Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
12-121746048-T-C n.1141A>G splice_region ANAPC5 1 18672 5.35561E-5 9336 0 3.1839E-5
12-121746307-CCCATGAGAGGGCAGCT-C p.Glu743fs frameshift ANAPC5 4 83294 4.80227E-5 41647 0 NA
12-121746337-C-T p.Arg738Arg synonymous ANAPC5 762 83340 0.00914327 41670 11 0.02375
12-121746338-C-T p.Arg738Gln missense ANAPC5 4 83358 4.79858E-5 41679 0 4.94486E-5
12-121746355-C-T p.Arg732Arg synonymous ANAPC5 5 83390 5.99592E-5 41695 0 6.75977E-5
12-121746357-G-A p.Arg732Trp missense ANAPC5 4 83396 4.79639E-5 41698 0 9.56023E-5
12-121746373-C-G p.Lys726Asn missense ANAPC5 1 83392 1.19916E-5 41696 0 3.97627E-6
12-121746387-G-A p.His722Tyr missense ANAPC5 1 83402 1.19901E-5 41701 0 8.23723E-6
12-121746389-T-C p.Tyr721Cys missense ANAPC5 5 83404 5.99492E-5 41702 0 8.2371E-6
12-121746405-A-G p.Phe716Leu missense ANAPC5 1 83408 1.19893E-5 41704 0 3.18634E-5
12-121746406-G-A p.Tyr715Tyr synonymous ANAPC5 36 83410 4.31603E-4 41705 1 0.003125
12-121746412-G-A p.Val713Val synonymous ANAPC5 1 83412 1.19887E-5 41706 0 3.18532E-5
12-121746415-G-A p.Asp712Asp synonymous ANAPC5 178 83408 0.00213409 41704 2 0.00414356
12-121746424-G-A p.Arg709Arg synonymous ANAPC5 1 83414 1.19884E-5 41707 0 3.18715E-5
12-121746440-A-G p.Val704Ala missense ANAPC5 7 83400 8.39329E-5 41700 0 2.02788E-4
12-121746457-C-G p.Lys698Asn missense ANAPC5 3 83400 3.59712E-5 41700 0 1.59286E-4
12-121746459-T-C p.Lys698Glu missense ANAPC5 1 83398 1.19907E-5 41699 0 NA
12-121746466-A-G p.Asn695Asn synonymous ANAPC5 1 83384 1.19927E-5 41692 0 3.18573E-5
12-121746467-T-C p.Asn695Ser missense ANAPC5 1 83386 1.19924E-5 41693 0 5.9645E-5
12-121746493-A-AGCTTCTGCTTTCTTCG p.Leu687fs frameshift ANAPC5 2 83330 2.4001E-5 41665 1 NA
12-121746497-G-A c.2057-3C>T splice_region ANAPC5 1 83324 1.20013E-5 41662 0 3.18512E-5
12-121746498-A-G c.2057-4T>C splice_region ANAPC5 1 83322 1.20016E-5 41661 0 1.64894E-5
12-121746499-C-T c.2057-5G>A splice_region ANAPC5 1 83314 1.20028E-5 41657 0 3.18735E-5
12-121746500-G-A c.2057-6C>T splice_region ANAPC5 8 83276 9.60661E-5 41638 0 1.59256E-4
12-121746502-A-C c.2057-8T>G splice_region ANAPC5 3 83258 3.60326E-5 41629 0 2.4739E-5
12-121747512-T-C p.Lys683Arg missense ANAPC5 6 83222 7.20963E-5 41611 0 7.57703E-5
12-121747517-C-T p.Pro681Pro synonymous ANAPC5 759 83220 0.0091204 41610 9 0.02375
12-121747518-G-A p.Pro681Leu missense ANAPC5 3 83230 3.60447E-5 41615 0 7.44257E-5
12-121747525-C-T p.Asp679Asn missense ANAPC5 4 83272 4.80354E-5 41636 0 5.78197E-5
12-121747526-G-A p.Tyr678Tyr synonymous ANAPC5 7 83276 8.40578E-5 41638 0 1.99173E-5
12-121747526-G-GT p.Tyr678fs frameshift ANAPC5 2 83278 2.40159E-5 41639 0 NA
12-121747533-G-A p.Ala676Val missense ANAPC5 65 83276 7.80537E-4 41638 1 4.22048E-4
12-121747536-G-A p.Ala675Val missense ANAPC5 1 83290 1.20062E-5 41645 0 3.98134E-6
12-121747544-C-T p.Val672Val synonymous ANAPC5 2 83310 2.40067E-5 41655 0 NA
12-121747553-CT-C p.Lys669fs frameshift ANAPC5 1 83324 1.20013E-5 41662 0 3.1837E-5
12-121747564-A-T p.Leu666Ile missense ANAPC5 2 83338 2.39987E-5 41669 0 8.24457E-6
12-121747568-C-T p.Met664Ile missense ANAPC5 57 83334 6.83995E-4 41667 0 0.00165563
12-121747585-C-T p.Asp659Asn missense ANAPC5 2 83334 2.39998E-5 41667 0 3.97757E-6
12-121747586-C-T p.Leu658Leu synonymous ANAPC5 1 83334 1.19999E-5 41667 0 NA
