Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
7-2739951-C-T c.-135C>T 5_prime_UTR_premature_start_codon_gain AMZ1 2 55722 3.58925E-5 27861 0 NA
7-2739969-C-T c.-117C>T 5_prime_UTR_premature_start_codon_gain AMZ1 3 61678 4.86397E-5 30839 0 9.58957E-5
7-2739980-C-T c.-106C>T 5_prime_UTR_premature_start_codon_gain AMZ1 2 65878 3.03591E-5 32939 0 6.38651E-5
7-2739980-C-G c.-106C>G 5_prime_UTR_premature_start_codon_gain AMZ1 3 65878 4.55387E-5 32939 0 NA
7-2739990-C-T c.-96C>T 5_prime_UTR_premature_start_codon_gain AMZ1 2 68750 2.90909E-5 34375 0 3.20945E-5
7-2740007-C-T c.-79C>T 5_prime_UTR_premature_start_codon_gain AMZ1 5 72124 6.93251E-5 36062 0 3.24465E-5
7-2740013-C-T c.-73C>T 5_prime_UTR_premature_start_codon_gain AMZ1 3 73678 4.07177E-5 36839 0 3.23269E-5
7-2740019-C-T c.-67C>T 5_prime_UTR_premature_start_codon_gain AMZ1 22 74652 2.94701E-4 37326 0 2.23385E-4
7-2740026-C-T c.-60C>T 5_prime_UTR_premature_start_codon_gain AMZ1 3 75726 3.96165E-5 37863 0 NA
7-2740073-C-T c.-13C>T 5_prime_UTR_premature_start_codon_gain AMZ1 1 78852 1.2682E-5 39426 0 8.8851E-6
7-2740078-C-T c.-8C>T 5_prime_UTR_premature_start_codon_gain AMZ1 1 79016 1.26557E-5 39508 0 6.28931E-4
7-2740089-C-G p.Leu2Val missense AMZ1 3 79616 3.76809E-5 39808 0 5.03525E-4
7-2740091-G-A p.Leu2Leu synonymous AMZ1 1 79682 1.25499E-5 39841 0 NA
7-2740103-C-G p.Pro6Pro synonymous AMZ1 1 80158 1.24754E-5 40079 0 3.19061E-5
7-2740103-C-T p.Pro6Pro synonymous AMZ1 4 80158 4.99014E-5 40079 0 3.32745E-5
7-2740104-G-T p.Ala7Ser missense AMZ1 7 80116 8.73733E-5 40058 0 6.37959E-5
7-2740104-G-A p.Ala7Thr missense AMZ1 41 80114 5.11771E-4 40057 1 5.03525E-4
7-2740104-GC-G p.Ala7fs frameshift AMZ1 1 80116 1.24819E-5 40058 0 NA
7-2740105-C-T p.Ala7Val missense AMZ1 1 80220 1.24657E-5 40110 0 NA
7-2740107-C-T p.Gln8* stop_gained AMZ1 2 80316 2.49016E-5 40158 0 2.52118E-5
7-2740107-CAGG-C p.Glu9del conservative_inframe_deletion AMZ1 1 80316 1.24508E-5 40158 0 NA
7-2740115-C-A p.Phe10Leu missense AMZ1 1 80506 1.24214E-5 40253 0 NA
7-2740120-T-C p.Phe12Ser missense AMZ1 1 80488 1.24242E-5 40244 0 8.27185E-6
7-2740122-G-C p.Gly13Arg missense AMZ1 1 80524 1.24187E-5 40262 0 NA
7-2740125-C-A p.Pro14Thr missense AMZ1 2 80510 2.48416E-5 40255 0 3.33328E-5
7-2740125-C-T p.Pro14Ser missense AMZ1 4 80510 4.96833E-5 40255 0 1.23841E-5
7-2740128-C-T p.Arg15Trp missense AMZ1 13 80594 1.61302E-4 40297 0 2.23243E-4
7-2740140-G-A p.Asp19Asn missense AMZ1 1 80772 1.23805E-5 40386 0 4.10435E-6
7-2740142-C-T p.Asp19Asp synonymous AMZ1 15 80752 1.85754E-4 40376 0 0.0025
7-2740143-G-T p.Ala20Ser missense AMZ1 1 80762 1.23821E-5 40381 0 NA
7-2740143-G-A p.Ala20Thr missense AMZ1 1 80762 1.23821E-5 40381 0 8.20123E-6
7-2740145-T-C p.Ala20Ala synonymous AMZ1 2 80806 2.47506E-5 40403 0 8.28789E-6
7-2740157-T-G p.Thr24Thr synonymous AMZ1 7 80850 8.65801E-5 40425 0 1.10257E-4
7-2740160-C-T p.Asp25Asp synonymous AMZ1 5 80832 6.18567E-5 40416 0 1.59459E-4
7-2740173-C-CAGCT p.Tyr32fs frameshift AMZ1 4 80914 4.94352E-5 40457 2 NA
7-2740174-A-T p.Gln30Leu missense AMZ1 1 80900 1.23609E-5 40450 0 4.06967E-6
7-2740177-T-A p.Leu31Gln missense AMZ1 1 80954 1.23527E-5 40477 0 NA
7-2740195-C-T p.Ser37Phe missense AMZ1 1 80770 1.23808E-5 40385 0 8.2687E-6
7-2740196-C-A p.Ser37Ser synonymous AMZ1 8 80798 9.90124E-5 40399 1 2.03236E-5
7-2740199-T-A p.Pro38Pro synonymous AMZ1 1 80746 1.23845E-5 40373 0 1.73654E-4
7-2740199-T-G p.Pro38Pro synonymous AMZ1 1 80746 1.23845E-5 40373 0 NA
7-2740200-G-T p.Ala39Ser missense AMZ1 1 80730 1.2387E-5 40365 0 NA
7-2740202-C-T p.Ala39Ala synonymous AMZ1 1 80696 1.23922E-5 40348 0 6.37836E-5
7-2740207-G-A p.Arg41Gln missense AMZ1 9 80682 1.11549E-4 40341 0 4.96179E-5
7-2740220-C-T p.Ala45Ala synonymous AMZ1 4 80548 4.96598E-5 40274 0 1.27502E-4
7-2740233-C-T p.Pro50Ser missense AMZ1 1 80508 1.24211E-5 40254 0 4.06233E-6
7-2740234-C-T p.Pro50Leu missense AMZ1 1 80480 1.24254E-5 40240 0 3.3095E-5
7-2740243-C-T p.Thr53Met missense AMZ1 2 80356 2.48892E-5 40178 0 2.03173E-5
7-2740244-G-A p.Thr53Thr synonymous AMZ1 29 80304 3.61128E-4 40152 0 0.00111593
7-2740249-T-C p.Phe55Ser missense AMZ1 2 80278 2.49134E-5 40139 0 8.11787E-6
7-2740254-A-C p.Thr57Pro missense AMZ1 1 80120 1.24813E-5 40060 0 NA
7-2740256-C-T p.Thr57Thr synonymous AMZ1 1 80240 1.24626E-5 40120 0 2.48377E-5
7-2740256-C-G p.Thr57Thr synonymous AMZ1 1 80240 1.24626E-5 40120 0 NA
7-2740257-C-G p.Leu58Val missense AMZ1 1 80242 1.24623E-5 40121 0 3.18451E-5
7-2740266-C-T p.Arg61Cys missense AMZ1 3 80074 3.74653E-5 40037 0 6.08144E-5
7-2740270-C-T p.Thr62Met missense AMZ1 3 80014 3.74934E-5 40007 0 3.31549E-5
7-2740271-G-A p.Thr62Thr synonymous AMZ1 3 79994 3.75028E-5 39997 0 4.97298E-5
7-2740277-C-T p.Phe64Phe synonymous AMZ1 7 79948 8.75569E-5 39974 0 7.46591E-5
7-2740278-G-A p.Asp65Asn missense AMZ1 1 79914 1.25135E-5 39957 0 8.29614E-6
7-2740280-C-A p.Asp65Glu missense AMZ1 5 79936 6.255E-5 39968 0 3.18532E-5
7-2740293-C-T p.Arg70* stop_gained AMZ1 2 79790 2.50658E-5 39895 0 1.21497E-5
