
5-139909039-C-T p.Pro2170Ser missense ANKHD1 11 80470 1.36697E-4 40235 0 0.00125
5-139909043-A-G p.Gln2171Arg missense ANKHD1 1 80470 1.2427E-5 40235 0 NA
5-139909051-C-T p.Pro2174Ser missense ANKHD1 1 80472 1.24267E-5 40236 0 NA
5-139909057-G-T p.Ala2176Ser missense ANKHD1 3 80474 3.72791E-5 40237 0 6.36821E-5
5-139909066-C-T p.Leu2179Phe missense ANKHD1 15 80468 1.8641E-4 40234 0 1.59215E-4
5-139909070-C-T p.Ser2180Phe missense ANKHD1 1 80470 1.2427E-5 40235 0 NA
5-139909096-T-C p.Ser2189Pro missense ANKHD1 1 80462 1.24282E-5 40231 0 NA
5-139909108-A-G p.Ile2193Val missense ANKHD1 2 80470 2.4854E-5 40235 0 NA
5-139909136-C-A p.Pro2202His missense ANKHD1 1 80470 1.2427E-5 40235 0 1.64728E-5
5-139909138-A-C p.Thr2203Pro missense ANKHD1 78 80472 9.69281E-4 40236 2 0.00125
5-139909154-C-T p.Thr2208Ile missense ANKHD1 1 80476 1.24261E-5 40238 0 NA
5-139909155-A-G p.Thr2208Thr synonymous ANKHD1 2 80474 2.48527E-5 40237 0 4.01542E-6
5-139909193-A-G p.Gln2221Arg missense ANKHD1 2 80478 2.48515E-5 40239 0 8.23642E-6
5-139909228-C-G p.Leu2233Val missense ANKHD1 1 80470 1.2427E-5 40235 0 2.81066E-5
5-139909238-G-A p.Arg2236Gln missense ANKHD1 1 80472 1.24267E-5 40236 0 NA
5-139909240-G-GTTT p.Val2237_Ala2238insPhe conservative_inframe_insertion ANKHD1 2 80474 2.48527E-5 40237 0 8.03058E-6
5-139909241-T-C p.Val2237Ala missense ANKHD1 1 80474 1.24264E-5 40237 0 NA
5-139909252-G-A p.Ala2241Thr missense ANKHD1 1 80480 1.24254E-5 40240 0 NA
5-139909260-C-G p.Phe2243Leu missense ANKHD1 11 80482 1.36677E-4 40241 0 1.27429E-4
5-139909275-G-A p.Ala2248Ala synonymous ANKHD1 1 80478 1.24258E-5 40239 0 6.37227E-5
5-139909289-C-T p.Ser2253Leu missense ANKHD1 1 80478 1.24258E-5 40239 0 NA
5-139909294-C-T p.Leu2255Phe missense ANKHD1 1 80474 1.24264E-5 40237 0 2.47093E-5
5-139909299-A-G p.Gly2256Gly synonymous ANKHD1 1 80468 1.24273E-5 40234 0 NA
5-139909312-A-C p.Met2261Leu missense ANKHD1 2 80454 2.48589E-5 40227 0 NA
5-139909312-A-T p.Met2261Leu missense ANKHD1 2 80454 2.48589E-5 40227 0 0.0015544
5-139909317-C-T p.His2262His synonymous ANKHD1 1 80454 1.24295E-5 40227 0 8.0309E-6
5-139909322-A-G p.Asp2264Gly missense ANKHD1 6 80448 7.45823E-5 40224 0 2.47117E-5
5-139909325-A-G p.Asn2265Ser missense ANKHD1 1 80448 1.24304E-5 40224 0 NA
5-139909333-G-A p.Ala2268Thr missense ANKHD1 2 80422 2.48688E-5 40211 0 8.23832E-6