12-121747597-C-T p.Gly655Arg missense ANAPC5 5 83334 5.99995E-5 41667 0 4.12507E-5
12-121747598-G-A p.Asp654Asp synonymous ANAPC5 3 83336 3.59988E-5 41668 0 0.00100908
12-121747615-C-T p.Glu649Lys missense ANAPC5 1 83310 1.20034E-5 41655 0 NA
12-121747616-G-A p.Ile648Ile synonymous ANAPC5 1 83304 1.20042E-5 41652 0 8.25928E-6
12-121747619-G-C p.Ala647Ala synonymous ANAPC5 1 83294 1.20057E-5 41647 0 NA
12-121747626-T-G p.His645Pro missense ANAPC5 1 83278 1.2008E-5 41639 0 NA
12-121747639-A-C p.Leu641Val missense ANAPC5 2 83206 2.40367E-5 41603 0 NA
12-121747640-G-A p.Ala640Ala synonymous ANAPC5 2 83198 2.4039E-5 41599 0 3.18471E-5
12-121747667-C-A c.1894-1G>T splice_acceptor ANAPC5 1 82646 1.20998E-5 41323 0 NA
12-121747669-G-A c.1894-3C>T splice_region ANAPC5 1 82548 1.21142E-5 41274 0 3.18776E-5
12-121756072-C-T c.1893+8G>A splice_region ANAPC5 8 82622 9.68265E-5 41311 0 1.08186E-4
12-121756073-G-A c.1893+7C>T splice_region ANAPC5 11 82674 1.33053E-4 41337 0 0.00125
12-121756079-C-G c.1893+1G>C splice_donor ANAPC5 1 82884 1.20651E-5 41442 0 NA
12-121756083-C-T p.Ala630Ala synonymous ANAPC5 2 82904 2.41243E-5 41452 0 3.1841E-5
12-121756083-C-A p.Ala630Ala synonymous ANAPC5 3 82904 3.61864E-5 41452 0 2.69445E-5
12-121756084-G-A p.Ala630Val missense ANAPC5 479 82854 0.00578125 41427 4 0.00624283
12-121756092-C-T p.Leu627Leu synonymous ANAPC5 1 82982 1.20508E-5 41491 0 8.93591E-6
12-121756098-C-G p.Leu625Leu synonymous ANAPC5 1 83240 1.20135E-5 41620 0 6.36943E-5
12-121756104-T-G p.Thr623Thr synonymous ANAPC5 9 83260 1.08095E-4 41630 0 5.04032E-4
12-121756107-T-G p.Glu622Asp missense ANAPC5 1 83266 1.20097E-5 41633 0 NA
12-121756113-G-A p.Leu395Phe missense ANAPC5 1 83288 1.20065E-5 41644 0 1.35445E-5
12-121756129-C-T p.Arg615Gln missense ANAPC5 1 83330 1.20005E-5 41665 0 6.37064E-5
12-121756130-G-A p.Arg615Trp missense ANAPC5 1 83330 1.20005E-5 41665 0 8.63961E-6
12-121756138-T-C p.Lys612Arg missense ANAPC5 1 83332 1.20002E-5 41666 0 6.25E-4
12-121756170-C-T p.Ala376Thr missense ANAPC5 1 83328 1.20008E-5 41664 0 6.25E-4
12-121756173-C-T p.Ala375Thr missense ANAPC5 1 83324 1.20013E-5 41662 0 8.4448E-6
12-121756174-G-A p.Ala600Val missense ANAPC5 2 83322 2.40033E-5 41661 0 6.01487E-5
12-121756176-G-A p.Arg374Cys missense ANAPC5 20 83322 2.40033E-4 41661 0 0.0040282
12-121756178-T-G p.Ile599Leu missense ANAPC5 3 83332 3.60006E-5 41666 0 9.56023E-5
12-121756194-T-A p.Ile368Phe missense ANAPC5 4 83326 4.80042E-5 41663 0 5.03525E-4
12-121756195-C-T p.Arg593Gln missense ANAPC5 2 83328 2.40015E-5 41664 0 4.0211E-6
12-121756195-C-A p.Arg593Leu missense ANAPC5 1 83328 1.20008E-5 41664 0 NA
12-121756196-G-A p.Arg593* stop_gained ANAPC5 2 83322 2.40033E-5 41661 0 6.37186E-5
12-121756200-G-A p.Tyr591Tyr synonymous ANAPC5 4 83332 4.80008E-5 41666 0 8.40562E-6
12-121756201-T-C p.Tyr591Cys missense ANAPC5 1 83334 1.19999E-5 41667 0 NA
12-121756206-C-T p.Ala364Thr missense+splice_region ANAPC5 1 83342 1.19988E-5 41671 0 NA
12-121756214-C-T p.Val587Met missense ANAPC5 2 83336 2.39992E-5 41668 0 0.00100705
12-121756215-G-A c.1089-8C>T splice_region ANAPC5 12 83336 1.43995E-4 41668 0 5.96933E-4
12-121756223-G-A p.Leu584Leu synonymous ANAPC5 7 83356 8.39772E-5 41678 0 4.18767E-5