7-2740294-G-A p.Arg70Gln missense AMZ1 12 79754 1.50463E-4 39877 0 2.24405E-4
7-2740295-ACCCGAGGCT-A p.Ala73_Glu75del disruptive_inframe_deletion AMZ1 1 79758 1.25379E-5 39879 0 NA
7-2740298-C-T p.Pro71Pro synonymous AMZ1 2 79838 2.50507E-5 39919 0 2.54907E-4
7-2740305-C-A p.Pro74Thr missense AMZ1 1 79818 1.25285E-5 39909 0 NA
7-2740307-C-T p.Pro74Pro synonymous AMZ1 8 79790 1.00263E-4 39895 0 0.00102881
7-2740308-G-A p.Glu75Lys missense AMZ1 1 79736 1.25414E-5 39868 0 4.04338E-6
7-2740325-C-T p.Phe80Phe synonymous AMZ1 2 79798 2.50633E-5 39899 0 3.18471E-5
7-2740326-C-T p.His81Tyr missense AMZ1 1 79780 1.25345E-5 39890 0 1.21106E-5
7-2740328-C-T p.His81His synonymous AMZ1 2 79784 2.50677E-5 39892 0 1.66658E-5
7-2740344-C-T p.Arg87Trp missense AMZ1 1 79780 1.25345E-5 39890 0 4.03939E-6
7-2740349-G-A p.Lys88Lys synonymous AMZ1 4 79758 5.01517E-5 39879 0 1.27453E-4
7-2740352-C-G p.Pro89Pro synonymous AMZ1 1 79820 1.25282E-5 39910 0 NA
7-2740353-C-T p.Arg90Cys missense AMZ1 22 79822 2.75613E-4 39911 1 7.43212E-4
7-2740354-G-A p.Arg90His missense AMZ1 6 79790 7.51974E-5 39895 0 2.02048E-5
7-2740358-G-A p.Leu91Leu synonymous AMZ1 1 79792 1.25326E-5 39896 0 4.04145E-6
7-2740362-C-T p.Arg93Trp missense AMZ1 3 79740 3.76223E-5 39870 0 7.54363E-5
7-2740363-G-A p.Arg93Gln missense AMZ1 8 79730 1.00339E-4 39865 0 3.23643E-5
7-2740366-A-G p.Lys94Arg missense AMZ1 1 79748 1.25395E-5 39874 0 NA
7-2740369-A-T p.His95Leu missense AMZ1 2 79708 2.50916E-5 39854 0 4.05334E-6
7-2740374-T-A p.Tyr97Asn missense AMZ1 6 79642 7.53371E-5 39821 0 3.18593E-5
7-2740380-C-T p.Gln99* stop_gained AMZ1 13 79676 1.63161E-4 39838 0 1.09463E-4
7-2740384-C-T p.Pro100Leu missense AMZ1 17 79660 2.13407E-4 39830 0 1.13576E-4
7-2740385-G-A p.Pro100Pro synonymous AMZ1 1 79618 1.256E-5 39809 0 8.11629E-6
7-2740392-A-ACGGGACGCCTGCAGCCAT c.304+3_304+4insCGGGACGCCTGCAGCCAT splice_region AMZ1 1 79494 1.25796E-5 39747 0 4.06633E-6
7-2740393-C-T c.304+4C>T splice_region AMZ1 86 79464 0.00108225 39732 0 0.00133784
7-2740394-G-A c.304+5G>A splice_region AMZ1 9 79446 1.13284E-4 39723 0 9.77246E-5
7-2742076-C-G n.422C>G splice_region AMZ1 1 52116 1.9188E-5 26058 0 NA
7-2742079-G-A n.424+1G>A splice_donor AMZ1 1 52370 1.90949E-5 26185 0 NA
7-2742242-A-C n.76+3A>C splice_region AMZ1 198 73682 0.00268722 36841 0 0.00623322
7-2742350-C-T c.305-6C>T splice_region AMZ1 16 78400 2.04082E-4 39200 0 9.246E-4
7-2742363-C-T p.Ser104Ser synonymous AMZ1 240 78974 0.00303897 39487 1 0.00875
7-2742364-G-A p.Glu105Lys missense AMZ1 1 79224 1.26224E-5 39612 0 5.57662E-5
7-2742371-C-T p.Pro107Leu missense AMZ1 3 79534 3.77197E-5 39767 0 5.50418E-5
7-2742372-G-A p.Pro107Pro synonymous AMZ1 86 79630 0.00107999 39815 0 0.00210634
7-2742373-G-A p.Val108Met missense AMZ1 1 79706 1.25461E-5 39853 0 NA
7-2742383-C-T p.Ser111Phe missense AMZ1 6 80046 7.49569E-5 40023 0 0.00129898
7-2742385-C-T p.Leu112Leu synonymous AMZ1 131 80150 0.00163444 40075 3 0.0025
7-2742394-C-G p.Gln115Glu missense AMZ1 2 80232 2.49277E-5 40116 0 3.34654E-5
7-2742396-G-C p.Gln115His missense AMZ1 4 80226 4.98591E-5 40113 0 6.68735E-6
7-2742400-T-C p.Cys117Arg missense AMZ1 1 80232 1.24639E-5 40116 0 NA
7-2742402-C-T p.Cys117Cys synonymous AMZ1 1 80194 1.24698E-5 40097 0 NA
7-2742403-A-C p.Ser118Arg missense AMZ1 1 80202 1.24685E-5 40101 0 3.18735E-5
7-2742405-C-T p.Ser118Ser synonymous AMZ1 2 80154 2.4952E-5 40077 0 1.27453E-4
7-2742408-C-T p.Cys119Cys synonymous AMZ1 1 80224 1.24651E-5 40112 0 1.3273E-5
7-2742411-A-G p.Thr120Thr synonymous AMZ1 1440 80210 0.0179529 40105 72 0.0406914
7-2742411-A-C p.Thr120Thr synonymous AMZ1 1 80286 1.24555E-5 40143 0 6.6198E-6
7-2742415-G-C p.Ala122Pro missense AMZ1 2 80220 2.49314E-5 40110 0 1.32357E-5
7-2742416-C-T p.Ala122Val missense AMZ1 6 80142 7.48671E-5 40071 0 1.32394E-5
7-2742417-C-T p.Ala122Ala synonymous AMZ1 52 80226 6.48169E-4 40113 0 8.93326E-4
7-2742422-T-C p.Phe124Ser missense AMZ1 1 80082 1.24872E-5 40041 0 6.59648E-6
7-2742424-C-T p.Leu125Leu synonymous AMZ1 3 80056 3.74738E-5 40028 0 3.18796E-5
7-2742426-G-T p.Leu125Leu synonymous AMZ1 3 79980 3.75094E-5 39990 0 1.05252E-4
7-2742430-C-T p.Leu127Leu synonymous AMZ1 61 79762 7.64775E-4 39881 0 0.00104058
7-2742430-C-G p.Leu127Val missense AMZ1 1 79766 1.25367E-5 39883 0 6.56332E-6
7-2742444-C-T p.Cys131Cys synonymous AMZ1 1 79154 1.26336E-5 39577 0 3.18715E-5
7-2742445-C-G p.Leu132Val missense AMZ1 1 79134 1.26368E-5 39567 0 NA
7-2742448-C-A p.Pro133Thr missense AMZ1 4 78934 5.06752E-5 39467 0 1.00888E-4
7-2742449-C-T p.Pro133Leu missense AMZ1 2 78876 2.53563E-5 39438 0 3.48328E-4
7-2742450-G-A p.Pro133Pro synonymous AMZ1 23 78856 2.91671E-4 39428 0 2.55004E-4
7-2742450-G-T p.Pro133Pro synonymous AMZ1 1 78856 1.26813E-5 39428 0 4.97711E-5
7-2742452-C-T p.Ser134Leu missense AMZ1 3 78624 3.81563E-5 39312 0 0.001875
7-2742460-G-A p.Ala137Thr missense AMZ1 1 78082 1.2807E-5 39041 0 NA
7-2742462-C-T p.Ala137Ala synonymous AMZ1 10 77942 1.28301E-4 38971 0 4.99417E-5