5-139909333-G-C p.Ala2268Pro missense ANKHD1 1 80422 1.24344E-5 40211 0 2.4715E-5
5-139909351-C-T p.Pro2274Ser missense ANKHD1 1 80348 1.24459E-5 40174 0 6.37064E-5
5-139909355-C-T p.Ser2275Phe missense ANKHD1 1 80320 1.24502E-5 40160 0 8.2481E-6
5-139909358-A-G p.Gln2276Arg missense ANKHD1 1 80308 1.24521E-5 40154 0 NA
5-139914948-G-T p.Gly2284Gly splice_region+synonymous ANKHD1 1 80264 1.24589E-5 40132 0 1.30519E-5
5-139914952-C-A p.Pro2286Thr missense ANKHD1 1 80304 1.24527E-5 40152 0 NA
5-139914964-C-A p.Pro2290Thr missense ANKHD1 1 80432 1.24329E-5 40216 0 NA
5-139914965-C-T p.Pro2290Leu missense ANKHD1 1 80446 1.24307E-5 40223 0 8.37451E-6
5-139914981-A-G p.Pro2295Pro synonymous ANKHD1 1 80460 1.24285E-5 40230 0 3.18613E-5
5-139914986-C-T p.Ser2297Phe missense ANKHD1 2 80458 2.48577E-5 40229 0 NA
5-139915006-A-G p.Ser2304Gly missense ANKHD1 1 80450 1.24301E-5 40225 0 NA
5-139915014-C-T p.Ser2306Ser synonymous ANKHD1 1 80456 1.24292E-5 40228 0 NA
5-139915015-G-A p.Gly2307Ser missense ANKHD1 4 80458 4.97154E-5 40229 0 2.55464E-4
5-139915018-A-G p.Ile2308Val missense ANKHD1 2 80460 2.48571E-5 40230 0 8.24008E-6
5-139915023-A-C p.Pro2309Pro synonymous ANKHD1 1 80462 1.24282E-5 40231 0 NA
5-139915024-G-A p.Gly2310Arg missense ANKHD1 1 80464 1.24279E-5 40232 0 NA
5-139915032-G-A p.Arg2312Arg synonymous ANKHD1 1 80468 1.24273E-5 40234 0 8.23873E-6
5-139915041-G-C p.Leu2315Leu synonymous ANKHD1 1 80470 1.2427E-5 40235 0 NA
5-139915043-A-G p.Gln2316Arg missense ANKHD1 17 80472 2.11254E-4 40236 0 3.8236E-4
5-139915066-C-G p.Pro2324Ala missense ANKHD1 1 80456 1.24292E-5 40228 0 NA
5-139915081-C-CAAATAAATAA p.His2330fs frameshift ANKHD1 1 80460 1.24285E-5 40230 0 NA
5-139915084-C-G p.His2330Asp missense ANKHD1 1 80452 1.24298E-5 40226 0 NA
5-139915109-G-C p.Ser2338Thr missense ANKHD1 1 80432 1.24329E-5 40216 0 6.37714E-5
5-139915111-G-A p.Ala2339Thr missense ANKHD1 1 80422 1.24344E-5 40211 0 1.68435E-5
5-139915120-T-G p.Ser2342Ala missense ANKHD1 1 80404 1.24372E-5 40202 0 NA
5-139916915-G-C c.2996-8G>C splice_region ANKHD1 2 79314 2.52162E-5 39657 0 3.60308E-5
5-139916929-C-T p.Ser1001Phe missense ANKHD1 2 80200 2.49377E-5 40100 0 8.5806E-6
5-139916930-T-G p.Ser1001Ser synonymous ANKHD1 1 80216 1.24663E-5 40108 0 NA
5-139916941-C-T p.Ser1005Phe missense ANKHD1 6 80338 7.46845E-5 40169 0 5.05553E-5
5-139916950-C-T p.Ser1008Leu missense ANKHD1 1 80364 1.24434E-5 40182 0 6.68025E-5