12-121756227-ACTGACCGTAAAGAGGAAAACACAGGATGAGAAGATCCACCACCACATCTCCGTGAGATGTACAAGAGACCCCTTAC-A c.1745+1_1746-1delGTAAGGGGTCTCTTGTACATCTCACGGAGATGTGGTGGTGGATCTTCTCATCCTGTGTTTTCCTCTTTACGGTCAG splice_acceptor ANAPC5 7 83354 8.39792E-5 41677 0 NA
12-121756229-T-C c.1746-2A>G splice_acceptor ANAPC5 2 83356 2.39935E-5 41678 0 2.81554E-5
12-121756234-G-A c.1746-7C>T splice_region ANAPC5 87 83372 0.00104352 41686 0 0.00200739
12-121756296-C-T c.1745+8G>A splice_region ANAPC5 1 83402 1.19901E-5 41701 0 2.78534E-5
12-121756297-C-T c.1745+7G>A splice_region ANAPC5 1 83400 1.19904E-5 41700 0 NA
12-121756308-T-C p.Ile581Val missense ANAPC5 1 83402 1.19901E-5 41701 0 NA
12-121756367-T-C p.His561Arg missense ANAPC5 2 83348 2.39958E-5 41674 0 1.48295E-4
12-121756378-C-T p.Met557Ile missense ANAPC5 2 83330 2.4001E-5 41665 0 3.29582E-5
12-121756405-C-G p.Ala548Ala synonymous ANAPC5 4 83258 4.80434E-5 41629 0 3.29902E-5
12-121756406-G-A p.Ala548Val missense ANAPC5 106 83248 0.0012733 41624 0 0.00213294
12-121756413-T-C c.1638-2A>G splice_acceptor ANAPC5 1 83236 1.2014E-5 41618 0 NA
12-121756413-T-G c.1638-2A>C splice_acceptor ANAPC5 3 83236 3.60421E-5 41618 0 3.1835E-5
12-121757508-A-G p.Gly543Gly synonymous ANAPC5 1 82942 1.20566E-5 41471 0 8.68629E-6
12-121757510-C-T p.Gly543Ser missense ANAPC5 1 82976 1.20517E-5 41488 0 4.06375E-6
12-121757511-C-A p.Glu542Asp missense ANAPC5 1 82982 1.20508E-5 41491 0 8.64469E-6
12-121757525-G-C p.Leu538Val missense ANAPC5 1 83030 1.20438E-5 41515 0 0.00100705
12-121757539-G-A p.Thr533Ile missense ANAPC5 1 83038 1.20427E-5 41519 0 3.1902E-5
12-121757548-G-A p.Ser530Leu missense ANAPC5 2 83042 2.40842E-5 41521 0 3.19244E-5
12-121757549-A-C p.Ser530Ala missense ANAPC5 1 83046 1.20415E-5 41523 0 3.18613E-5
12-121757550-A-G p.Asp529Asp synonymous ANAPC5 1 83036 1.2043E-5 41518 0 7.57142E-5
12-121757575-T-C p.Asn521Ser missense ANAPC5 15 82954 1.80823E-4 41477 0 0.001875
12-121757580-T-C p.Ala519Ala synonymous ANAPC5 4 82942 4.82265E-5 41471 0 3.33834E-5
12-121757597-T-C p.Ile514Val missense ANAPC5 1 82878 1.20659E-5 41439 0 NA
12-121757604-A-T p.Asp511Glu missense ANAPC5 1 82832 1.20726E-5 41416 0 NA
12-121757607-A-C p.Cys510Trp missense ANAPC5 1 82814 1.20753E-5 41407 0 NA
12-121757612-G-A p.Leu509Leu synonymous ANAPC5 1 82782 1.20799E-5 41391 0 NA
12-121757614-A-G p.Met508Thr missense ANAPC5 1 82788 1.2079E-5 41394 0 NA
12-121757615-T-G p.Met508Leu missense ANAPC5 1 82768 1.2082E-5 41384 0 NA
12-121757617-C-CCAATCTCAA p.Trp507delinsPheGluIleGly conservative_inframe_insertion ANAPC5 1 82756 1.20837E-5 41378 0 NA
12-121757618-A-G p.Trp507Arg missense ANAPC5 1 82742 1.20858E-5 41371 0 9.5645E-5
12-121757622-C-CTGGGCGTGCTGACTAT c.1516-2_1516-1insATAGTCAGCACGCCCA splice_acceptor ANAPC5 8 82712 9.67212E-5 41356 4 NA
12-121757623-T-TGGGCGTGCTGACTATTAGGCGGAAATCGTTCCTTCAAGTGCTTTAACACTTC c.1516-3_1516-2insGAAGTGTTAAAGCACTTGAAGGAACGATTTCCGCCTAATAGTCAGCACGCCC splice_region ANAPC5 2 82660 2.41955E-5 41330 1 NA
12-121758193-C-T p.Ala504Thr missense ANAPC5 3 83186 3.60638E-5 41593 0 3.18654E-5
12-121758194-G-A p.His503His synonymous ANAPC5 3 83190 3.6062E-5 41595 0 5.03525E-4
12-121758201-C-T p.Ser501Asn missense ANAPC5 1 83240 1.20135E-5 41620 0 NA
12-121758203-A-G p.Asn500Asn synonymous ANAPC5 2 83234 2.40286E-5 41617 0 7.95387E-6
12-121758204-T-A p.Asn500Ile missense ANAPC5 1 83238 1.20137E-5 41619 0 NA