7-2742463-G-A p.Ala138Thr missense AMZ1 2 77674 2.57486E-5 38837 0 1.755E-4
7-2742463-G-C p.Ala138Pro missense AMZ1 1 77674 1.28743E-5 38837 0 NA
7-2742464-C-T p.Ala138Val missense AMZ1 1 77600 1.28866E-5 38800 0 5.10725E-4
7-2742472-C-T p.Arg141Cys missense AMZ1 2 77002 2.59734E-5 38501 0 3.18796E-5
7-2742473-G-A p.Arg141His missense AMZ1 1 76760 1.30276E-5 38380 0 3.71581E-5
7-2742474-C-A p.Arg141Arg synonymous AMZ1 8 76696 1.04308E-4 38348 0 1.52681E-5
7-2742482-C-T p.Ser144Leu missense AMZ1 1 75748 1.32017E-5 37874 0 2.01261E-4
7-2742483-G-A p.Ser144Ser synonymous AMZ1 2 75354 2.65414E-5 37677 0 3.28537E-5
7-2742484-C-T p.Arg145Trp missense AMZ1 2 75174 2.66049E-5 37587 0 4.98529E-6
7-2742484-C-A p.Arg145Arg synonymous AMZ1 1 75174 1.33025E-5 37587 0 NA
7-2742485-G-A p.Arg145Gln missense AMZ1 1 75264 1.32866E-5 37632 0 3.18634E-5
7-2742490-A-G p.Ser147Gly missense AMZ1 1 75166 1.33039E-5 37583 0 NA
7-2742493-C-T p.Arg148Trp missense AMZ1 17 74812 2.27236E-4 37406 0 9.55901E-5
7-2742494-G-A p.Arg148Gln missense AMZ1 10 74810 1.33672E-4 37405 0 2.19768E-4
7-2742501-T-G p.Ser150Ser synonymous AMZ1 1 74524 1.34185E-5 37262 0 NA
7-2742505-A-G p.Arg152Gly missense AMZ1 3 74244 4.04073E-5 37122 0 3.18552E-5
7-2742514-C-T p.Leu155Phe missense AMZ1 28 73640 3.80228E-4 36820 0 4.77737E-4
7-2742527-A-G c.472+4A>G splice_region AMZ1 1 73136 1.36732E-5 36568 0 NA
7-2742529-T-A c.472+6T>A splice_region AMZ1 45 72922 6.17098E-4 36461 1 3.70814E-4
7-2748216-C-A c.473-6C>A splice_region AMZ1 2 82094 2.43623E-5 41047 0 NA
7-2748217-C-T c.473-5C>T splice_region AMZ1 16 82096 1.94894E-4 41048 0 1.59398E-4
7-2748217-C-G c.473-5C>G splice_region AMZ1 1 82100 1.21803E-5 41050 0 8.46339E-6
7-2748218-G-A c.473-4G>A splice_region AMZ1 1 82068 1.2185E-5 41034 0 3.18593E-5
7-2748222-A-C p.Asp158Ala missense+splice_region AMZ1 1 82180 1.21684E-5 41090 0 3.18837E-5
7-2748223-C-T p.Asp158Asp splice_region+synonymous AMZ1 5 82206 6.08228E-5 41103 0 1.2648E-4
7-2748224-G-A p.Gly159Ser missense+splice_region AMZ1 31 82218 3.77046E-4 41109 0 0.00100806
7-2748224-G-T p.Gly159Cys missense+splice_region AMZ1 1 82218 1.21628E-5 41109 0 3.18613E-5
7-2748227-A-C p.Ile160Leu missense AMZ1 12 82310 1.4579E-4 41155 0 2.96674E-4
7-2748229-C-T p.Ile160Ile synonymous AMZ1 1 82346 1.21439E-5 41173 0 4.40938E-5
7-2748233-T-A p.Ser162Thr missense AMZ1 13 82402 1.57763E-4 41201 0 1.00746E-4
7-2748234-CCTT-C p.Phe163del disruptive_inframe_deletion AMZ1 9 82418 1.09199E-4 41209 0 1.59307E-4
7-2748237-T-C p.Phe163Ser missense AMZ1 4 82438 4.85213E-5 41219 0 8.00762E-6
7-2748240-TGAA-T p.Lys165del disruptive_inframe_deletion AMZ1 5 82470 6.06281E-5 41235 0 5.03525E-4
7-2748244-GAAC-G p.Asn167del disruptive_inframe_deletion AMZ1 4 82514 4.84766E-5 41257 0 5.03525E-4
7-2748255-C-T p.Pro169Leu missense AMZ1 3 82630 3.63064E-5 41315 0 3.99786E-6
7-2748259-G-C p.Gly170Gly synonymous AMZ1 4 82648 4.8398E-5 41324 0 8.35464E-6
7-2748262-C-T p.Asp171Asp synonymous AMZ1 20 82644 2.42002E-4 41322 0 5.03525E-4
7-2748263-G-A p.Ala172Thr missense AMZ1 6 82626 7.26164E-5 41313 0 9.56206E-5
7-2748264-C-T p.Ala172Val missense AMZ1 6 82648 7.2597E-5 41324 0 2.23115E-4
7-2748265-G-A p.Ala172Ala synonymous AMZ1 6 82680 7.25689E-5 41340 0 6.37349E-5
7-2748271-T-G p.Cys174Trp missense AMZ1 1 82736 1.20866E-5 41368 0 NA
7-2748279-G-A p.Gly177Asp missense AMZ1 1 82774 1.20811E-5 41387 0 NA
7-2748286-A-C p.Thr179Thr synonymous AMZ1 2 82824 2.41476E-5 41412 0 NA
7-2748287-C-G p.Leu180Val missense AMZ1 4 82838 4.8287E-5 41419 0 5.03525E-4
7-2748287-C-A p.Leu180Met missense AMZ1 1 82838 1.20718E-5 41419 0 3.18674E-5
7-2748289-G-T p.Leu180Leu synonymous AMZ1 1 82834 1.20723E-5 41417 0 NA
7-2748289-G-C p.Leu180Leu synonymous AMZ1 1 82834 1.20723E-5 41417 0 NA
7-2748290-T-C p.Ser181Pro missense AMZ1 1 82840 1.20715E-5 41420 0 3.99074E-6
7-2748296-C-G p.Leu183Val missense AMZ1 1 82842 1.20712E-5 41421 0 NA
7-2748297-T-C p.Leu183Pro missense AMZ1 2 82856 2.41383E-5 41428 0 3.18634E-5
7-2748304-C-T p.Pro185Pro synonymous AMZ1 3 82850 3.621E-5 41425 0 5.18743E-5
7-2748306-A-C p.His186Pro missense AMZ1 1 82832 1.20726E-5 41416 0 3.18817E-5
7-2748312-C-A p.Ala188Asp missense AMZ1 4 82818 4.82987E-5 41409 0 3.991E-6
7-2748313-C-T p.Ala188Ala synonymous AMZ1 1 82822 1.20741E-5 41411 0 3.18715E-5
7-2748313-C-G p.Ala188Ala synonymous AMZ1 3 82822 3.62223E-5 41411 0 9.15797E-5
7-2748316-G-T p.Trp189Cys missense AMZ1 1 82810 1.20758E-5 41405 0 8.32542E-6
7-2748316-G-C p.Trp189Cys missense AMZ1 1 82810 1.20758E-5 41405 0 4.99525E-5
7-2748340-T-C p.Leu197Leu synonymous AMZ1 3 82652 3.62968E-5 41326 0 NA
7-2748344-G-A p.Gly199Arg missense AMZ1 2 82578 2.42195E-5 41289 0 1.66736E-5
7-2748347-C-T p.His200Tyr missense AMZ1 1 82544 1.21148E-5 41272 0 8.34279E-6
7-2748349-C-T p.His200His splice_region+synonymous AMZ1 18 82518 2.18134E-4 41259 0 2.83716E-4
7-2748350-G-A p.Glu201Lys missense+splice_region AMZ1 27 82514 3.27217E-4 41257 0 0.00125