5-139916954-A-T p.Gly1009Gly synonymous ANKHD1 1 80386 1.244E-5 40193 0 3.63299E-5
5-139916971-C-A p.Ser1015* stop_gained ANKHD1 1 80412 1.2436E-5 40206 0 NA
5-139916983-C-T p.Ala2346Val missense ANKHD1 4 80442 4.97253E-5 40221 0 4.01907E-6
5-139916991-A-G p.Thr2349Ala missense ANKHD1 1 80450 1.24301E-5 40225 0 NA
5-139916992-C-A p.Thr2349Lys missense ANKHD1 1 80448 1.24304E-5 40224 0 NA
5-139916993-G-A p.Thr2349Thr synonymous ANKHD1 2 80442 2.48626E-5 40221 0 1.60671E-5
5-139916998-G-T p.Gly2351Val missense ANKHD1 1 80448 1.24304E-5 40224 0 NA
5-139917001-A-G p.Gln2352Arg missense ANKHD1 1 80452 1.24298E-5 40226 0 NA
5-139917016-G-A p.Ser2357Asn missense ANKHD1 1 80456 1.24292E-5 40228 0 NA
5-139917018-G-T p.Ala2358Ser missense ANKHD1 1 80462 1.24282E-5 40231 0 8.23845E-6
5-139917076-G-A p.Arg2377Gln missense ANKHD1 2 80472 2.48534E-5 40236 0 1.60667E-5
5-139917102-C-G p.Pro2386Ala missense ANKHD1 116 80468 0.00144157 40234 3 0.00466321
5-139917102-C-T p.Pro2386Ser missense ANKHD1 2 80472 2.48534E-5 40236 0 3.18552E-5
5-139917103-C-T p.Pro2386Leu missense ANKHD1 5 80470 6.2135E-5 40235 0 8.33611E-6
5-139917106-C-T p.Ala2387Val missense ANKHD1 5 80466 6.2138E-5 40233 0 0.00125
5-139917107-G-A p.Ala2387Ala synonymous ANKHD1 6 80468 7.45638E-5 40234 0 2.5043E-5
5-139917111-A-G p.Thr2389Ala missense ANKHD1 1 80466 1.24276E-5 40233 0 NA
5-139917112-C-G p.Thr2389Ser missense ANKHD1 1 80466 1.24276E-5 40233 0 3.18552E-5
5-139917122-C-T p.Val2392Val synonymous ANKHD1 2 80470 2.4854E-5 40235 0 8.48292E-6
5-139917123-G-A p.Ala2393Thr missense ANKHD1 2 80464 2.48558E-5 40232 0 1.05751E-4
5-139917128-C-T p.Pro2394Pro synonymous ANKHD1 5 80462 6.21411E-5 40231 0 8.53344E-6
5-139917129-G-A p.Val2395Ile missense ANKHD1 4 80460 4.97141E-5 40230 0 6.25E-4
5-139917130-T-C p.Val2395Ala missense ANKHD1 1 80464 1.24279E-5 40232 0 3.42226E-5
5-139917136-A-T p.His2397Leu missense ANKHD1 1 80460 1.24285E-5 40230 0 NA
5-139917159-G-C p.Val2405Leu missense ANKHD1 1 80362 1.24437E-5 40181 0 3.1841E-5
5-139917160-T-A p.Val2405Asp missense ANKHD1 1 80368 1.24428E-5 40184 0 NA
5-139917160-T-G p.Val2405Gly missense ANKHD1 1 80368 1.24428E-5 40184 0 8.87571E-6
5-139917163-A-G p.Asn2406Ser missense ANKHD1 7 80342 8.71275E-5 40171 0 0.00125
5-139917179-A-G c.7228+5A>G splice_region ANKHD1 1 80122 1.2481E-5 40061 0 NA