12-121758206-A-T p.Pro499Pro synonymous ANAPC5 502 83236 0.00603104 41618 8 0.0118168
12-121758210-G-A p.Pro498Leu missense ANAPC5 20 83258 2.40217E-4 41629 0 2.22482E-4
12-121758233-T-C p.Leu490Leu synonymous ANAPC5 13 83224 1.56205E-4 41612 0 6.36314E-5
12-121758244-A-G p.Ser487Pro missense ANAPC5 1 83176 1.20227E-5 41588 0 8.24906E-6
12-121758253-C-G p.Ala484Pro missense ANAPC5 2 83144 2.40547E-5 41572 0 NA
12-121758265-A-C c.1441-3T>G splice_region ANAPC5 2 83032 2.40871E-5 41516 0 1.65317E-5
12-121764899-C-T p.Gln480Gln splice_region+synonymous ANAPC5 1 80252 1.24607E-5 40126 0 NA
12-121764905-C-T p.Ala478Ala synonymous ANAPC5 1 80378 1.24412E-5 40189 0 1.24531E-5
12-121764907-C-T p.Ala478Thr missense ANAPC5 1 80398 1.24381E-5 40199 0 NA
12-121764908-G-A p.His477His synonymous ANAPC5 6 80542 7.44953E-5 40271 0 3.18309E-5
12-121764920-G-A p.Leu473Leu synonymous ANAPC5 1 81014 1.23435E-5 40507 0 3.3269E-5
12-121764923-G-A p.His472His synonymous ANAPC5 61 81122 7.51954E-4 40561 0 0.00352467
12-121764932-T-G p.Ala469Ala synonymous ANAPC5 1 81318 1.22974E-5 40659 0 NA
12-121764934-C-T p.Ala469Thr missense ANAPC5 1 81292 1.23013E-5 40646 0 NA
12-121764935-G-A p.Val468Val synonymous ANAPC5 40 81338 4.91775E-4 40669 0 4.14013E-4
12-121764963-T-G p.Gln459Pro missense ANAPC5 1 81758 1.22312E-5 40879 0 8.26706E-6
12-121764968-G-A p.Gly457Gly synonymous ANAPC5 5 81738 6.11711E-5 40869 0 5.03525E-4
12-121764971-C-T p.Ala456Ala synonymous ANAPC5 2 81802 2.44493E-5 40901 0 3.59299E-5
12-121764980-C-T p.Ala453Ala synonymous ANAPC5 1 81878 1.22133E-5 40939 0 2.39531E-5
12-121764987-A-G p.Leu451Pro missense ANAPC5 10 81894 1.22109E-4 40947 0 1.27364E-4
12-121764988-G-C p.Leu451Val missense ANAPC5 1 81868 1.22148E-5 40934 0 3.1837E-5
12-121764990-C-T p.Ser450Asn missense ANAPC5 1 81844 1.22184E-5 40922 0 6.36862E-5
12-121765019-T-C p.Gln440Gln synonymous ANAPC5 1 81604 1.22543E-5 40802 0 6.3678E-5
12-121765024-G-A p.Leu439Leu synonymous ANAPC5 1 81496 1.22705E-5 40748 0 NA
12-121765041-G-A c.1305-7C>T splice_region ANAPC5 3 80796 3.71306E-5 40398 0 6.05777E-5
12-121766118-C-G c.1304+1G>C splice_donor ANAPC5 2 82996 2.40975E-5 41498 0 NA
12-121766123-G-A p.Arg434Cys missense ANAPC5 1 83090 1.20351E-5 41545 0 1.19474E-5
12-121766130-C-A p.Leu431Leu synonymous ANAPC5 11 83146 1.32297E-4 41573 0 9.5645E-5
12-121766142-G-A p.Ala427Ala synonymous ANAPC5 4 83208 4.80723E-5 41604 0 3.18918E-5
12-121766145-C-T p.Thr426Thr synonymous ANAPC5 1 83212 1.20175E-5 41606 0 3.18979E-5
12-121766157-G-A p.Ile422Ile synonymous ANAPC5 1 83258 1.20109E-5 41629 0 3.97738E-6
12-121766169-G-A p.Ile418Ile synonymous ANAPC5 14 83278 1.68112E-4 41639 0 5.64779E-4
12-121766187-G-C p.His412Gln missense ANAPC5 1 83280 1.20077E-5 41640 0 NA
12-121766189-G-A p.His412Tyr missense ANAPC5 2 83278 2.40159E-5 41639 0 8.24198E-6
12-121766196-G-A p.His409His synonymous ANAPC5 1 83286 1.20068E-5 41643 0 NA
12-121766201-G-A p.Leu408Leu synonymous ANAPC5 1 83288 1.20065E-5 41644 0 3.97719E-6
12-121766203-A-T p.Leu407His missense ANAPC5 2 83292 2.40119E-5 41646 0 NA
12-121766203-AGGTC-A p.Asp406fs frameshift ANAPC5 1 83292 1.2006E-5 41646 0 NA
12-121766208-G-A p.Ser405Ser synonymous ANAPC5 5 83286 6.00341E-5 41643 0 3.29728E-5