7-2748350-G-C p.Glu201Gln missense+splice_region AMZ1 1 82514 1.21192E-5 41257 0 6.67735E-5
7-2748358-G-A c.601+8G>A splice_region AMZ1 4 82386 4.85519E-5 41193 0 6.80921E-5
7-2748701-C-G c.602-8C>G splice_region AMZ1 3 82520 3.63548E-5 41260 0 1.39628E-4
7-2748703-C-G c.602-6C>G splice_region AMZ1 1 82552 1.21136E-5 41276 0 NA
7-2748705-C-G c.602-4C>G splice_region AMZ1 3 82568 3.63337E-5 41284 0 8.98844E-6
7-2748705-C-T c.602-4C>T splice_region AMZ1 1 82568 1.21112E-5 41284 0 NA
7-2748713-G-A p.Val202Val synonymous AMZ1 5 82592 6.05386E-5 41296 0 1.24243E-4
7-2748716-C-T p.Gly203Gly synonymous AMZ1 13 82588 1.57408E-4 41294 0 1.59317E-4
7-2748717-G-A p.Val204Ile missense AMZ1 83 82612 0.0010047 41306 1 0.00229358
7-2748717-G-C p.Val204Leu missense AMZ1 2 82612 2.42096E-5 41306 0 NA
7-2748718-T-G p.Val204Gly missense AMZ1 2 82618 2.42078E-5 41309 0 NA
7-2748722-C-T p.Cys205Cys synonymous AMZ1 2 82632 2.42037E-5 41316 0 5.04032E-4
7-2748725-C-T p.Ser206Ser synonymous AMZ1 2 82632 2.42037E-5 41316 0 NA
7-2748728-C-T p.Phe207Phe synonymous AMZ1 15 82616 1.81563E-4 41308 0 6.37389E-4
7-2748729-G-T p.Ala208Ser missense AMZ1 4 82576 4.84402E-5 41288 0 3.18735E-5
7-2748729-G-A p.Ala208Thr missense AMZ1 4 82576 4.84402E-5 41288 0 9.56206E-5
7-2748732-C-T p.Arg209Trp missense AMZ1 9 82562 1.09009E-4 41281 0 5.04032E-4
7-2748734-G-T p.Arg209Arg synonymous AMZ1 1 82518 1.21186E-5 41259 0 8.34927E-6
7-2748737-C-T p.Phe210Phe synonymous AMZ1 1 82502 1.21209E-5 41251 0 NA
7-2748738-T-G p.Ser211Ala missense AMZ1 1 82480 1.21242E-5 41240 0 1.67062E-5
7-2748750-C-T p.Pro215Ser missense AMZ1 1 82224 1.21619E-5 41112 0 5.45256E-5
7-2748751-C-T p.Pro215Leu missense AMZ1 4 82164 4.86831E-5 41082 0 6.30162E-5
7-2748752-G-A p.Pro215Pro synonymous AMZ1 4 82120 4.87092E-5 41060 0 1.83033E-5
7-2748753-A-G p.Lys216Glu missense AMZ1 2 82082 2.43659E-5 41041 0 NA
7-2748755-G-A p.Lys216Lys synonymous AMZ1 1 82044 1.21886E-5 41022 0 5.48978E-5
7-2748757-C-T p.Ser217Leu missense AMZ1 3 81966 3.66005E-5 40983 0 6.73531E-5
7-2748758-G-C p.Ser217Ser synonymous AMZ1 10790 81306 0.132709 40653 901 0.179595
7-2748758-G-A p.Ser217Ser synonymous AMZ1 26 81920 3.17383E-4 40960 0 8.19288E-4
7-2748761-G-T p.Gly218Gly synonymous AMZ1 2 81764 2.44606E-5 40882 0 5.04032E-4
7-2748761-GCCCAGCGC-G p.Ser220fs frameshift AMZ1 1 81764 1.22303E-5 40882 0 NA
7-2748762-C-T p.Pro219Ser missense AMZ1 4 81716 4.895E-5 40858 0 0.00125
7-2748762-C-A p.Pro219Thr missense AMZ1 2 81716 2.4475E-5 40858 0 9.09802E-6
7-2748767-C-T p.Ser220Ser synonymous AMZ1 7 81370 8.60268E-5 40685 0 1.61822E-4
7-2748768-G-A p.Ala221Thr missense AMZ1 10 81270 1.23047E-4 40635 0 6.25782E-4
7-2748774-G-C p.Asp223His missense AMZ1 1 81052 1.23378E-5 40526 0 9.56145E-5
7-2748787-T-C p.Val227Ala missense AMZ1 135 80188 0.00168354 40094 0 0.00219879
7-2748791-G-A p.Glu228Glu synonymous AMZ1 1 80088 1.24863E-5 40044 0 NA
7-2748796-C-T p.Ala230Val missense AMZ1 21 79858 2.62967E-4 39929 1 0.00125471
7-2748801-G-T p.Asp232Tyr missense AMZ1 1 79504 1.2578E-5 39752 0 4.98629E-6
7-2748803-C-T p.Asp232Asp synonymous AMZ1 11697 77896 0.150162 38948 969 0.198686
7-2748803-CGGCCCCG-C p.Gly233fs frameshift AMZ1 13 79210 1.64121E-4 39605 0 1.27714E-4
7-2748804-G-A p.Gly233Ser missense AMZ1 53 79022 6.70699E-4 39511 2 0.00188917
7-2748808-C-A p.Pro234His missense AMZ1 2 78798 2.53814E-5 39399 0 5.04032E-4
7-2748809-C-T p.Pro234Pro synonymous AMZ1 7 78664 8.89861E-5 39332 0 0.00100908
7-2748810-G-A p.Glu235Lys missense AMZ1 59 78606 7.50579E-4 39303 0 0.00169091
7-2748811-AG-A p.Ala236fs frameshift AMZ1 9 78486 1.1467E-4 39243 0 1.27632E-4
7-2748814-C-A p.Ala236Asp missense AMZ1 3 78376 3.8277E-5 39188 0 3.19E-5
7-2748819-C-T p.Leu238Leu synonymous AMZ1 2 78358 2.55239E-5 39179 0 NA
7-2748820-T-G p.Leu238Arg missense AMZ1 3 78246 3.83406E-5 39123 0 3.19203E-5
7-2748823-A-G p.Gln239Arg missense AMZ1 1 78072 1.28087E-5 39036 0 NA
7-2748830-G-T p.Arg241Ser missense AMZ1 12 77596 1.54647E-4 38798 0 1.37203E-4
7-2748832-G-T p.Gly242Val missense AMZ1 3 77424 3.87477E-5 38712 0 1.1612E-5
7-2748833-C-T p.Gly242Gly synonymous AMZ1 2 77334 2.58618E-5 38667 0 NA
7-2748844-G-C p.Cys246Ser missense AMZ1 172 76560 0.0022466 38280 0 0.00520069
7-2748844-G-A p.Cys246Tyr missense AMZ1 3 76576 3.91768E-5 38288 0 2.40082E-5
7-2748848-C-T p.Phe247Phe synonymous AMZ1 1 76406 1.3088E-5 38203 0 6.31313E-4
7-2748856-T-C p.Leu250Pro missense AMZ1 80 75826 0.00105505 37913 0 0.00182016
7-2748858-G-C p.Gly251Arg missense AMZ1 2 75782 2.63915E-5 37891 0 6.13843E-6
7-2748860-G-T p.Gly251Gly synonymous AMZ1 3 75620 3.9672E-5 37810 0 9.80841E-5
7-2748860-G-A p.Gly251Gly synonymous AMZ1 2 75620 2.6448E-5 37810 0 1.08982E-5
7-2748869-G-A p.Gln254Gln synonymous AMZ1 1 74596 1.34055E-5 37298 0 6.37276E-6
7-2748871-G-A p.Cys255Tyr missense AMZ1 1 74296 1.34597E-5 37148 0 1.27618E-5
7-2748872-C-T p.Cys255Cys synonymous AMZ1 8 74176 1.07852E-4 37088 1 1.27938E-5
7-2748882-G-A c.771+4G>A splice_region AMZ1 1 72940 1.37099E-5 36470 0 NA
