Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
9-140069424-G-A p.Gly813Gly synonymous ANAPC2 1 73054 1.36885E-5 36527 0 8.57118E-5
9-140069430-C-T p.Ser811Ser synonymous ANAPC2 12 74792 1.60445E-4 37396 0 6.25E-4
9-140069480-G-A p.Leu795Leu synonymous ANAPC2 2 80340 2.48942E-5 40170 0 NA
9-140069482-T-G p.Glu794Ala missense ANAPC2 1 80386 1.244E-5 40193 0 NA
9-140069495-T-C p.Ile790Val missense ANAPC2 1 80642 1.24005E-5 40321 0 NA
9-140069498-C-T p.Glu789Lys missense ANAPC2 1 80644 1.24002E-5 40322 0 8.08843E-5
9-140069499-G-A p.Ala788Ala synonymous ANAPC2 3 80614 3.72144E-5 40307 0 2.69397E-5
9-140069502-C-A p.Leu787Leu synonymous ANAPC2 4 80800 4.95049E-5 40400 0 3.19061E-5
9-140069506-G-A p.Ala786Val missense ANAPC2 2 80830 2.47433E-5 40415 0 NA
9-140069517-C-T p.Val782Val synonymous ANAPC2 26 81084 3.20655E-4 40542 0 0.00101215
9-140069528-T-C p.Met779Val missense ANAPC2 2 81302 2.45996E-5 40651 0 NA
9-140069530-C-T p.Arg778His missense ANAPC2 3 81302 3.68995E-5 40651 0 7.31565E-5
9-140069532-G-A p.Leu777Leu synonymous ANAPC2 7 81416 8.59782E-5 40708 0 6.65364E-5
9-140069532-G-C p.Leu777Leu synonymous ANAPC2 2 81416 2.45652E-5 40708 0 2.55281E-4
9-140069538-G-A p.Asn775Asn synonymous ANAPC2 1 81562 1.22606E-5 40781 0 NA
9-140069543-A-G p.Tyr774His missense ANAPC2 1 81658 1.22462E-5 40829 0 NA
9-140069588-G-T p.Gln759Lys missense ANAPC2 1 81722 1.22366E-5 40861 0 NA
9-140069595-C-T p.Thr756Thr synonymous ANAPC2 3 81618 3.67566E-5 40809 0 6.38081E-5
9-140069606-GCTGCGGACACAGGCCAGCCCCCGTCAGGCACCTGCAGGCCTCGCCCCCGCCCCCTGGCCCCCCGTGGGGCCTGCACGCGCAC-G c.2256+1_2257-1delGTGCGCGTGCAGGCCCCACGGGGGGCCAGGGGGCGGGGGCGAGGCCTGCAGGTGCCTGACGGGGGCTGGCCTGTGTCCGCAG splice_acceptor ANAPC2 6 81564 7.35619E-5 40782 0 NA
9-140069610-C-T c.2257-4G>A splice_region ANAPC2 6 81488 7.36305E-5 40744 0 1.52726E-4
9-140069611-G-A c.2257-5C>T splice_region ANAPC2 3 81504 3.6808E-5 40752 0 6.38366E-5
9-140069682-C-T c.2256+7G>A splice_region ANAPC2 13 81388 1.59729E-4 40694 0 7.8869E-5
9-140069682-C-A c.2256+7G>T splice_region ANAPC2 11 81388 1.35155E-4 40694 0 4.14541E-4
9-140069683-G-A c.2256+6C>T splice_region ANAPC2 2 81370 2.45791E-5 40685 0 6.3804E-5
9-140069698-C-T p.Glu749Glu synonymous ANAPC2 29 81922 3.53995E-4 40961 0 0.003125
9-140069701-C-T p.Glu748Glu synonymous ANAPC2 1 81996 1.21957E-5 40998 0 8.97666E-6
9-140069712-C-G p.Asp745His missense ANAPC2 2 82088 2.43641E-5 41044 0 NA
9-140069713-G-A p.Ala744Ala synonymous ANAPC2 5 82076 6.09191E-5 41038 0 9.56938E-5
9-140069730-C-T p.Gly739Ser missense ANAPC2 1 82256 1.21572E-5 41128 0 4.00869E-6
9-140069731-G-A p.Ser738Ser synonymous ANAPC2 6 82254 7.29448E-5 41127 0 4.81116E-5
9-140069736-C-T p.Asp737Asn missense ANAPC2 2 82284 2.43061E-5 41142 0 1.2024E-5
9-140069736-C-A p.Asp737Tyr missense ANAPC2 1 82284 1.2153E-5 41142 0 NA
9-140069737-G-A p.Ser736Ser synonymous ANAPC2 3 82260 3.64697E-5 41130 0 1.56329E-4
9-140069738-C-A p.Ser736Ile missense ANAPC2 1 82274 1.21545E-5 41137 0 NA
9-140069740-CTCG-C p.Asp734del disruptive_inframe_deletion ANAPC2 2 82332 2.42919E-5 41166 0 NA
9-140069743-G-A p.Asp734Asp synonymous ANAPC2 10 82274 1.21545E-4 41137 0 5.97076E-5
9-140069745-C-T p.Asp734Asn missense ANAPC2 1 82330 1.21462E-5 41165 0 5.04032E-4
9-140069751-T-C p.Ser732Gly missense ANAPC2 1 82338 1.21451E-5 41169 0 NA
9-140069757-T-C p.Ile730Val missense ANAPC2 1 82302 1.21504E-5 41151 0 3.60528E-5
9-140069758-G-A p.Leu729Leu synonymous ANAPC2 1 82290 1.21521E-5 41145 0 8.53286E-6
9-140069763-C-G p.Val728Leu missense ANAPC2 1 82200 1.21655E-5 41100 0 NA
9-140069764-C-T p.Met727Ile missense ANAPC2 1 82202 1.21652E-5 41101 0 NA
9-140069768-T-C p.Asn726Ser missense ANAPC2 2 82182 2.43362E-5 41091 0 8.58472E-6
9-140069769-T-G p.Asn726His missense ANAPC2 1 82162 1.21711E-5 41081 0 NA
9-140069770-G-T p.Asp725Glu missense ANAPC2 2 82126 2.43528E-5 41063 0 1.54708E-4