12-121766219-G-A p.Leu402Leu synonymous ANAPC5 2 83282 2.40148E-5 41641 0 8.2447E-6
12-121766237-T-C p.Asn396Asp missense ANAPC5 1 83264 1.201E-5 41632 0 3.18878E-5
12-121766250-A-G p.Leu213Pro missense ANAPC5 1 83258 1.20109E-5 41629 0 8.25028E-6
12-121766269-A-G p.Val385Ala missense ANAPC5 2 83238 2.40275E-5 41619 0 NA
12-121766279-G-A p.Gln382* stop_gained ANAPC5 1 83184 1.20215E-5 41592 0 3.98023E-6
12-121768386-C-T p.Pro374Pro splice_region+synonymous ANAPC5 1 82942 1.20566E-5 41471 0 NA
12-121768387-G-A p.Pro374Leu missense+splice_region ANAPC5 3 82946 3.61681E-5 41473 0 1.59843E-5
12-121768400-G-A p.His370Tyr missense ANAPC5 4 83018 4.81823E-5 41509 0 7.96864E-6
12-121768401-T-C p.Val369Val synonymous ANAPC5 6 83014 7.2277E-5 41507 0 3.30366E-5
12-121768411-T-C p.Lys366Arg missense ANAPC5 5 83062 6.0196E-5 41531 0 1.23416E-4
12-121768443-G-A p.Ser355Ser synonymous ANAPC5 4 83090 4.81406E-5 41545 0 3.30147E-5
12-121768446-T-C p.Arg354Arg synonymous ANAPC5 1 83090 1.20351E-5 41545 0 8.25464E-6
12-121768464-A-G p.Tyr348Tyr synonymous ANAPC5 1 83084 1.2036E-5 41542 0 7.96356E-6
12-121768483-G-C p.Ser8Cys missense ANAPC5 10 82958 1.20543E-4 41479 0 4.44586E-4
12-121768492-T-C p.Asp5Gly missense ANAPC5 1 82836 1.2072E-5 41418 0 3.18471E-5
12-121768498-TATATC-T p.Met1fs frameshift ANAPC5 1 82754 1.2084E-5 41377 0 NA
12-121768499-A-G p.Tyr3His missense ANAPC5 1 82744 1.20855E-5 41372 0 7.99284E-6
12-121768505-T-A p.Met1? initiator_codon ANAPC5 1 82586 1.21086E-5 41293 0 6.36943E-5
12-121768510-G-A c.-5C>T 5_prime_UTR_premature_start_codon_gain ANAPC5 1 82472 1.21253E-5 41236 0 3.1841E-5
12-121768637-T-C c.-132A>G 5_prime_UTR_premature_start_codon_gain ANAPC5 13 51252 2.53649E-4 25626 0 1.91058E-4
12-121768730-T-G c.-225A>C 5_prime_UTR_premature_start_codon_gain ANAPC5 1 17192 5.81666E-5 8596 0 NA
12-121768752-A-G c.-247T>C 5_prime_UTR_premature_start_codon_gain ANAPC5 1 13286 7.52672E-5 6643 0 NA
12-121768994-T-C c.-489A>G 5_prime_UTR_premature_start_codon_gain ANAPC5 1 62754 1.59352E-5 31377 0 NA
12-121769087-G-A c.-582C>T 5_prime_UTR_premature_start_codon_gain ANAPC5 1 77992 1.28218E-5 38996 0 NA
12-121769114-G-A c.-609C>T 5_prime_UTR_premature_start_codon_gain ANAPC5 9 80796 1.11392E-4 40398 0 2.42142E-5
12-121769136-G-A c.-631C>T 5_prime_UTR_premature_start_codon_gain ANAPC5 5 82202 6.08258E-5 41101 0 1.27364E-4
12-121769156-G-A c.-651C>T 5_prime_UTR_premature_start_codon_gain ANAPC5 1 82890 1.20642E-5 41445 0 NA
12-121769171-G-T p.His337Gln missense ANAPC5 1 83032 1.20435E-5 41516 0 NA
12-121769178-T-G p.Asn335Thr missense ANAPC5 1 83078 1.20369E-5 41539 0 NA
12-121769178-T-C p.Asn335Ser missense ANAPC5 5 83078 6.01844E-5 41539 0 1.19369E-5
12-121769204-C-T p.Glu326Glu synonymous ANAPC5 2 83104 2.40662E-5 41552 0 1.65815E-5
12-121769212-GG-TT p.AlaLeu323AlaMet missense ANAPC5 1 83078 1.20369E-5 41539 0 NA
12-121769222-T-A p.Ala320Ala synonymous ANAPC5 1 83014 1.20462E-5 41507 0 0.00251762
12-121769239-C-T c.951-8G>A splice_region ANAPC5 1 82838 1.20718E-5 41419 0 6.36902E-5
12-121773343-C-T p.Gly315Ser missense ANAPC5 1 83108 1.20325E-5 41554 0 2.84209E-5
12-121773344-G-A p.Phe314Phe synonymous ANAPC5 1 83142 1.20276E-5 41571 0 5.05051E-4
12-121773349-G-A p.Arg313Cys missense ANAPC5 2 83178 2.40448E-5 41589 0 4.02353E-6
12-121773359-G-C p.Ala309Ala synonymous ANAPC5 1 83224 1.20158E-5 41612 0 NA