5-139917180-A-G c.7228+6A>G splice_region ANKHD1 3 80146 3.74317E-5 40073 0 2.68644E-5
5-139917181-T-A c.7228+7T>A splice_region ANKHD1 2 80148 2.49538E-5 40074 0 9.94599E-6
5-139917660-ATTC-A c.7229-10_7229-8delTTC splice_region ANKHD1 1 80108 1.24831E-5 40054 0 8.44495E-6
5-139917739-A-T p.Ser2433Cys missense ANKHD1 3 80378 3.73236E-5 40189 0 8.03277E-6
5-139917747-C-G p.Phe2435Leu missense ANKHD1 1 80388 1.24397E-5 40194 0 1.00406E-4
5-139917754-C-T p.His2438Tyr missense ANKHD1 1 80396 1.24384E-5 40198 0 9.55171E-5
5-139917792-C-T p.Ala2450Ala synonymous ANKHD1 1 80402 1.24375E-5 40201 0 9.23932E-5
5-139917792-C-A p.Ala2450Ala synonymous ANKHD1 1 80402 1.24375E-5 40201 0 8.23832E-6
5-139917800-A-G p.Asn2453Ser missense ANKHD1 123 80398 0.00152989 40199 0 0.003125
5-139918508-T-G p.Leu2470Arg missense ANKHD1 1 78806 1.26894E-5 39403 0 NA
5-139918513-A-G p.Ile2472Val missense ANKHD1 1 78990 1.26598E-5 39495 0 3.18573E-5
5-139918516-T-A p.Ser2473Thr missense ANKHD1 1 78890 1.26759E-5 39445 0 NA
5-139918528-G-A p.Gly2477Ser missense ANKHD1 1 79086 1.26445E-5 39543 0 NA
5-139918534-A-G p.Ile2479Val missense ANKHD1 4 80230 4.98567E-5 40115 0 4.13305E-4
5-139918554-G-A p.Gln2485Gln synonymous ANKHD1 1 80384 1.24403E-5 40192 0 8.24457E-6
5-139918554-G-C p.Gln2485His missense ANKHD1 1 80384 1.24403E-5 40192 0 NA
5-139918555-C-G p.Leu2486Val missense ANKHD1 4 80380 4.97636E-5 40190 0 3.29761E-5
5-139918567-C-T p.Pro2490Ser missense ANKHD1 2 80418 2.48701E-5 40209 0 NA
5-139918583-T-A p.Phe2495Tyr missense ANKHD1 1 80460 1.24285E-5 40230 0 2.54761E-4
5-139918597-A-G p.Asn2500Asp missense ANKHD1 1 80460 1.24285E-5 40230 0 NA
5-139918598-A-G p.Asn2500Ser missense ANKHD1 1 80464 1.24279E-5 40232 0 3.18451E-5
5-139918600-C-G p.Pro2501Ala missense ANKHD1 20 80464 2.48558E-4 40232 0 5.18135E-4
5-139918604-A-T p.Asp2502Val missense ANKHD1 1 80464 1.24279E-5 40232 0 NA
5-139918613-G-T p.Trp2505Leu missense ANKHD1 1 80450 1.24301E-5 40225 0 NA
5-139918625-T-C p.Ile2509Thr missense ANKHD1 1 80438 1.24319E-5 40219 0 NA
5-139918645-A-G p.Thr2516Ala missense ANKHD1 19 80436 2.36213E-4 40218 0 9.55901E-5
5-139918652-G-T p.Cys2518Phe missense ANKHD1 2 80418 2.48701E-5 40209 0 4.14656E-5
5-139918666-C-G p.Gln2523Glu missense+splice_region ANKHD1 1 80400 1.24378E-5 40200 0 NA
5-139918667-A-G p.Gln2523Arg missense+splice_region ANKHD1 2 80404 2.48744E-5 40202 0 NA