9-140069774-C-T p.Arg724Gln missense ANAPC2 3 81896 3.66318E-5 40948 0 3.18817E-5
9-140069776-G-C p.Asp723Glu missense ANAPC2 1 81850 1.22175E-5 40925 0 NA
9-140069783-G-A p.Pro721Leu missense ANAPC2 1 81582 1.22576E-5 40791 0 8.7687E-6
9-140069784-G-A p.Pro721Ser missense ANAPC2 1 81500 1.22699E-5 40750 0 3.21368E-5
9-140069786-C-T p.Arg720Gln missense ANAPC2 1 81430 1.22805E-5 40715 0 7.06427E-5
9-140069787-GCTC-G p.Glu719del conservative_inframe_deletion ANAPC2 2 81302 2.45996E-5 40651 0 8.84017E-6
9-140069788-C-T p.Glu719Glu synonymous ANAPC2 1 81304 1.22995E-5 40652 0 NA
9-140069814-C-T p.Gly711Ser missense ANAPC2 5 79306 6.30469E-5 39653 0 8.87276E-5
9-140069815-G-A p.Pro710Pro synonymous ANAPC2 5 79330 6.30279E-5 39665 0 1.18676E-4
9-140069819-G-T p.Pro709His missense ANAPC2 1 78890 1.26759E-5 39445 0 NA
9-140069821-C-A p.Glu708Asp missense ANAPC2 20 78662 2.54252E-4 39331 0 0.00201816
9-140069828-C-T p.Arg706His missense ANAPC2 166 77862 0.00213198 38931 0 0.00154707
9-140069841-G-C p.Gln702Glu missense ANAPC2 1 76374 1.30935E-5 38187 0 3.18776E-5
9-140069851-C-T p.Val698Val synonymous ANAPC2 1 75584 1.32303E-5 37792 0 3.18715E-5
9-140069854-G-A p.Ser697Ser synonymous ANAPC2 64 75128 8.51879E-4 37564 0 8.5075E-4
9-140069857-C-T p.Met696Ile missense ANAPC2 2 74820 2.67308E-5 37410 0 NA
9-140069861-C-T p.Arg695Gln missense ANAPC2 2 74300 2.69179E-5 37150 0 3.18735E-5
9-140069866-C-G p.Arg693Arg synonymous ANAPC2 1 74062 1.35022E-5 37031 0 NA
9-140069867-C-T p.Arg693Gln missense ANAPC2 5 74086 6.74891E-5 37043 0 3.18776E-5
9-140069868-G-A p.Arg693Trp missense ANAPC2 1 73972 1.35186E-5 36986 0 4.26015E-5
9-140069875-C-T p.Ala690Ala synonymous ANAPC2 111 73602 0.00150811 36801 0 0.00156825
9-140069880-C-T p.Val689Met missense ANAPC2 1 73344 1.36344E-5 36672 0 4.77525E-5
9-140069881-G-A p.Pro688Pro synonymous ANAPC2 3 73224 4.09702E-5 36612 0 9.56023E-5
9-140069884-C-G p.Met687Ile missense ANAPC2 1 73100 1.36799E-5 36550 0 NA
9-140069886-T-A p.Met687Leu missense ANAPC2 1 73188 1.36634E-5 36594 0 NA
9-140069887-C-G p.Lys686Asn missense ANAPC2 7 73176 9.56598E-5 36588 1 2.22944E-4
9-140069891-A-G p.Val685Ala missense ANAPC2 1 72868 1.37234E-5 36434 0 NA
9-140069893-C-T p.Ala684Ala synonymous ANAPC2 36 72874 4.94003E-4 36437 0 0.00101626
9-140069894-G-A p.Ala684Val missense ANAPC2 5 72744 6.87342E-5 36372 0 4.75312E-6
9-140069896-C-T p.Lys683Lys synonymous ANAPC2 6 72962 8.22346E-5 36481 0 6.37024E-5
9-140069909-T-C p.Glu679Gly missense ANAPC2 3 72674 4.12802E-5 36337 0 5.27282E-6
9-140069928-C-T c.2021-4G>A splice_region ANAPC2 13 72342 1.79702E-4 36171 0 4.96076E-4
9-140069932-C-T c.2021-8G>A splice_region ANAPC2 1 72670 1.37608E-5 36335 0 6.32215E-6
9-140069932-C-G c.2021-8G>C splice_region ANAPC2 1 72670 1.37608E-5 36335 0 NA
9-140070167-C-T p.Gln671Gln synonymous ANAPC2 1 81684 1.22423E-5 40842 0 3.18552E-5
9-140070176-C-G p.Leu668Leu synonymous ANAPC2 3 81798 3.66757E-5 40899 0 9.25703E-6
9-140070188-C-T p.Ala664Ala synonymous ANAPC2 205 81904 0.00250293 40952 0 0.00235759
9-140070206-C-T p.Ala658Ala synonymous ANAPC2 78 82016 9.51034E-4 41008 1 0.002687
9-140070213-G-C p.Ser656Cys missense ANAPC2 2 82074 2.43683E-5 41037 0 9.67436E-6
9-140070215-C-G p.Leu655Leu synonymous ANAPC2 3 82068 3.65551E-5 41034 0 0.00125
9-140070221-G-A p.Arg653Arg synonymous ANAPC2 1 82018 1.21924E-5 41009 0 3.18593E-5
9-140070222-C-T p.Arg653His missense ANAPC2 1 82026 1.21913E-5 41013 0 1.22192E-5
9-140070227-G-A p.Ala651Ala synonymous ANAPC2 2 81988 2.43938E-5 40994 0 1.01533E-4
9-140070239-G-A p.Asp647Asp synonymous ANAPC2 4 81880 4.8852E-5 40940 0 3.19809E-5
9-140070253-G-A p.Leu643Leu synonymous ANAPC2 1 81780 1.22279E-5 40890 0 NA
9-140070278-G-A p.Thr634Thr synonymous ANAPC2 1 81398 1.22853E-5 40699 0 2.59296E-5
9-140070281-C-G p.Arg633Arg synonymous ANAPC2 2 81310 2.45972E-5 40655 0 1.3112E-5
9-140070294-G-T c.1891-5C>A splice_region ANAPC2 1 80866 1.23661E-5 40433 0 NA