12-121773362-G-A p.Ala308Ala synonymous ANAPC5 2 83232 2.40292E-5 41616 0 6.61583E-5
12-121773376-C-T p.Ala304Thr missense ANAPC5 2 83266 2.40194E-5 41633 0 8.25205E-6
12-121773376-C-A p.Ala304Ser missense ANAPC5 1 83266 1.20097E-5 41633 0 NA
12-121773377-G-A p.Ala303Ala synonymous ANAPC5 13 83278 1.56104E-4 41639 1 4.37724E-5
12-121773380-G-A p.Tyr302Tyr synonymous ANAPC5 3 83296 3.60161E-5 41648 0 2.7856E-5
12-121773383-T-C p.Arg301Arg synonymous ANAPC5 1 83314 1.20028E-5 41657 0 NA
12-121773393-C-T p.Arg298Gln missense ANAPC5 2 83332 2.40004E-5 41666 0 3.18552E-5
12-121773394-G-A p.Arg298Trp missense ANAPC5 1 83340 1.1999E-5 41670 0 NA
12-121773406-CT-C p.Glu294fs frameshift ANAPC5 2 83366 2.39906E-5 41683 0 1.19316E-5
12-121773411-C-G p.Gly292Ala missense ANAPC5 2 83368 2.399E-5 41684 0 3.18532E-5
12-121773413-A-G p.Asn291Asn synonymous ANAPC5 2 83374 2.39883E-5 41687 0 NA
12-121773414-T-G p.Asn291Thr missense ANAPC5 1 83368 1.1995E-5 41684 0 NA
12-121773428-G-A p.Ala286Ala synonymous ANAPC5 1 83370 1.19947E-5 41685 0 3.9769E-6
12-121773431-T-G p.Gly285Gly synonymous ANAPC5 14 83364 1.67938E-4 41682 0 2.4657E-4
12-121773434-G-A p.Thr284Thr synonymous ANAPC5 1 83366 1.19953E-5 41683 0 2.38624E-5
12-121773445-G-A p.Leu281Leu synonymous ANAPC5 7 83376 8.3957E-5 41688 0 9.885E-5
12-121773463-G-T p.Leu275Ile missense ANAPC5 1 83394 1.19913E-5 41697 0 NA
12-121773467-A-G p.Ser273Ser synonymous ANAPC5 1 83390 1.19918E-5 41695 0 3.18451E-5
12-121773480-C-T p.Ser269Asn missense ANAPC5 1 83390 1.19918E-5 41695 0 NA
12-121773488-A-G p.Asp266Asp synonymous ANAPC5 97 83378 0.00116338 41689 0 0.00286533
12-121773527-C-T c.760-1G>A splice_acceptor ANAPC5 1 83280 1.20077E-5 41640 0 NA
12-121773529-A-G c.760-3T>C splice_region ANAPC5 1 83230 1.20149E-5 41615 0 NA
12-121775094-C-T p.Ala253Ala splice_region+synonymous ANAPC5 17 82616 2.05771E-4 41308 0 5.03525E-4
12-121775100-A-C p.Ala251Ala synonymous ANAPC5 1 82766 1.20823E-5 41383 0 5.03525E-4
12-121775163-G-C p.Ala230Ala synonymous ANAPC5 3 82998 3.61454E-5 41499 0 3.9846E-6
12-121775187-C-G p.Leu222Phe missense ANAPC5 1 82844 1.20709E-5 41422 0 NA
12-121779801-C-T c.657+5G>A splice_region ANAPC5 4 82698 4.83688E-5 41349 1 4.0292E-6
12-121779803-T-TA c.657+2_657+3insT splice_donor ANAPC5 2 82684 2.41885E-5 41342 0 NA
12-121779810-T-C p.Gln218Arg missense ANAPC5 1 82810 1.20758E-5 41405 0 NA
12-121779844-G-A p.Leu207Leu synonymous ANAPC5 1 82896 1.20633E-5 41448 0 3.18857E-5
12-121779845-A-C p.Pro206Pro synonymous ANAPC5 1 82880 1.20656E-5 41440 0 NA
12-121779876-G-GA c.591-5_591-4insT splice_region ANAPC5 2 82440 2.42601E-5 41220 0 1.20011E-4
12-121779876-GAAAAAATA-G c.591-12_591-5delTATTTTTT splice_region ANAPC5 1 82442 1.21297E-5 41221 0 NA
12-121779876-GA-G c.591-5delT splice_region ANAPC5 2 82442 2.42595E-5 41221 0 NA
12-121779876-GAA-G c.591-6_591-5delTT splice_region ANAPC5 1 82442 1.21297E-5 41221 0 NA
12-121783644-T-C p.Val196Val splice_region+synonymous ANAPC5 1 82968 1.20528E-5 41484 0 NA
12-121783667-T-C p.Lys189Glu missense ANAPC5 4 83218 4.80665E-5 41609 0 4.12671E-5
12-121783672-A-G p.Met187Thr missense ANAPC5 1 83254 1.20114E-5 41627 0 NA
12-121783684-C-A p.Gly183Val missense ANAPC5 1 83306 1.20039E-5 41653 0 3.98365E-6