7-2748882-GGTGGGGGCTCTGGGGCTGGTAA-G c.771+5_771+26delGTGGGGGCTCTGGGGCTGGTAA splice_region AMZ1 1 72940 1.37099E-5 36470 0 NA
7-2748886-G-A c.771+8G>A splice_region AMZ1 2 72278 2.76709E-5 36139 0 1.59581E-4
7-2749270-C-G c.772-4C>G splice_region AMZ1 1 79126 1.26381E-5 39563 0 4.06855E-6
7-2749278-C-T p.Thr259Met missense AMZ1 9 79204 1.13631E-4 39602 0 3.04712E-4
7-2749279-G-A p.Val203Met missense AMZ1 3 79190 3.78836E-5 39595 0 3.18613E-5
7-2749280-T-A p.Cys260Ser missense AMZ1 1 79300 1.26103E-5 39650 0 4.0594E-6
7-2749285-C-T p.Arg205* stop_gained AMZ1 7 79332 8.82368E-5 39666 0 6.74787E-5
7-2749286-G-A p.Glu262Lys missense AMZ1 1 79344 1.26033E-5 39672 0 4.86476E-5
7-2749295-C-T p.His265Tyr missense AMZ1 2 79652 2.51092E-5 39826 0 1.68614E-5
7-2749297-C-A p.His265Gln missense AMZ1 2 79776 2.50702E-5 39888 0 3.18532E-5
7-2749298-C-T p.Leu266Phe missense AMZ1 1 79772 1.25357E-5 39886 0 3.18552E-5
7-2749303-G-C p.Gly211Arg missense AMZ1 2 79914 2.50269E-5 39957 0 1.01172E-4
7-2749304-G-T p.Gly268Cys missense AMZ1 1 79886 1.25178E-5 39943 0 NA
7-2749307-C-T p.Pro212Leu missense AMZ1 4 80068 4.99575E-5 40034 0 NA
7-2749308-T-C p.Leu269Pro missense AMZ1 1 80124 1.24807E-5 40062 0 NA
7-2749309-G-A p.Gly213Arg missense AMZ1 11 80166 1.37215E-4 40083 0 3.50363E-4
7-2749317-G-T p.Cys272Phe missense AMZ1 57 80434 7.08656E-4 40217 0 6.31313E-4
7-2749318-C-T p.Pro216Ser missense AMZ1 81 80458 0.00100674 40229 1 0.002421
7-2749319-C-T p.Arg273Cys missense AMZ1 12 80498 1.49072E-4 40249 0 6.37146E-5
7-2749326-T-C p.Leu275Pro missense AMZ1 1 80754 1.23833E-5 40377 0 NA
7-2749328-C-T p.Arg276Cys missense AMZ1 13 80810 1.60871E-4 40405 0 2.54858E-4
7-2749329-G-A p.Arg276His missense AMZ1 1 80842 1.23698E-5 40421 0 5.05715E-5
7-2749333-C-A p.Cys277* stop_gained AMZ1 3 81086 3.69978E-5 40543 0 NA
7-2749337-A-T p.Met279Leu missense AMZ1 1 81216 1.23128E-5 40608 0 1.6852E-5
7-2749338-T-A p.Met279Lys missense AMZ1 3 81248 3.6924E-5 40624 0 1.68549E-5
7-2749347-C-T p.Ala282Val missense AMZ1 5 81420 6.141E-5 40710 0 1.59297E-4
7-2749348-G-A p.Ala226Thr missense AMZ1 2 81470 2.45489E-5 40735 0 2.53314E-5
7-2749356-T-G p.Leu285Arg missense AMZ1 1 81690 1.22414E-5 40845 0 3.18532E-5
7-2749359-A-G p.Asp286Gly missense AMZ1 1 81744 1.22333E-5 40872 0 NA
7-2749360-C-T p.Arg230* stop_gained AMZ1 7 81744 8.56332E-5 40872 0 9.55657E-5
7-2749361-G-A p.Glu287Lys missense AMZ1 4 81750 4.89297E-5 40875 0 0.00100908
7-2749364-G-C p.Ala288Pro missense AMZ1 61 81724 7.46415E-4 40862 0 6.45435E-4
7-2749365-C-T p.Ala288Val missense AMZ1 1 81762 1.22306E-5 40881 0 2.23001E-4
7-2749370-C-T p.Arg290Trp missense AMZ1 41 81812 5.01149E-4 40906 0 7.32904E-4
7-2749371-G-A p.Arg290Gln missense AMZ1 11 81816 1.34448E-4 40908 0 7.64721E-4
7-2749373-C-T p.Arg291Trp missense AMZ1 23 81808 2.81146E-4 40904 0 6.27353E-4
7-2749374-G-A p.Arg291Gln missense AMZ1 2 81816 2.44451E-5 40908 0 6.84352E-5
7-2749376-C-A p.Pro292Thr missense AMZ1 2 81732 2.44702E-5 40866 0 8.54438E-6
7-2749387-C-A p.Leu239Met missense AMZ1 1 81906 1.22091E-5 40953 0 4.02295E-6
7-2749390-T-C p.Ser240Pro missense AMZ1 1 81950 1.22026E-5 40975 0 6.37227E-5
7-2749393-C-T p.His241Tyr missense AMZ1 4 82020 4.87686E-5 41010 0 3.1841E-5
7-2749403-A-C p.Glu244Ala missense AMZ1 3 82040 3.65675E-5 41020 0 2.01105E-5
7-2749411-G-A p.Ala247Thr missense AMZ1 2 81986 2.43944E-5 40993 0 1.59215E-4
7-2749418-G-A p.Val306Ile missense AMZ1 1 81940 1.22041E-5 40970 0 NA
7-2749423-G-A p.Gly251Arg missense AMZ1 1 81918 1.22073E-5 40959 0 NA
7-2749426-T-G p.Phe252Val missense AMZ1 1 81882 1.22127E-5 40941 0 NA
7-2749431-G-T p.Arg310Met missense AMZ1 4 81880 4.8852E-5 40940 0 3.18431E-5
7-2749433-C-T p.Leu311Phe missense AMZ1 1 81832 1.22202E-5 40916 0 8.07318E-6
7-2749434-T-G p.Leu311Arg missense AMZ1 1 81822 1.22217E-5 40911 0 NA
7-2749435-C-T p.His255Tyr missense AMZ1 1 81780 1.22279E-5 40890 0 8.8821E-6
7-2749437-T-C p.Ile312Thr missense AMZ1 25 81748 3.05818E-4 40874 0 4.03763E-4
7-2749438-C-T p.Arg256* stop_gained AMZ1 7 81706 8.5673E-5 40853 1 0.0010101
7-2749438-C-G p.Ile312Met missense AMZ1 3 81708 3.67161E-5 40854 0 3.18552E-5
7-2749439-G-A p.Glu313Lys missense AMZ1 4 81690 4.89656E-5 40845 0 6.26152E-5
7-2749439-G-C p.Glu313Gln missense AMZ1 3 81690 3.67242E-5 40845 0 NA
7-2749447-C-A p.Tyr315* stop_gained AMZ1 1 81538 1.22642E-5 40769 0 9.1181E-6
7-2749451-G-T c.948+1G>T splice_donor AMZ1 1 81478 1.22733E-5 40739 0 3.18512E-5
7-2749451-G-A c.948+1G>A splice_donor AMZ1 1 81478 1.22733E-5 40739 0 1.85123E-5
7-2749452-T-G c.948+2T>G splice_donor AMZ1 1 81392 1.22862E-5 40696 0 NA
7-2751959-C-T c.949-5C>T splice_region AMZ1 1 80346 1.24462E-5 40173 0 NA
7-2751963-G-C c.949-1G>C splice_acceptor AMZ1 4 80418 4.97401E-5 40209 0 4.15395E-5
7-2751972-C-A p.Tyr319* stop_gained AMZ1 2 80508 2.48423E-5 40254 0 NA
7-2751974-C-G p.Thr320Ser missense AMZ1 1 80514 1.24202E-5 40257 0 NA
7-2751976-T-C p.Trp321Arg missense AMZ1 1 80528 1.2418E-5 40264 0 NA