9-140070447-G-T n.70+8C>A splice_region ANAPC2 2 48446 4.12831E-5 24223 0 3.18735E-5
9-140070450-C-G n.70+5G>C splice_region ANAPC2 1 47578 2.10181E-5 23789 0 NA
9-140074629-G-A c.1890+4C>T splice_region ANAPC2 2 82542 2.42301E-5 41271 0 NA
9-140074648-C-T p.Lys625Lys synonymous ANAPC2 1 82846 1.20706E-5 41423 0 8.46683E-6
9-140074651-C-T p.Lys624Lys synonymous ANAPC2 5 82884 6.03253E-5 41442 0 0.00125
9-140074662-C-T p.Ala621Thr missense ANAPC2 2 82934 2.41156E-5 41467 0 2.5113E-5
9-140074675-C-A p.Arg616Ser missense ANAPC2 1 82994 1.20491E-5 41497 0 NA
9-140074683-C-T p.Asp614Asn missense ANAPC2 1 82996 1.20488E-5 41498 0 3.98349E-6
9-140074687-G-A p.Pro612Pro synonymous ANAPC2 2 83000 2.40964E-5 41500 0 8.30523E-6
9-140074698-G-A p.Leu609Leu synonymous ANAPC2 1 83022 1.2045E-5 41511 0 3.18573E-5
9-140074705-G-A p.Asp606Asp synonymous ANAPC2 1 83014 1.20462E-5 41507 0 3.31609E-5
9-140074708-C-T p.Lys605Lys synonymous ANAPC2 1 83032 1.20435E-5 41516 0 3.98203E-6
9-140074735-C-T p.Leu596Leu synonymous ANAPC2 2 83026 2.40888E-5 41513 0 3.98153E-6
9-140074738-G-T p.Ile595Ile synonymous ANAPC2 2 83022 2.409E-5 41511 0 8.28789E-6
9-140074741-G-A p.Val594Val synonymous ANAPC2 1 83004 1.20476E-5 41502 0 NA
9-140074744-A-G p.Ala593Ala synonymous ANAPC2 1 82980 1.20511E-5 41490 0 3.98194E-6
9-140074745-G-A p.Ala593Val missense ANAPC2 1 82960 1.2054E-5 41480 0 NA
9-140074747-G-A p.Tyr592Tyr synonymous ANAPC2 1 82948 1.20557E-5 41474 0 8.29421E-6
9-140074756-G-A p.Phe589Phe synonymous ANAPC2 7 82922 8.44167E-5 41461 0 5.03525E-4
9-140074759-C-T p.Pro588Pro synonymous ANAPC2 2 82904 2.41243E-5 41452 0 1.6605E-5
9-140074760-G-A p.Pro588Leu missense ANAPC2 2 82876 2.41324E-5 41438 0 3.18512E-5
9-140074779-G-A p.Pro582Ser missense ANAPC2 2 82662 2.41949E-5 41331 0 7.48976E-5
9-140074799-C-T p.Arg575Gln missense ANAPC2 22 82622 2.66273E-4 41311 0 0.001875
9-140074805-T-C p.Asn573Ser missense ANAPC2 1 82610 1.21051E-5 41305 0 3.99396E-6
9-140074829-G-A p.Ala565Val missense ANAPC2 1 80898 1.23612E-5 40449 0 3.18959E-5
9-140074835-TCCTGAGGAGGAGCCGGTGTCACGGGGGACCTGCGGGGCGGCCGGGCAGCGGGCGGGGCTGGGACCCA-T p.Asp563fs frameshift ANAPC2 9 81332 1.10658E-4 40666 1 NA
9-140074839-G-A c.1687-3C>T splice_region ANAPC2 1 81538 1.22642E-5 40769 0 NA
9-140074840-A-G c.1687-4T>C splice_region ANAPC2 1 81538 1.22642E-5 40769 0 4.0361E-6
9-140074909-G-A p.Leu561Leu synonymous ANAPC2 2 82762 2.41657E-5 41381 0 9.55414E-5
9-140074916-T-C p.Glu558Glu synonymous ANAPC2 5 82840 6.03573E-5 41420 0 6.37186E-5
9-140074925-G-A p.His555His synonymous ANAPC2 5 82876 6.03311E-5 41438 0 1.59236E-4
9-140074930-T-C p.Met554Val missense ANAPC2 1 82868 1.20674E-5 41434 0 3.18837E-5
9-140074931-T-C p.Pro553Pro synonymous ANAPC2 2 82872 2.41336E-5 41436 0 3.98543E-6
9-140074940-G-A p.Gly550Gly synonymous ANAPC2 15 82886 1.80971E-4 41443 0 4.14197E-4
9-140074967-G-A p.Asn541Asn synonymous ANAPC2 1 82878 1.20659E-5 41439 0 4.98753E-5
9-140074971-C-T p.Arg540His missense ANAPC2 2 82888 2.41289E-5 41444 0 NA
9-140074976-C-G p.Glu538Asp missense ANAPC2 1 82878 1.20659E-5 41439 0 NA
9-140075231-AG-A c.1610+8delC splice_region ANAPC2 2 81830 2.44409E-5 40915 0 NA
9-140075233-G-C c.1610+7C>G splice_region ANAPC2 2 81820 2.44439E-5 40910 0 NA
9-140075260-C-G p.Gln530His missense ANAPC2 2 82340 2.42895E-5 41170 0 NA
9-140075268-G-A p.Leu528Leu synonymous ANAPC2 1 82338 1.21451E-5 41169 0 3.18613E-5
9-140075271-G-A p.Leu527Leu synonymous ANAPC2 16 82396 1.94184E-4 41198 0 8.96914E-4
9-140075278-G-A p.Ala524Ala synonymous ANAPC2 2 82392 2.42742E-5 41196 0 5.01882E-5
9-140075283-G-A p.Leu523Leu synonymous ANAPC2 1 82420 1.2133E-5 41210 0 NA
9-140075287-C-G p.Ser521Ser synonymous ANAPC2 1 82424 1.21324E-5 41212 0 1.1994E-5
9-140075287-C-T p.Ser521Ser synonymous ANAPC2 1 82424 1.21324E-5 41212 0 3.33873E-5
9-140075288-G-A p.Ser521Leu missense ANAPC2 1 82460 1.21271E-5 41230 0 3.33767E-5