12-121783693-C-T p.Arg180Lys missense ANAPC5 1 83326 1.20011E-5 41663 0 NA
12-121783696-C-T p.Ser179Asn missense ANAPC5 2 83326 2.40021E-5 41663 0 NA
12-121783711-T-A p.Asp174Val missense ANAPC5 2 83338 2.39987E-5 41669 0 NA
12-121783724-C-T p.Val170Met missense ANAPC5 10 83348 1.19979E-4 41674 0 7.15882E-5
12-121783724-C-G p.Val170Leu missense ANAPC5 3 83348 3.59937E-5 41674 0 3.29495E-5
12-121783727-T-C p.Thr169Ala missense ANAPC5 1 83346 1.19982E-5 41673 0 NA
12-121783739-C-T p.Gly165Ser missense ANAPC5 2 83344 2.39969E-5 41672 0 5.03525E-4
12-121783758-A-G n.566-4T>C splice_region ANAPC5 1 83338 1.19993E-5 41669 0 NA
12-121783780-A-C p.Val151Gly missense ANAPC5 1 83328 1.20008E-5 41664 0 NA
12-121783833-A-G p.Gly133Gly splice_region+synonymous ANAPC5 1 83228 1.20152E-5 41614 0 NA
12-121783838-C-CTACACTTGTTTTGTGAACCTCTGGTTCAGTTCCAGAGAAAGAATCTG p.Val11fs frameshift ANAPC5 1 83198 1.20195E-5 41599 0 NA
12-121783838-C-A n.565+1G>T splice_donor ANAPC5 4 83204 4.80746E-5 41602 0 9.55414E-5
12-121783848-C-T p.Ser7Ser synonymous ANAPC5 8 83036 9.63438E-5 41518 0 NA
12-121783849-G-A p.Ser7Leu missense ANAPC5 1 82964 1.20534E-5 41482 0 1.77261E-5
12-121783861-G-A p.Ser3Phe missense ANAPC5 3 82872 3.62004E-5 41436 0 NA
12-121784730-A-T p.Thr122Thr synonymous ANAPC5 4 83006 4.81893E-5 41503 0 0.001875
12-121784763-A-G p.Phe111Phe synonymous ANAPC5 2 83112 2.40639E-5 41556 0 8.03135E-6
12-121784787-G-A p.Gly103Gly synonymous ANAPC5 1 83014 1.20462E-5 41507 0 1.27421E-4
12-121784797-A-C p.Met1? start_lost ANAPC5 1 82980 1.20511E-5 41490 0 NA
12-121784798-T-C p.Met1? start_lost ANAPC5 1 82988 1.20499E-5 41494 0 3.1839E-5
12-121784807-T-C p.Ile97Val missense+splice_region ANAPC5 1 82940 1.20569E-5 41470 0 NA
12-121784811-G-GATCTGCACTGAATTTGCCAGCTGTGGACAAGACTCTTC c.288-4_288-3insGAAGAGTCTTGTCCACAGCTGGCAAATTCAGTGCAGAT splice_region ANAPC5 2 82842 2.41423E-5 41421 1 NA
12-121785606-T-C p.Arg96Gly missense+splice_region ANAPC5 1 82582 1.21092E-5 41291 0 NA
12-121785633-G-T p.Pro87Thr missense ANAPC5 1 82818 1.20747E-5 41409 0 NA
12-121785645-C-T p.Glu83Lys missense ANAPC5 24 82868 2.89617E-4 41434 0 0.00100705
12-121785646-A-C p.Ile82Met missense ANAPC5 1 82862 1.20683E-5 41431 0 6.36862E-5
12-121785648-T-C p.Ile82Val missense ANAPC5 1 82852 1.20697E-5 41426 0 1.64783E-5
12-121785652-C-T p.Lys80Lys synonymous ANAPC5 1 82822 1.20741E-5 41411 0 8.23927E-6
12-121785662-T-C p.Lys77Arg missense ANAPC5 2 82822 2.41482E-5 41411 0 1.59152E-5
12-121785668-A-G p.Leu75Pro missense ANAPC5 1 82786 1.20793E-5 41393 0 3.97924E-6
12-121785671-G-A p.Thr74Ile missense ANAPC5 1 82792 1.20785E-5 41396 0 NA
12-121785673-A-G p.Ile73Ile synonymous ANAPC5 1 82742 1.20858E-5 41371 0 NA
12-121785674-A-G p.Ile73Thr missense ANAPC5 1 82746 1.20852E-5 41373 0 NA
12-121785684-C-T p.Gly70Ser missense+splice_region ANAPC5 2 82606 2.42113E-5 41303 0 1.59286E-5
12-121785687-G-GCAGCAGGGGCAGGAGCAGCTGGTTGAGCCTCCGCCGC c.208-4_208-3insGCGGCGGAGGCTCAACCAGCTGCTCCTGCCCCTGCTG splice_region ANAPC5 2 82544 2.42295E-5 41272 1 NA
12-121785687-G-A c.208-3C>T splice_region ANAPC5 1 82544 1.21148E-5 41272 0 8.24538E-6
12-121785688-T-C c.208-4A>G splice_region ANAPC5 10 82516 1.21189E-4 41258 0 4.78221E-5
12-121788859-A-C c.351+4T>G splice_region ANAPC5 1 8968 1.11508E-4 4484 0 NA
12-121788870-T-C p.Gln115Arg missense ANAPC5 9 8968 0.00100357 4484 0 7.22543E-4