7-2751977-G-A p.Trp321* stop_gained AMZ1 1 80540 1.24162E-5 40270 0 NA
7-2751979-A-T p.Thr322Ser missense AMZ1 1 80502 1.24221E-5 40251 0 0.00101112
7-2751979-A-G p.Thr322Ala missense AMZ1 1 80502 1.24221E-5 40251 0 4.40323E-6
7-2751982-C-T p.Gln323* stop_gained AMZ1 1 80528 1.2418E-5 40264 0 NA
7-2751985-G-C p.Ala324Pro missense AMZ1 1 80472 1.24267E-5 40236 0 NA
7-2751986-C-T p.Ala324Val missense AMZ1 5 80440 6.21581E-5 40220 0 1.08225E-4
7-2751987-G-A p.Gly268Ser missense AMZ1 334 80506 0.00414876 40253 2 0.00993441
7-2751987-G-C p.Gly268Arg missense AMZ1 3 80522 3.72569E-5 40261 0 8.6414E-6
7-2751991-G-A p.Val326Met missense AMZ1 2 80458 2.48577E-5 40229 0 8.58074E-6
7-2751997-A-C p.Thr328Pro missense AMZ1 1 80432 1.24329E-5 40216 0 NA
7-2751998-C-T p.Thr328Met missense AMZ1 11 80408 1.36802E-4 40204 0 5.05561E-4
7-2751999-G-A p.Val272Met missense AMZ1 15 80480 1.86382E-4 40240 0 5.06586E-4
7-2752005-C-T p.Gln274* stop_gained AMZ1 2 80552 2.48287E-5 40276 0 3.18512E-5
7-2752010-A-G p.Gln332Arg missense AMZ1 1 80560 1.24131E-5 40280 0 4.1868E-6
7-2752011-G-A p.Gly276Arg missense AMZ1 1 80634 1.24017E-5 40317 0 4.19576E-6
7-2752012-G-A p.Glu333Lys missense AMZ1 1 80582 1.24097E-5 40291 0 9.45412E-6
7-2752016-C-T p.Ala334Val missense AMZ1 1 80510 1.24208E-5 40255 0 6.25E-4
7-2752016-C-A p.Ala334Glu missense AMZ1 1 80510 1.24208E-5 40255 0 4.19372E-6
7-2752017-G-A p.Gly278Arg missense AMZ1 20 80736 2.47721E-4 40368 0 0.00202429
7-2752020-G-A p.Gly279Arg missense AMZ1 5 80744 6.19241E-5 40372 0 3.18593E-5
7-2752023-G-A p.Ala280Thr missense AMZ1 1 80684 1.2394E-5 40342 0 NA
7-2752025-C-T p.Pro337Leu missense AMZ1 3 80722 3.71646E-5 40361 0 1.27429E-4
7-2752026-G-A p.Val281Ile missense AMZ1 435 80752 0.00538686 40376 2 0.0107969
7-2752032-G-A p.Val283Met missense AMZ1 1 80882 1.23637E-5 40441 0 NA
7-2752037-A-G p.Glu341Gly missense AMZ1 1 80910 1.23594E-5 40455 0 9.06454E-6
7-2752039-G-A p.Asp342Asn missense AMZ1 1 80880 1.2364E-5 40440 0 NA
7-2752043-C-T p.Thr343Ile missense AMZ1 4 80998 4.93839E-5 40499 0 5.05561E-4
7-2752043-C-A p.Thr343Asn missense AMZ1 1 80998 1.2346E-5 40499 0 NA
7-2752044-C-A p.Pro287Thr missense AMZ1 1 81052 1.23378E-5 40526 0 8.98909E-6
7-2752045-C-T p.Pro344Ser missense AMZ1 2 81072 2.46694E-5 40536 0 5.05561E-4
7-2752046-C-T p.Pro344Leu missense AMZ1 53 81032 6.54063E-4 40516 0 0.00151668
7-2752047-G-A p.Ala288Thr missense AMZ1 4 81008 4.93778E-5 40504 0 9.56023E-5
7-2752053-C-T p.Gln290* stop_gained AMZ1 225 81288 0.00276794 40644 0 0.00656566
7-2752056-C-T p.Arg291Cys missense AMZ1 8 81290 9.84131E-5 40645 0 0.00151822
7-2752057-G-A p.Ala348Thr missense AMZ1 6 81322 7.37808E-5 40661 0 6.25E-4
7-2752058-C-G p.Ala348Gly missense AMZ1 1 81358 1.22914E-5 40679 0 2.66297E-5
7-2752059-C-T p.Arg292* stop_gained AMZ1 1922 81334 0.023631 40667 23 0.0375
7-2752060-G-A p.Asp349Asn missense AMZ1 1 81418 1.22823E-5 40709 0 2.65755E-5
7-2752064-C-T p.Ser350Leu missense AMZ1 2 81504 2.45387E-5 40752 0 9.55901E-5
7-2752064-CGG-C p.Gly351fs frameshift AMZ1 1 81504 1.22693E-5 40752 0 NA
7-2752065-G-A p.Gly294Arg missense AMZ1 216 81536 0.00264914 40768 1 0.00442986
7-2752067-G-T p.Gly351Val missense AMZ1 1 81590 1.22564E-5 40795 0 4.06544E-6
7-2752068-C-T p.His295Tyr missense AMZ1 1 81616 1.22525E-5 40808 0 8.8358E-6
7-2752074-C-A p.Cys353* stop_gained AMZ1 1 81720 1.22369E-5 40860 0 NA
7-2752076-G-T p.Cys354Phe missense AMZ1 1 81732 1.22351E-5 40866 0 8.83783E-6
7-2752080-G-A p.Glu355Glu synonymous AMZ1 5 81712 6.11905E-5 40856 0 2.1274E-4
7-2752086-CTCGGAGCCCGGCACCAGTGTG-C p.Gly361_Pro367del conservative_inframe_deletion AMZ1 1 81636 1.22495E-5 40818 0 8.88478E-6
7-2752088-C-T p.Ser358Leu missense AMZ1 1 81620 1.22519E-5 40810 0 1.6328E-5
7-2752089-G-A p.Ser358Ser synonymous AMZ1 6 81630 7.35024E-5 40815 0 0.00151822
7-2752095-C-T p.Pro360Pro synonymous AMZ1 5 81578 6.1291E-5 40789 0 5.06586E-4
7-2752096-G-A p.Gly361Ser missense AMZ1 11 81482 1.34999E-4 40741 0 2.231E-4
7-2752097-GCACCAGTGTGTCGGAGCCCCT-G p.Ser363_Thr369del conservative_inframe_deletion AMZ1 2 81526 2.45321E-5 40763 0 8.96861E-6
7-2752100-C-T p.Thr362Ile missense AMZ1 1 81564 1.22603E-5 40782 0 4.09028E-6
7-2752101-C-T p.Thr362Thr synonymous AMZ1 1 81576 1.22585E-5 40788 0 3.59157E-5
7-2752102-AGT-A p.Ser365fs frameshift AMZ1 1 81550 1.22624E-5 40775 0 NA
7-2752104-T-C p.Ser363Ser synonymous AMZ1 46 81554 5.64043E-4 40777 0 0.00125
7-2752109-C-T p.Ser365Leu missense AMZ1 3 81528 3.67972E-5 40764 0 0.00101215
7-2752110-G-A p.Ser365Ser synonymous AMZ1 936 81518 0.0114821 40759 9 0.0135239
7-2752113-G-GCCCCTCA p.Asp371fs frameshift AMZ1 1 81538 1.22642E-5 40769 0 4.10411E-6
7-2752121-C-T p.Thr369Ile missense AMZ1 1 81616 1.22525E-5 40808 0 NA
7-2752122-C-T p.Thr369Thr synonymous AMZ1 1 81632 1.22501E-5 40816 0 3.18756E-5
7-2752123-C-G p.Pro370Ala missense AMZ1 1 81626 1.2251E-5 40813 0 9.07556E-6
7-2752124-C-T p.Pro370Leu missense AMZ1 1 81644 1.22483E-5 40822 0 NA
7-2752128-T-G p.Asp371Glu missense AMZ1 1 81630 1.22504E-5 40815 0 9.09025E-6