9-140075311-G-A p.Asp513Asp synonymous ANAPC2 1 82798 1.20776E-5 41399 0 1.66165E-5
9-140075314-C-T p.Lys512Lys synonymous ANAPC2 19 82826 2.29397E-4 41413 0 0.0020141
9-140075322-C-T p.Gly510Ser missense ANAPC2 1 82894 1.20636E-5 41447 0 1.19544E-5
9-140075323-G-A p.Tyr509Tyr synonymous ANAPC2 214 82904 0.0025813 41452 1 0.00672446
9-140075331-T-C p.Ser507Gly missense ANAPC2 1 82904 1.20621E-5 41452 0 6.37471E-5
9-140075340-G-A p.Leu504Leu synonymous ANAPC2 7 82910 8.44289E-5 41455 0 4.14504E-4
9-140075349-T-C p.Ile501Val missense ANAPC2 1 82906 1.20619E-5 41453 0 3.98464E-6
9-140075353-C-T p.Ser499Ser synonymous ANAPC2 16 82874 1.93064E-4 41437 0 6.25E-4
9-140075353-C-G p.Ser499Ser synonymous ANAPC2 1 82874 1.20665E-5 41437 0 3.98559E-6
9-140075354-G-A p.Ser499Leu missense ANAPC2 1 82870 1.20671E-5 41435 0 NA
9-140075361-G-A p.Arg497Cys missense ANAPC2 1 82804 1.20767E-5 41402 0 3.98667E-6
9-140075362-C-T p.Arg496Arg synonymous ANAPC2 1 82796 1.20779E-5 41398 0 NA
9-140075370-A-G p.Ser494Pro missense ANAPC2 1 82652 1.20989E-5 41326 0 NA
9-140075375-G-A p.Ser492Leu missense ANAPC2 1 82518 1.21186E-5 41259 0 4.98969E-5
9-140075378-T-C p.Lys491Arg missense ANAPC2 1 82486 1.21233E-5 41243 0 NA
9-140075381-C-G p.Gly490Ala missense+splice_region ANAPC2 1 82416 1.21336E-5 41208 0 3.99237E-6
9-140075384-G-A c.1469-3C>T splice_region ANAPC2 1 82342 1.21445E-5 41171 0 8.33139E-6
9-140075389-G-A c.1469-8C>T splice_region ANAPC2 2 82206 2.43291E-5 41103 0 NA
9-140076127-G-T c.1468+6C>A splice_region ANAPC2 1 81840 1.2219E-5 40920 0 NA
9-140076136-G-C p.Pro489Ala missense ANAPC2 3 81990 3.65898E-5 40995 0 2.85638E-5
9-140076140-G-A p.Ala487Ala synonymous ANAPC2 4 81984 4.879E-5 40992 0 8.35024E-6
9-140076155-C-T p.Pro482Pro synonymous ANAPC2 3 82336 3.64361E-5 41168 0 8.91615E-6
9-140076174-T-A p.Glu476Val missense ANAPC2 1 82494 1.21221E-5 41247 0 NA
9-140076184-C-T p.Asp473Asn missense ANAPC2 5 82490 6.06134E-5 41245 0 2.01238E-5
9-140076186-T-A p.Asp472Val missense ANAPC2 1 82462 1.21268E-5 41231 0 1.20814E-5
9-140076188-C-A p.Glu471Asp missense ANAPC2 2 82482 2.42477E-5 41241 1 3.18756E-5
9-140076193-T-C p.Ser470Gly missense ANAPC2 2 82440 2.42601E-5 41220 0 NA
9-140076196-C-G p.Asp469His missense ANAPC2 1 82462 1.21268E-5 41231 0 NA
9-140076200-G-C p.Gly467Gly synonymous ANAPC2 1 82420 1.2133E-5 41210 0 8.525E-6
9-140076203-T-C p.Thr466Thr synonymous ANAPC2 1 82426 1.21321E-5 41213 0 NA
9-140076212-G-A p.Ser463Ser synonymous ANAPC2 2 82278 2.43078E-5 41139 0 1.70724E-5
9-140076218-C-G p.Pro461Pro synonymous ANAPC2 1 82144 1.21737E-5 41072 0 4.04753E-6
9-140076223-C-T p.Asp460Asn missense ANAPC2 10 82002 1.21948E-4 41001 0 1.49823E-4
9-140076224-G-A p.Thr459Thr synonymous ANAPC2 3 82020 3.65764E-5 41010 0 5.94732E-5
9-140076256-T-A p.Thr449Ser missense ANAPC2 3 81930 3.66166E-5 40965 0 8.45995E-6
9-140076260-G-A p.Asp447Asp synonymous ANAPC2 3 81950 3.66077E-5 40975 0 6.92143E-5
9-140076266-G-A p.Asp445Asp synonymous ANAPC2 2 81890 2.4423E-5 40945 0 NA
9-140076272-C-T p.Thr443Thr synonymous ANAPC2 114 82118 0.00138825 41059 0 0.00168844
9-140076273-G-A p.Thr443Met missense ANAPC2 1 81996 1.21957E-5 40998 0 NA
9-140076293-C-T p.Arg436Arg synonymous ANAPC2 1 82428 1.21318E-5 41214 0 8.49805E-6
9-140076299-T-C p.Thr434Thr synonymous ANAPC2 1 82336 1.21454E-5 41168 0 8.53708E-6
9-140076310-G-T p.Arg431Arg synonymous ANAPC2 1 82060 1.21862E-5 41030 0 NA
9-140076311-C-T p.Thr430Thr synonymous ANAPC2 17 82016 2.07277E-4 41008 0 0.00203252
9-140076316-T-TCAGGTAGCGGCGGATAGGCTCACAG c.1287-3_1287-2insCTGTGAGCCTATCCGCCGCTACCTG splice_region ANAPC2 1 82036 1.21898E-5 41018 0 NA
9-140076319-C-T c.1287-5G>A splice_region ANAPC2 3 81902 3.66291E-5 40951 0 1.27502E-4
9-140076319-C-A c.1287-5G>T splice_region ANAPC2 3 81900 3.663E-5 40950 0 NA
9-140076322-T-C c.1287-8A>G splice_region ANAPC2 61 81748 7.46196E-4 40874 0 9.24627E-4