12-121788895-C-T p.Ala107Thr missense ANAPC5 1 8968 1.11508E-4 4484 0 NA
12-121788901-G-T p.Arg105Ser missense ANAPC5 2 8960 2.23214E-4 4480 0 6.37267E-5
12-121788905-T-A p.Pro103Pro synonymous ANAPC5 1 8958 1.11632E-4 4479 0 8.17261E-6
12-121788945-G-A p.Pro90Leu missense ANAPC5 3 8896 3.3723E-4 4448 0 0.00137012
12-121788952-T-C p.Ile88Val missense ANAPC5 1 8842 1.13097E-4 4421 0 NA
12-121788957-T-C p.Gln86Arg missense ANAPC5 2 8782 2.27739E-4 4391 0 8.29029E-4
12-121788974-G-C p.Ala80Ala synonymous ANAPC5 1 8496 1.17702E-4 4248 0 3.19163E-5
12-121789942-G-A c.-16C>T 5_prime_UTR_premature_start_codon_gain ANAPC5 2 80714 2.47788E-5 40357 0 1.71002E-5
12-121789950-A-C p.Leu65Arg missense ANAPC5 1 81038 1.23399E-5 40519 0 NA
12-121789951-G-A c.-25C>T 5_prime_UTR_premature_start_codon_gain ANAPC5 1 81072 1.23347E-5 40536 0 4.03538E-6
12-121789957-G-T p.Leu63Met missense ANAPC5 1 81044 1.2339E-5 40522 0 NA
12-121789962-T-C p.Asn61Ser missense ANAPC5 1 81090 1.2332E-5 40545 0 2.54755E-5
12-121789975-G-A p.Arg57Trp missense ANAPC5 1 81522 1.22666E-5 40761 0 3.18756E-5
12-121789978-C-T p.Glu56Lys missense ANAPC5 1 81720 1.22369E-5 40860 0 NA
12-121789980-A-T p.Met55Lys missense ANAPC5 1 81786 1.2227E-5 40893 0 1.68005E-5
12-121789986-C-A p.Ser53Ile missense ANAPC5 3 81848 3.66533E-5 40924 0 1.59305E-4
12-121789986-C-T p.Ser53Asn missense ANAPC5 2 81848 2.44355E-5 40924 0 1.6769E-5
12-121789990-C-A p.Val52Phe missense ANAPC5 2 81782 2.44553E-5 40891 0 NA
12-121789990-C-G p.Val52Leu missense ANAPC5 1 81782 1.22276E-5 40891 0 NA
12-121789993-C-A p.Ala51Ser missense ANAPC5 1 81790 1.22264E-5 40895 0 NA
12-121790012-C-T p.Met44Ile missense ANAPC5 5 82600 6.05327E-5 41300 0 9.55718E-5
12-121790022-A-G p.Leu41Pro missense ANAPC5 2 82818 2.41493E-5 41409 0 3.98019E-6
12-121790024-C-G p.Leu40Leu synonymous ANAPC5 76 82826 9.17586E-4 41413 0 0.00213485
12-121790026-G-A c.-100C>T 5_prime_UTR_premature_start_codon_gain ANAPC5 1 82884 1.20651E-5 41442 0 3.18573E-5
12-121790039-G-C p.Ile35Met missense ANAPC5 1 83052 1.20406E-5 41526 0 3.97893E-6
12-121790045-G-C p.Tyr33* stop_gained ANAPC5 4 83096 4.81371E-5 41548 0 4.96007E-5
12-121790052-G-A p.Thr31Met missense ANAPC5 4 83102 4.81336E-5 41551 0 NA
12-121790068-T-A p.Ile26Phe missense ANAPC5 1 83170 1.20236E-5 41585 0 3.18735E-5
12-121790079-T-C p.Asn22Ser missense ANAPC5 5 83174 6.01149E-5 41587 0 3.18243E-5
12-121790112-T-C p.Asn11Ser missense ANAPC5 1 83030 1.20438E-5 41515 0 NA
12-121790112-T-A p.Asn11Ile missense ANAPC5 1 83030 1.20438E-5 41515 0 1.59266E-5
12-121790129-G-A c.-203C>T 5_prime_UTR_premature_start_codon_gain ANAPC5 1 82566 1.21115E-5 41283 0 2.16927E-4
12-121790143-T-C p.Met1? start_lost ANAPC5 3 81716 3.67125E-5 40858 0 8.55769E-6
12-121790165-G-A c.-22C>T 5_prime_UTR_premature_start_codon_gain ANAPC5 2 78694 2.54149E-5 39347 0 1.83739E-5
12-121790215-G-A c.-72C>T 5_prime_UTR_premature_start_codon_gain ANAPC5 2 71114 2.81239E-5 35557 0 3.18959E-5
12-121790257-G-A c.-114C>T 5_prime_UTR_premature_start_codon_gain ANAPC5 1 56476 1.77066E-5 28238 0 NA
12-121837657-G-A c.-334C>T 5_prime_UTR_premature_start_codon_gain ANAPC5 3 11580 2.59067E-4 5790 0 NA
12-121837694-G-A c.-371C>T 5_prime_UTR_premature_start_codon_gain ANAPC5 1 23550 4.24628E-5 11775 0 NA