7-2752131-C-T p.Ala372Ala synonymous AMZ1 11 81596 1.34811E-4 40798 0 6.25782E-4
7-2752132-G-A p.Gly373Arg missense AMZ1 63 81610 7.71964E-4 40805 1 0.00202634
7-2752133-G-T p.Gly373Val missense AMZ1 1 81630 1.22504E-5 40815 0 1.82508E-5
7-2752134-G-A p.Gly373Gly synonymous AMZ1 26 81638 3.18479E-4 40819 0 0.00438048
7-2752134-G-T p.Gly373Gly synonymous AMZ1 1 81638 1.22492E-5 40819 0 4.12954E-6
7-2752146-C-T p.Phe377Phe synonymous AMZ1 5 81662 6.1228E-5 40831 0 0.00151668
7-2752147-G-A p.Ala378Thr missense AMZ1 4 81624 4.90052E-5 40812 0 6.25782E-4
7-2752148-C-T p.Ala378Val missense AMZ1 1 81632 1.22501E-5 40816 0 9.16019E-6
7-2752151-C-T p.Ser379Leu missense AMZ1 12 81642 1.46983E-4 40821 0 8.2905E-5
7-2752152-G-A p.Ser379Ser synonymous AMZ1 20071 81260 0.246997 40630 2594 0.255989
7-2752153-G-C p.Gly380Arg missense AMZ1 3 81650 3.67422E-5 40825 0 3.18735E-5
7-2752155-G-A p.Gly380Gly synonymous AMZ1 174 81624 0.00213173 40812 5 0.00260621
7-2752157-C-T p.Pro381Leu missense AMZ1 1 81682 1.22426E-5 40841 0 NA
7-2752158-A-G p.Pro381Pro synonymous AMZ1 1 81690 1.22414E-5 40845 0 NA
7-2752159-G-C p.Glu382Gln missense AMZ1 1 81728 1.22357E-5 40864 0 9.12992E-6
7-2752177-C-G p.Leu388Val missense AMZ1 1 81718 1.22372E-5 40859 0 3.18573E-5
7-2752178-T-G p.Leu388Arg missense AMZ1 3 81706 3.6717E-5 40853 0 9.87752E-5
7-2752180-G-A p.Ala389Thr missense AMZ1 147 81688 0.00179953 40844 1 0.00442986
7-2752184-C-G p.Ala390Gly missense AMZ1 1 81762 1.22306E-5 40881 0 1.82242E-5
7-2752185-C-T p.Ala390Ala synonymous AMZ1 1 81796 1.22255E-5 40898 0 3.18613E-5
7-2752187-C-G p.Ser391* stop_gained AMZ1 1 81790 1.22264E-5 40895 0 4.11147E-6
7-2752187-C-T p.Ser391Leu missense AMZ1 1 81790 1.22264E-5 40895 0 4.11147E-6
7-2752191-G-T p.Glu392Asp missense AMZ1 1 81812 1.22231E-5 40906 0 8.21618E-6
7-2752196-C-T p.Pro394Leu missense AMZ1 167 81776 0.00204216 40888 4 0.00555556
7-2752196-C-G p.Pro394Arg missense AMZ1 4 81778 4.89129E-5 40889 0 NA
7-2752197-G-A p.Pro394Pro synonymous AMZ1 5 81740 6.11696E-5 40870 0 6.37267E-5
7-2752201-C-T p.Pro396Ser missense AMZ1 5 81762 6.11531E-5 40881 0 8.5974E-5
7-2752204-C-T p.Pro397Ser missense AMZ1 1 81796 1.22255E-5 40898 0 6.25E-4
7-2752204-C-G p.Pro397Ala missense AMZ1 2 81796 2.44511E-5 40898 0 NA
7-2752206-TG-T p.Gly399fs frameshift AMZ1 1 81814 1.22228E-5 40907 0 NA
7-2752210-G-A p.Gly399Ser missense AMZ1 1 81854 1.22169E-5 40927 0 6.25E-4
7-2752213-C-G p.Pro400Ala missense AMZ1 2 81840 2.44379E-5 40920 0 NA
7-2752215-T-G p.Pro400Pro synonymous AMZ1 23 81884 2.80885E-4 40942 0 1.16623E-4
7-2752217-C-T p.Ala401Val missense AMZ1 12 81884 1.46549E-4 40942 0 1.27453E-4
7-2752217-C-A p.Ala401Glu missense AMZ1 2 81884 2.44248E-5 40942 0 NA
7-2752218-G-A p.Ala401Ala synonymous AMZ1 8 81948 9.76229E-5 40974 0 7.15372E-5
7-2752222-G-A p.Ala403Thr missense AMZ1 3 82012 3.658E-5 41006 0 3.18552E-5
7-2752224-C-T p.Ala403Ala synonymous AMZ1 5 82056 6.0934E-5 41028 0 0.004375
7-2752226-T-C p.Ile404Thr missense AMZ1 1 82106 1.21794E-5 41053 0 8.87989E-6
7-2752231-G-GA p.His407fs frameshift AMZ1 1 82202 1.21652E-5 41101 0 NA
7-2752233-G-A p.Glu406Glu synonymous AMZ1 1 82210 1.2164E-5 41105 0 8.84298E-6
7-2752237-G-T p.Glu408* stop_gained AMZ1 1 82288 1.21524E-5 41144 0 NA
7-2752239-A-G p.Glu408Glu synonymous AMZ1 1 82284 1.2153E-5 41142 0 4.04112E-6
7-2752240-C-T p.Arg409Trp missense AMZ1 7 82262 8.5094E-5 41131 0 1.2751E-4
7-2752241-G-A p.Arg409Gln missense AMZ1 18 82276 2.18776E-4 41138 0 6.25E-4
7-2752242-G-T p.Arg409Arg synonymous AMZ1 2 82286 2.43055E-5 41143 0 NA
7-2752246-C-T p.Leu411Leu synonymous AMZ1 1 82298 1.2151E-5 41149 0 3.63581E-5
7-2752253-T-C p.Met413Thr missense AMZ1 1 82384 1.21383E-5 41192 0 4.03232E-6
7-2752264-G-A p.Ala417Thr missense AMZ1 1 82444 1.21294E-5 41222 0 2.01431E-5
7-2752269-G-C p.Leu418Leu synonymous AMZ1 4 82470 4.85025E-5 41235 0 NA
7-2752270-C-T p.Gln419* stop_gained AMZ1 4 82484 4.84943E-5 41242 0 1.27527E-4
7-2752273-C-T p.Arg420Trp missense AMZ1 6 82480 7.27449E-5 41240 0 6.04543E-5
7-2752274-G-A p.Arg420Gln missense AMZ1 4 82518 4.84743E-5 41259 0 6.37552E-5
7-2752278-A-C p.Glu421Asp missense AMZ1 8 82528 9.69368E-5 41264 0 6.25E-4
7-2752288-G-A p.Glu425Lys missense AMZ1 1 82534 1.21162E-5 41267 0 NA
7-2752290-G-C p.Glu425Asp missense AMZ1 1 82540 1.21153E-5 41270 0 NA
7-2752294-C-A p.Leu427Met missense AMZ1 1 82520 1.21183E-5 41260 0 NA
7-2752296-G-C p.Leu427Leu synonymous AMZ1 1 82524 1.21177E-5 41262 0 NA
7-2752297-G-C p.Val428Leu missense AMZ1 1 82524 1.21177E-5 41262 0 NA
7-2752306-G-C p.Asp431His missense AMZ1 1 82518 1.21186E-5 41259 0 NA
7-2752308-C-T p.Asp431Asp synonymous AMZ1 1 82514 1.21192E-5 41257 0 NA
7-2752312-G-A p.Ala433Thr missense AMZ1 1 82530 1.21168E-5 41265 0 NA
7-2752314-C-T p.Ala433Ala synonymous AMZ1 37 82550 4.48213E-4 41275 0 0.005
7-2752315-G-A p.Val434Met missense AMZ1 9 82570 1.08998E-4 41285 0 6.25E-4
7-2752315-G-T p.Val434Leu missense AMZ1 2 82570 2.42219E-5 41285 0 4.02518E-6