9-140077569-G-A c.1286+8C>T splice_region ANAPC2 1 82016 1.21927E-5 41008 0 NA
9-140077586-C-T p.Arg426His missense ANAPC2 6 82374 7.28385E-5 41187 0 7.55148E-5
9-140077586-C-A p.Arg426Leu missense ANAPC2 2 82374 2.42795E-5 41187 0 NA
9-140077587-G-A p.Arg426Cys missense ANAPC2 5 82394 6.0684E-5 41197 0 6.70095E-5
9-140077589-C-T p.Arg425His missense ANAPC2 1 82438 1.21303E-5 41219 0 NA
9-140077590-G-A p.Arg425Cys missense ANAPC2 1 82468 1.21259E-5 41234 0 1.59847E-5
9-140077593-T-C p.Ile424Val missense ANAPC2 3 82326 3.64405E-5 41163 0 4.39501E-5
9-140077597-C-T p.Glu422Glu synonymous ANAPC2 427 82300 0.00518834 41150 4 0.00618544
9-140077627-A-G p.Pro412Pro synonymous ANAPC2 2 82794 2.41563E-5 41397 0 NA
9-140077639-G-A p.Arg408Arg synonymous ANAPC2 17468 82408 0.21197 41204 2141 0.283125
9-140077639-G-T p.Arg408Arg synonymous ANAPC2 1 82814 1.20753E-5 41407 0 1.65579E-5
9-140077640-C-T p.Arg408His missense ANAPC2 3 82816 3.62249E-5 41408 0 9.56633E-5
9-140077645-C-T p.Ala406Ala synonymous ANAPC2 2 82836 2.41441E-5 41418 0 3.18756E-5
9-140077648-C-T p.Lys405Lys synonymous ANAPC2 6 82850 7.242E-5 41425 0 1.03549E-4
9-140077666-G-A p.Leu399Leu synonymous ANAPC2 1 82780 1.20802E-5 41390 0 3.18878E-5
9-140077669-G-A p.Thr398Thr synonymous ANAPC2 24 82744 2.90051E-4 41372 1 0.00151057
9-140077692-C-T p.Val391Ile missense+splice_region ANAPC2 1 82344 1.21442E-5 41172 0 3.18939E-5
9-140077693-G-A p.Gly390Gly splice_region+synonymous ANAPC2 1 82258 1.21569E-5 41129 0 0.00100806
9-140078117-A-G c.1168+7T>C splice_region ANAPC2 1 81916 1.22076E-5 40958 0 NA
9-140078120-G-A c.1168+4C>T splice_region ANAPC2 1 81990 1.21966E-5 40995 0 8.77532E-6
9-140078136-G-C p.Leu386Val missense ANAPC2 1 82304 1.21501E-5 41152 0 NA
9-140078167-G-A p.Leu375Leu synonymous ANAPC2 1 82586 1.21086E-5 41293 0 5.10499E-5
9-140078172-G-A p.Leu374Leu synonymous ANAPC2 1 82660 1.20978E-5 41330 0 6.37024E-5
9-140078172-G-T p.Leu374Met missense ANAPC2 1 82660 1.20978E-5 41330 0 NA
9-140078188-C-T p.Thr368Thr synonymous ANAPC2 4 82828 4.82928E-5 41414 0 1.27437E-4
9-140078197-C-T p.Leu365Leu synonymous ANAPC2 3 82894 3.61908E-5 41447 0 6.36983E-5
9-140078217-C-T p.Glu359Lys missense ANAPC2 1 82916 1.20604E-5 41458 0 NA
9-140078218-G-A p.Ile358Ile synonymous ANAPC2 9 82908 1.08554E-4 41454 0 7.32671E-4
9-140078230-G-C p.Ser354Ser synonymous ANAPC2 1 82912 1.2061E-5 41456 0 NA
9-140078233-G-C p.Asp353Glu missense ANAPC2 1 82910 1.20613E-5 41455 0 3.18492E-5
9-140078239-G-A p.Phe351Phe synonymous ANAPC2 1 82872 1.20668E-5 41436 0 NA
9-140078247-CAAG-C c.1049-7_1049-5delCTT splice_region ANAPC2 26 82816 3.13949E-4 41408 0 5.41574E-4
9-140079368-G-T p.Arg349Arg synonymous ANAPC2 1 81732 1.22351E-5 40866 0 6.97459E-5
9-140079371-C-T p.Val348Ile missense ANAPC2 1 81774 1.22288E-5 40887 0 3.47977E-5
9-140079390-G-A p.Ile341Ile synonymous ANAPC2 27 82004 3.29252E-4 41002 0 9.26418E-5
9-140079397-A-T p.Leu339Gln missense ANAPC2 1 82034 1.21901E-5 41017 0 8.82971E-6
9-140079404-C-T p.Ala337Thr missense ANAPC2 1 81920 1.2207E-5 40960 0 4.03861E-6
9-140079405-G-A p.Tyr336Tyr synonymous ANAPC2 2 81946 2.44063E-5 40973 0 8.9463E-5
9-140079412-C-T p.Arg334His missense ANAPC2 6 81906 7.32547E-5 40953 0 0.00100908
9-140079431-C-T p.Val328Met missense ANAPC2 4 81622 4.90064E-5 40811 0 2.86697E-4
9-140079432-G-A p.His327His synonymous ANAPC2 1 81596 1.22555E-5 40798 0 5.05561E-4
9-140079440-G-A p.Arg325Cys missense ANAPC2 1 81296 1.23007E-5 40648 0 2.10336E-5
9-140079445-C-T p.Arg323His missense ANAPC2 1 81162 1.2321E-5 40581 0 3.18613E-5
9-140079448-C-T p.Arg322His missense ANAPC2 1 81090 1.2332E-5 40545 0 3.18552E-5
9-140079449-G-A p.Arg322Cys missense ANAPC2 1 81094 1.23314E-5 40547 0 1.01282E-4
9-140079453-G-A p.Thr320Thr synonymous ANAPC2 1 81136 1.2325E-5 40568 0 4.25007E-6
9-140079459-G-A p.Gly318Gly synonymous ANAPC2 3 80886 3.70892E-5 40443 0 9.5584E-5