5-139918668-G-GATTTGGCCTGGCAC p.Val181fs frameshift ANKHD1 4 80404 4.97488E-5 40202 0 NA
5-139918670-T-TGGGCACCTCATATTGGAAACATGCATCTC p.Lys182fs frameshift ANKHD1 1 80396 1.24384E-5 40198 0 NA
5-139918683-A-G p.Ter185Ter stop_retained ANKHD1 1 80332 1.24483E-5 40166 0 NA
5-139918945-T-C p.Ile2524Thr missense+splice_region ANKHD1 1 83126 1.20299E-5 41563 0 NA
5-139918957-C-T p.Thr2528Met missense ANKHD1 2 83174 2.4046E-5 41587 0 1.19411E-5
5-139918965-C-T p.Pro2531Ser missense ANKHD1 2 83250 2.4024E-5 41625 0 3.18512E-5
5-139918999-A-G p.Asn2542Ser missense ANKHD1 1 83186 1.20213E-5 41593 0 3.18532E-5
5-139921766-C-G p.Leu2527Val missense ANKHD1 2 83146 2.40541E-5 41573 0 NA
5-139921770-C-T p.Pro2528Leu missense ANKHD1 18 83178 2.16403E-4 41589 0 6.25E-4
5-139921773-C-T p.Ser2529Leu missense ANKHD1 2 83202 2.40379E-5 41601 0 3.1837E-5
5-139921776-T-G p.Val2530Gly missense ANKHD1 1 83232 1.20146E-5 41616 0 5.56904E-5
5-139921787-A-T p.Lys2534* stop_gained ANKHD1 1 83274 1.20085E-5 41637 0 NA
5-139921797-T-C p.Ile2537Thr missense ANKHD1 7 83300 8.40336E-5 41650 0 NA
5-139921806-C-T p.Pro2540Leu missense ANKHD1 1 83308 1.20036E-5 41654 0 NA
5-139921815-C-G p.Thr2543Ser missense ANKHD1 1 83314 1.20028E-5 41657 0 3.97798E-6
5-139921821-C-T p.Pro2545Leu missense ANKHD1 2 83312 2.40061E-5 41656 0 5.77101E-5
5-139921838-C-T p.Arg2551Trp missense ANKHD1 14 83290 1.68087E-4 41645 0 0.00151057
5-139921839-G-A p.Arg2551Gln missense ANKHD1 18 83286 2.16123E-4 41643 0 5.42875E-4
5-139921841-C-T p.Pro2552Ser missense ANKHD1 1 83288 1.20065E-5 41644 0 NA
5-139921842-C-T p.Pro2552Leu missense ANKHD1 1 83278 1.2008E-5 41639 0 1.19507E-5
5-139921843-G-A p.Pro2552Pro synonymous ANKHD1 1 83270 1.20091E-5 41635 0 6.25E-4
5-139921845-T-C p.Met2553Thr missense ANKHD1 1 83260 1.20106E-5 41630 0 3.98311E-6
5-139921853-T-A p.Ser2556Thr missense ANKHD1 1 83242 1.20132E-5 41621 0 NA
5-139921854-C-T p.Ser2556Phe missense ANKHD1 3 83238 3.60412E-5 41619 0 3.32823E-5
5-139928486-G-C c.7680-5G>C splice_region ANKHD1 3 79830 3.75799E-5 39915 0 3.18715E-5
5-139928486-G-A c.7680-5G>A splice_region ANKHD1 1 79830 1.25266E-5 39915 0 NA
5-139928492-C-A p.His2561Asn missense+splice_region ANKHD1 2 79940 2.50188E-5 39970 0 8.47788E-5
5-139928508-G-A p.Arg2566Gln missense ANKHD1 4 80190 4.98815E-5 40095 0 1.66625E-5
5-139928511-C-T p.Pro2567Leu missense ANKHD1 1 80256 1.24601E-5 40128 0 5.81908E-5