7-2752317-G-A p.Val434Val synonymous AMZ1 11 82592 1.33185E-4 41296 0 0.001875
7-2752320-C-T p.Asp435Asp synonymous AMZ1 23 82580 2.78518E-4 41290 0 0.0015121
7-2752322-C-T p.Ala436Val missense AMZ1 119 82570 0.0014412 41285 1 0.00161296
7-2752326-C-T p.Leu437Leu synonymous AMZ1 3 82578 3.63293E-5 41289 0 0.00125
7-2752327-G-A p.Asp438Asn missense AMZ1 4 82548 4.84567E-5 41274 0 8.47225E-5
7-2752327-G-C p.Asp438His missense AMZ1 4 82548 4.84567E-5 41274 0 2.0172E-5
7-2752328-A-G p.Asp438Gly missense AMZ1 2 82560 2.42248E-5 41280 0 3.19061E-5
7-2752329-C-T p.Asp438Asp synonymous AMZ1 1 82600 1.21065E-5 41300 0 4.03551E-6
7-2752330-C-T p.Arg439Cys missense AMZ1 729 82594 0.00882631 41297 8 0.016875
7-2752333-T-C p.Trp440Arg missense AMZ1 2 82618 2.42078E-5 41309 0 2.59484E-5
7-2752334-G-A p.Trp440* stop_gained AMZ1 1 82640 1.21007E-5 41320 0 3.18918E-5
7-2752334-G-T p.Trp440Leu missense AMZ1 1 82640 1.21007E-5 41320 0 4.03672E-6
7-2752344-C-T p.Phe443Phe synonymous AMZ1 1 82640 1.21007E-5 41320 0 NA
7-2752346-C-T p.Thr444Met missense AMZ1 53 82630 6.41414E-4 41315 0 0.00148177
7-2752347-G-A p.Thr444Thr synonymous AMZ1 10 82634 1.21016E-4 41317 0 1.27518E-4
7-2752358-C-T p.Pro448Leu missense AMZ1 5 82574 6.05517E-5 41287 0 1.91278E-4
7-2752359-G-A p.Pro448Pro synonymous AMZ1 5 82548 6.05708E-5 41274 0 3.26648E-5
7-2752361-C-CCACCAGGCAGGACCCACCCAGCAGCAGGGA p.Thr450_Asp459dup disruptive_inframe_insertion AMZ1 1 82518 1.21186E-5 41259 0 NA
7-2752365-C-G p.Thr450Thr synonymous AMZ1 1 82556 1.2113E-5 41278 0 NA
7-2752366-A-C p.Arg451Arg synonymous AMZ1 1 82544 1.21148E-5 41272 0 NA
7-2752367-GGC-AGG p.ArgGln451LysGlu missense AMZ1 2 82524 2.42354E-5 41262 0 NA
7-2752369-C-A p.Gln452Lys missense AMZ1 2 82498 2.4243E-5 41249 0 NA
7-2752375-C-G p.Pro454Ala missense AMZ1 2 82486 2.42465E-5 41243 0 5.03525E-4
7-2752383-C-A p.Ser456Arg missense AMZ1 319 82470 0.00386807 41235 2 0.00347466
7-2752392-C-T p.Asp459Asp synonymous AMZ1 2 82354 2.42854E-5 41177 0 3.18695E-5
7-2752394-G-A p.Ser460Asn missense AMZ1 17 82300 2.06561E-4 41150 0 7.01352E-4
7-2752395-C-T p.Ser460Ser synonymous AMZ1 21 82260 2.55288E-4 41130 1 0.00100705
7-2752396-G-A p.Val461Met missense AMZ1 2 82256 2.43143E-5 41128 0 4.22379E-5
7-2752397-T-C p.Val461Ala missense AMZ1 1 82232 1.21607E-5 41116 0 NA
7-2752399-G-C p.Gly462Arg missense AMZ1 2 82204 2.43297E-5 41102 0 NA
7-2752400-G-A p.Gly462Glu missense AMZ1 1 82186 1.21675E-5 41093 0 4.26862E-6
7-2752405-C-T p.Arg464Cys missense AMZ1 3 82080 3.65497E-5 41040 0 5.03525E-4
7-2752406-G-A p.Arg464His missense AMZ1 5 82058 6.09325E-5 41029 0 2.23214E-4
7-2752428-C-T p.Phe471Phe synonymous AMZ1 1 81654 1.22468E-5 40827 0 6.37592E-5
7-2752430-C-T p.Ser472Phe missense AMZ1 1 81622 1.22516E-5 40811 0 9.63363E-6
7-2752430-C-G p.Ser472Cys missense AMZ1 1 81622 1.22516E-5 40811 0 NA
7-2752436-T-G p.Leu474Arg missense AMZ1 1 81516 1.22675E-5 40758 0 NA
7-2752437-G-A p.Leu474Leu synonymous AMZ1 2 81506 2.45381E-5 40753 0 NA
7-2752439-G-A p.Arg475Lys missense AMZ1 1 81494 1.22708E-5 40747 0 5.12458E-6
7-2752440-G-A p.Arg475Arg synonymous AMZ1 1 81486 1.2272E-5 40743 0 NA
7-2752446-G-C p.Lys477Asn missense AMZ1 10 81398 1.22853E-4 40699 0 2.8688E-4
7-2752449-G-C p.Leu478Leu synonymous AMZ1 1 81376 1.22886E-5 40688 0 6.37674E-5
7-2752456-C-T p.Arg481* stop_gained AMZ1 181 81314 0.00222594 40657 1 0.00175817
7-2752457-G-A p.Arg481Gln missense AMZ1 4 81306 4.91969E-5 40653 0 0.00165795
7-2752465-G-A p.Ala484Thr missense AMZ1 6 81290 7.38098E-5 40645 0 0.00100705
7-2752467-C-G p.Ala484Ala synonymous AMZ1 2 81284 2.46051E-5 40642 0 5.30436E-6
7-2752467-C-T p.Ala484Ala synonymous AMZ1 2 81284 2.46051E-5 40642 0 NA
7-2752474-G-C p.Glu487Gln missense AMZ1 1 81270 1.23047E-5 40635 0 NA
7-2752478-C-T p.Ser488Leu missense AMZ1 33 81244 4.06184E-4 40622 0 8.92459E-4
7-2752478-CG-C p.Ala489fs frameshift AMZ1 1 81246 1.23083E-5 40623 0 2.85948E-5
7-2752479-G-A p.Ser488Ser synonymous AMZ1 23 81238 2.83119E-4 40619 0 5.42161E-4
7-2752480-G-A p.Ala489Thr missense AMZ1 2 81222 2.46239E-5 40611 0 9.54253E-6
7-2752485-C-T p.Pro490Pro synonymous AMZ1 1 81216 1.23128E-5 40608 0 NA
7-2752486-C-T p.Arg491Cys missense AMZ1 16 81206 1.9703E-4 40603 0 6.25E-4
7-2752486-CG-GA p.Arg491Asp missense AMZ1 1 81206 1.23144E-5 40603 0 NA
7-2752487-G-A p.Arg491His missense AMZ1 25416 79464 0.319843 39732 4057 0.360524
7-2752491-C-T p.Pro492Pro synonymous AMZ1 2 81196 2.46318E-5 40598 0 3.18857E-5
7-2752498-G-A p.Gly495Arg missense AMZ1 1 81176 1.23189E-5 40588 0 5.62544E-6
7-2752499-G-T p.Gly495Val missense AMZ1 4 81178 4.92744E-5 40589 0 1.12499E-5
7-2752502-AAG-A p.Ser498fs frameshift AMZ1 2 81150 2.46457E-5 40575 0 3.1904E-5
7-2752506-G-A p.Glu497Glu synonymous AMZ1 1264 81130 0.0155799 40565 14 0.0133567
7-2752506-GAGTT-G p.Ter499fs frameshift AMZ1 3 81168 3.69604E-5 40584 0 1.14211E-5
7-2752506-G-C p.Glu497Asp missense AMZ1 1 81168 1.23201E-5 40584 0 NA
7-2752733-G-A c.*654G>A splice_region AMZ1 1 26772 3.73525E-5 13386 0 NA