9-140079459-G-T p.Gly318Gly synonymous ANAPC2 1 80888 1.23628E-5 40444 0 NA
9-140079462-G-A p.Ala317Ala synonymous ANAPC2 11 80810 1.36122E-4 40405 0 1.18585E-4
9-140079462-G-T p.Ala317Ala synonymous ANAPC2 1 80810 1.23747E-5 40405 0 NA
9-140079467-C-T p.Glu316Lys missense ANAPC2 7 80562 8.68896E-5 40281 1 0.00203666
9-140079468-G-A p.Pro315Pro synonymous ANAPC2 5 80608 6.20286E-5 40304 0 6.37796E-5
9-140079474-T-C p.Ala313Ala synonymous ANAPC2 2 80302 2.4906E-5 40151 0 6.25E-4
9-140079476-C-T p.Ala313Thr missense ANAPC2 1 80236 1.24632E-5 40118 0 1.3369E-4
9-140079477-G-A p.Pro312Pro synonymous ANAPC2 313 80260 0.00389983 40130 2 0.00618519
9-140079486-G-A p.Pro309Pro synonymous ANAPC2 15 79828 1.87904E-4 39914 0 6.11596E-4
9-140079491-C-T p.Gly308Ser missense ANAPC2 2 79384 2.5194E-5 39692 0 9.5706E-5
9-140079492-G-A p.Asp307Asp synonymous ANAPC2 327 79258 0.00412577 39629 2 0.00899694
9-140079499-A-G p.Leu305Pro missense ANAPC2 2 79098 2.52851E-5 39549 0 5.23341E-5
9-140079512-C-T p.Gly301Ser missense ANAPC2 3 78402 3.82643E-5 39201 0 8.02761E-5
9-140079513-G-A p.Leu300Leu synonymous ANAPC2 4 78804 5.07588E-5 39402 0 6.25E-4
9-140079521-C-T p.Gly298Ser missense ANAPC2 1 78818 1.26875E-5 39409 0 3.19061E-5
9-140079522-G-A p.Val297Val synonymous ANAPC2 17421 77702 0.224203 38851 1985 0.3075
9-140079534-G-A p.Ile293Ile synonymous ANAPC2 1 78576 1.27265E-5 39288 0 6.97088E-6
9-140079539-ACTGTCAGGAGAACGCTAGTGTGAGCTGCAGGGAGGCATGGTGAGCCCCGGGCTGACTCAGAGGCTGGGAGGAGCCTCACGGCCACCCAC-A c.874-89_874-1delGTGGGTGGCCGTGAGGCTCCTCCCAGCCTCTGAGTCAGCCCGGGGCTCACCATGCCTCCCTGCAGCTCACACTAGCGTTCTCCTGACAG splice_acceptor ANAPC2 4 78434 5.09983E-5 39217 0 NA
9-140079545-A-G c.874-6T>C splice_region ANAPC2 1 78304 1.27707E-5 39152 0 3.1902E-5
9-140080668-G-A c.873+8C>T splice_region ANAPC2 1 82424 1.21324E-5 41212 0 9.56023E-5
9-140080681-G-A p.His290Tyr missense ANAPC2 3 82582 3.63275E-5 41291 0 NA
9-140080689-C-T p.Arg287His missense ANAPC2 11 82590 1.33188E-4 41295 0 1.561E-4
9-140080694-G-A p.Phe285Phe synonymous ANAPC2 1 82662 1.20975E-5 41331 0 1.6899E-5
9-140080701-C-T p.Arg283His missense ANAPC2 9 82594 1.08967E-4 41297 0 6.25E-4
9-140080717-G-A p.Arg278Trp missense ANAPC2 1 82582 1.21092E-5 41291 0 NA
9-140080723-G-A p.Arg276Cys missense ANAPC2 2 82506 2.42407E-5 41253 0 6.25E-4
9-140080740-C-T p.Arg270Gln missense ANAPC2 8 82408 9.7078E-5 41204 0 0.00125
9-140080741-G-A p.Arg270Trp missense ANAPC2 17 82364 2.06401E-4 41182 0 2.93406E-4
9-140080766-C-G p.Val261Val synonymous ANAPC2 1 82124 1.21767E-5 41062 0 2.4323E-5
9-140080769-A-G p.Ala260Ala synonymous ANAPC2 77 82110 9.37766E-4 41055 0 0.00345815
9-140080774-C-T p.Glu259Lys missense ANAPC2 6 82038 7.31368E-5 41019 0 4.49626E-5
9-140080795-G-C p.Leu252Val missense ANAPC2 1 81728 1.22357E-5 40864 0 NA
9-140080796-A-G p.Ser251Ser synonymous ANAPC2 1 81678 1.22432E-5 40839 0 1.32707E-5
9-140080807-G-A p.His248Tyr missense+splice_region ANAPC2 3 81408 3.68514E-5 40704 0 2.97699E-5
9-140080813-A-G c.741-5T>C splice_region ANAPC2 1 81218 1.23125E-5 40609 0 NA
9-140080815-G-A c.741-7C>T splice_region ANAPC2 2 81144 2.46475E-5 40572 0 6.37999E-5
9-140081930-C-T c.740+3G>A splice_region ANAPC2 2 82908 2.41231E-5 41454 0 8.58826E-6
9-140081935-G-C p.Val246Val splice_region+synonymous ANAPC2 4 82918 4.82404E-5 41459 0 0.001875
9-140081937-C-T p.Val246Ile missense ANAPC2 2 82928 2.41173E-5 41464 0 8.51571E-6
9-140081938-C-T p.Gln245Gln synonymous ANAPC2 1 82930 1.20584E-5 41465 0 4.01126E-6
9-140081940-G-C p.Gln245Glu missense ANAPC2 1 82966 1.20531E-5 41483 0 NA
9-140081948-T-C p.Gln242Arg missense ANAPC2 2 83020 2.40906E-5 41510 0 7.99667E-6
9-140081956-C-T p.Gln239Gln synonymous ANAPC2 1 83050 1.20409E-5 41525 0 NA
9-140082004-C-T p.Gly223Gly synonymous ANAPC2 1 83042 1.20421E-5 41521 0 2.48488E-5
9-140082015-G-C p.Leu220Val missense ANAPC2 1 83018 1.20456E-5 41509 0 NA
9-140082018-G-T p.Pro219Thr missense ANAPC2 5 83024 6.02235E-5 41512 0 3.98324E-5