5-139928512-G-A p.Pro2567Pro synonymous ANKHD1 10 80266 1.24586E-4 40133 1 9.56328E-5
5-139928512-G-T p.Pro2567Pro synonymous ANKHD1 7 80266 8.721E-5 40133 0 2.4919E-5
5-139928513-A-G p.Lys2568Glu missense ANKHD1 1 80270 1.2458E-5 40135 0 6.25E-4
5-139928530-G-C p.Val2573Val synonymous ANKHD1 1 80326 1.24493E-5 40163 0 4.01748E-6
5-139928537-C-A p.Leu2576Ile missense ANKHD1 1 80334 1.2448E-5 40167 0 8.03439E-6
5-139928538-T-A p.Leu2576His missense ANKHD1 2 80338 2.48948E-5 40169 0 NA
5-139928550-C-T p.Pro2580Leu missense ANKHD1 3 80332 3.7345E-5 40166 0 3.18613E-5
5-139928550-CG-C p.Asp2581fs frameshift ANKHD1 1 80332 1.24483E-5 40166 0 NA
5-139928551-G-A p.Pro2580Pro synonymous ANKHD1 3 80334 3.73441E-5 40167 0 1.27518E-4
5-139928555-AC-A p.Leu2584fs frameshift ANKHD1 1 80324 1.24496E-5 40162 0 NA
5-139928559-C-T p.Pro2583Leu missense ANKHD1 1 80352 1.24452E-5 40176 0 3.18512E-5
5-139928560-C-G p.Pro2583Pro synonymous ANKHD1 3 80362 3.73311E-5 40181 0 1.60693E-4
5-139928578-T-A p.Asp2589Glu missense ANKHD1 1 80394 1.24387E-5 40197 0 NA
5-139928584-G-T p.Arg2591Arg synonymous ANKHD1 2 80396 2.48769E-5 40198 0 9.55962E-5
5-139928584-G-A p.Arg2591Arg synonymous ANKHD1 1 80396 1.24384E-5 40198 0 NA
5-139928592-ACTC-A p.Ser2596del conservative_inframe_deletion ANKHD1 1 80394 1.24387E-5 40197 0 NA
5-139928601-A-G p.Asn2597Ser missense ANKHD1 1 80398 1.24381E-5 40199 0 NA
5-139928606-C-T p.Pro2599Ser missense ANKHD1 1 80422 1.24344E-5 40211 0 8.25409E-6
5-139928621-GGAGGAGC-G p.Gly2604fs frameshift ANKHD1 36 80426 4.47616E-4 40213 0 3.82312E-4
5-139928629-TGAAGGAGC-T p.Glu2607fs frameshift ANKHD1 36 80430 4.47594E-4 40215 0 3.82409E-4
5-139928633-G-A p.Gly2608Arg missense ANKHD1 1 80430 1.24332E-5 40215 0 NA
5-139928638-A-T p.Ala2609Ala synonymous ANKHD1 35 80432 4.3515E-4 40216 0 6.25E-4
5-139928644-CAG-C p.Gly2613fs frameshift ANKHD1 1 80434 1.24326E-5 40217 0 NA
5-139928645-A-G p.Arg2612Gly missense ANKHD1 1 80438 1.24319E-5 40219 0 NA
5-139928648-G-C p.Gly2613Arg missense ANKHD1 1 80430 1.24332E-5 40215 0 NA
5-139928649-G-C p.Gly2613Ala missense ANKHD1 2 80428 2.4867E-5 40214 0 8.24593E-6
5-139928654-G-C p.Asp2615His missense ANKHD1 1 80432 1.24329E-5 40216 0 4.01758E-6
5-139928660-C-T p.Arg2617* stop_gained ANKHD1 1 80426 1.24338E-5 40213 0 3.18593E-5
5-139928661-G-GAT c.7850_7850+1insAT splice_donor ANKHD1 1 80418 1.2435E-5 40209 0 NA