9-140082030-G-A p.Leu215Phe missense ANAPC2 1 83050 1.20409E-5 41525 0 3.18512E-5
9-140082034-G-A p.Tyr213Tyr synonymous ANAPC2 3 83052 3.61219E-5 41526 0 8.27417E-6
9-140082043-G-C p.Arg210Arg synonymous ANAPC2 17 83076 2.04632E-4 41538 0 5.03525E-4
9-140082056-C-T p.Arg206Gln missense ANAPC2 3 83116 3.60941E-5 41558 0 1.65415E-5
9-140082078-G-A p.Leu199Leu synonymous ANAPC2 1 83162 1.20247E-5 41581 0 NA
9-140082078-G-C p.Leu199Val missense ANAPC2 2 83162 2.40494E-5 41581 0 3.18552E-5
9-140082093-C-T p.Gly194Ser missense ANAPC2 1 83180 1.20221E-5 41590 0 8.26979E-6
9-140082106-C-T p.Arg189Arg synonymous ANAPC2 2 83184 2.40431E-5 41592 0 6.36943E-5
9-140082112-A-C p.Ser187Arg missense ANAPC2 3 83166 3.60724E-5 41583 0 8.2728E-6
9-140082124-G-A p.Val183Val synonymous ANAPC2 1 83182 1.20218E-5 41591 0 NA
9-140082136-G-A p.Cys179Cys synonymous ANAPC2 5 83164 6.01222E-5 41582 0 1.9903E-5
9-140082142-A-G p.Tyr177Tyr synonymous ANAPC2 2 83174 2.4046E-5 41587 0 7.96083E-6
9-140082145-C-T p.Leu176Leu synonymous ANAPC2 2 83172 2.40466E-5 41586 0 4.96106E-5
9-140082147-G-A p.Leu176Leu synonymous ANAPC2 2 83170 2.40471E-5 41585 0 8.26843E-6
9-140082148-A-G p.Arg175Arg synonymous ANAPC2 1 83162 1.20247E-5 41581 0 3.98004E-6
9-140082160-C-G p.Glu171Asp missense ANAPC2 1 83148 1.20267E-5 41574 0 NA
9-140082175-G-C p.Pro166Pro synonymous ANAPC2 1 83104 1.20331E-5 41552 0 NA
9-140082182-C-A p.Ser164Ile missense ANAPC2 1 83074 1.20375E-5 41537 0 NA
9-140082195-C-T p.Val160Ile missense ANAPC2 37 82996 4.45805E-4 41498 1 0.001875
9-140082200-C-T p.Arg158His missense ANAPC2 1 82912 1.2061E-5 41456 0 NA
9-140082204-A-G p.Leu157Leu synonymous ANAPC2 3 82870 3.62013E-5 41435 0 3.97994E-6
9-140082213-G-A p.His154Tyr missense ANAPC2 1 82704 1.20913E-5 41352 0 1.99059E-5
9-140082214-G-C p.Val153Val synonymous ANAPC2 1 82680 1.20948E-5 41340 0 NA
9-140082219-C-T p.Glu152Lys missense ANAPC2 1 82558 1.21127E-5 41279 0 NA
9-140082222-C-T p.Glu151Lys missense ANAPC2 2 82434 2.42618E-5 41217 0 NA
9-140082222-C-G p.Glu151Gln missense ANAPC2 1 82434 1.21309E-5 41217 0 NA
9-140082226-C-T p.Leu149Leu synonymous ANAPC2 1 82182 1.21681E-5 41091 0 NA
9-140082239-C-T p.Gly145Asp missense ANAPC2 2 81720 2.44738E-5 40860 0 NA
9-140082242-G-A p.Thr144Ile missense ANAPC2 15 81626 1.83765E-4 40813 0 1.65618E-4
9-140082245-C-T p.Gly143Asp missense ANAPC2 1 81478 1.22733E-5 40739 0 8.28102E-6
9-140082253-C-T p.Leu140Leu synonymous ANAPC2 5 81152 6.16128E-5 40576 0 0.00100705
9-140082260-A-C p.Leu138Arg missense ANAPC2 1 80874 1.23649E-5 40437 0 NA
9-140082261-G-T p.Leu138Met missense ANAPC2 6 80784 7.42721E-5 40392 0 8.28226E-6
9-140082261-G-A p.Leu138Leu synonymous ANAPC2 3 80784 3.71361E-5 40392 0 NA
9-140082264-G-A p.Arg137Cys missense ANAPC2 2 80584 2.48188E-5 40292 0 8.28267E-6
9-140082281-A-T p.Leu131Gln missense ANAPC2 3 80574 3.72329E-5 40287 0 3.58935E-5
9-140082294-G-A p.Arg127Cys missense ANAPC2 2 80364 2.48868E-5 40182 0 3.98991E-6
9-140082295-C-A p.Leu126Leu synonymous ANAPC2 1 80416 1.24353E-5 40208 0 NA
9-140082302-G-C p.Pro124Arg missense ANAPC2 2 80496 2.4846E-5 40248 0 3.98988E-6
9-140082311-C-T p.Arg121His missense ANAPC2 1 80266 1.24586E-5 40133 0 NA
9-140082311-C-A p.Arg121Leu missense ANAPC2 1 80266 1.24586E-5 40133 0 3.18492E-5
9-140082322-C-T p.Leu117Leu synonymous ANAPC2 1 80830 1.23716E-5 40415 0 NA
9-140082325-G-A p.Gly116Gly synonymous ANAPC2 1 80992 1.23469E-5 40496 0 NA
9-140082343-T-C p.Leu110Leu synonymous ANAPC2 1 81932 1.22052E-5 40966 0 1.65796E-5
9-140082351-G-A p.Leu108Phe missense ANAPC2 1 82306 1.21498E-5 41153 0 NA
9-140082356-T-C p.Gln106Arg missense ANAPC2 118 82450 0.00143117 41225 1 0.00232499
9-140082376-C-A p.Glu99Asp missense ANAPC2 2 82900 2.41255E-5 41450 0 1.59383E-5
9-140082378-C-T p.Glu99Lys missense ANAPC2 8 82916 9.64832E-5 41458 0 1.59246E-4
9-140082380-C-A p.Cys98Phe missense ANAPC2 1 82916 1.20604E-5 41458 0 NA
9-140082382-T-C p.Gln97Gln synonymous ANAPC2 1 82944 1.20563E-5 41472 0 2.4881E-5
9-140082392-G-A p.Ala94Val missense ANAPC2 1 82918 1.20601E-5 41459 0 NA
9-140082394-A-C p.Asn93Lys missense ANAPC2 2 82954 2.41097E-5 41477 0 NA
9-140082399-A-G p.Trp92Arg missense ANAPC2 1 82916 1.20604E-5 41458 0 NA
9-140082407-G-A p.Pro89Leu missense ANAPC2 1 82852 1.20697E-5 41426 0 3.99345E-6
9-140082408-G-A p.Pro89Ser missense ANAPC2 1 82842 1.20712E-5 41421 0 3.99632E-6
9-140082410-G-A p.Ser88Phe missense ANAPC2 1 82836 1.2072E-5 41418 0 NA
9-140082410-G-T p.Ser88Tyr missense ANAPC2 1 82836 1.2072E-5 41418 0 3.18471E-5
9-140082414-T-G p.Ile87Leu missense ANAPC2 3 82774 3.62433E-5 41387 0 7.99834E-6
9-140082416-T-C p.Asn86Ser missense ANAPC2 7 82714 8.4629E-5 41357 0 6.25E-4
9-140082426-G-A p.Leu83Leu synonymous ANAPC2 1 82578 1.21098E-5 41289 0 1.66226E-5
9-140082440-A-G p.Val78Ala missense ANAPC2 4 82188 4.86689E-5 41094 0 NA
9-140082442-C-T p.Glu77Glu synonymous ANAPC2 6 82364 7.28474E-5 41182 0 3.18512E-5
9-140082450-A-G p.Phe75Leu missense ANAPC2 1 82272 1.21548E-5 41136 0 NA
9-140082474-G-A p.Leu67Leu synonymous ANAPC2 5 82142 6.08702E-5 41071 0 8.35268E-5
9-140082474-G-C p.Leu67Val missense ANAPC2 1 82142 1.2174E-5 41071 0 NA
9-140082480-G-A p.His65Tyr missense ANAPC2 64 82050 7.80012E-4 41025 1 0.00755287
9-140082481-G-A p.Gly64Gly synonymous ANAPC2 1 82036 1.21898E-5 41018 0 8.36372E-6
9-140082489-G-A p.Leu62Leu synonymous ANAPC2 9 81974 1.09791E-4 40987 0 6.37024E-5
9-140082496-C-T p.Val59Val synonymous ANAPC2 1 81910 1.22085E-5 40955 0 NA
9-140082498-C-G p.Val59Leu missense ANAPC2 1 81898 1.22103E-5 40949 0 NA
9-140082506-C-T p.Arg56Gln missense ANAPC2 1 81784 1.22273E-5 40892 0 NA
9-140082507-G-A p.Arg56Trp missense ANAPC2 1 81766 1.223E-5 40883 0 NA
9-140082517-T-C p.Glu52Glu synonymous ANAPC2 2 81688 2.44834E-5 40844 0 NA
9-140082520-C-T p.Lys51Lys synonymous ANAPC2 1 81598 1.22552E-5 40799 0 4.06603E-6
9-140082531-C-T p.Val48Ile missense ANAPC2 5 81170 6.15991E-5 40585 0 1.22491E-5
9-140082535-A-C p.Gly46Gly synonymous ANAPC2 1 80968 1.23506E-5 40484 0 NA
9-140082537-C-T p.Gly46Ser missense ANAPC2 1 80978 1.2349E-5 40489 0 4.08998E-6
9-140082540-T-G p.Ser45Arg missense ANAPC2 9 80924 1.11215E-4 40462 0 5.05051E-4
9-140082546-G-T p.Arg43Arg synonymous ANAPC2 3 80688 3.71802E-5 40344 0 3.18613E-5
9-140082551-G-A p.Ser41Phe missense ANAPC2 2 80664 2.47942E-5 40332 0 3.18573E-5
9-140082556-C-CGACTCCGAGAT c.118-2_118-1insATCTCGGAGTC splice_acceptor ANAPC2 1 80472 1.24267E-5 40236 0 NA
9-140082563-G-T c.118-8C>A splice_region ANAPC2 1 80146 1.24772E-5 40073 0 NA
9-140082871-C-T p.Gly38Gly synonymous ANAPC2 1 62970 1.58806E-5 31485 0 NA
9-140082873-C-A p.Gly38Trp missense ANAPC2 1 63184 1.58268E-5 31592 0 NA
9-140082874-C-T p.Leu37Leu synonymous ANAPC2 1 63236 1.58138E-5 31618 0 NA
9-140082877-C-A p.Ala36Ala synonymous ANAPC2 1 63050 1.58604E-5 31525 0 NA
9-140082878-G-A p.Ala36Val missense ANAPC2 1 62930 1.58907E-5 31465 0 4.47918E-5
9-140082904-C-T p.Val27Val synonymous ANAPC2 1 65504 1.52662E-5 32752 0 1.00152E-5
9-140082910-G-A p.Asn25Asn synonymous ANAPC2 6 65672 9.13631E-5 32836 0 6.74292E-5
9-140082920-A-C p.Val22Gly missense ANAPC2 7 66078 1.05935E-4 33039 0 1.2751E-4
9-140082939-G-C p.Pro16Ala missense ANAPC2 1 65590 1.52462E-5 32795 0 NA
9-140082957-C-T p.Gly10Arg missense ANAPC2 1 65052 1.53723E-5 32526 0 NA
9-140082971-A-G p.Val5Ala missense ANAPC2 47 64262 7.31381E-4 32131 1 0.00128171
9-140082973-TGCC-T p.Ala4del disruptive_inframe_deletion ANAPC2 6 64010 9.37354E-5 32005 0 6.37796E-5
9-140082976-C-T p.Ala3Ala synonymous ANAPC2 1 63854 1.56607E-5 31927 0 NA
9-140082979-C-A p.Ala2Ala synonymous ANAPC2 1 63600 1.57233E-5 31800 0 2.8255E-5
9-140082980-G-T p.Ala2Glu missense ANAPC2 2 63302 3.15946E-5 31651 0 2.82901E-5
9-140082980-G-C p.Ala2Gly missense ANAPC2 1 63302 1.57973E-5 31651 0 NA