Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
3-49454794-A-G p.Ser382Pro missense AMT 1 83086 1.20357E-5 41543 0 NA
3-49454978-TGAG-T p.Leu402del conservative_inframe_deletion AMT 1 83336 1.19996E-5 41668 0 3.18756E-5
3-49454983-G-T p.Thr401Asn missense AMT 1 83350 1.19976E-5 41675 0 1.64813E-5
3-49454986-T-C p.Tyr400Cys missense AMT 1 83346 1.19982E-5 41673 0 NA
3-49454987-A-G p.Tyr400His missense AMT 1 83348 1.19979E-5 41674 0 1.19301E-5
3-49454988-G-A p.Tyr399Tyr synonymous AMT 1 83348 1.19979E-5 41674 0 5.03525E-4
3-49455007-G-A p.Pro393Leu missense AMT 1 83308 1.20036E-5 41654 0 NA
3-49455023-C-T p.Val388Ile missense AMT 3 83272 3.60265E-5 41636 0 1.64851E-5
3-49455028-A-G p.Met386Thr missense AMT 1 83254 1.20114E-5 41627 0 8.24266E-5
3-49455029-TCTG-T p.Gln385del conservative_inframe_deletion AMT 2 83244 2.40258E-5 41622 0 6.37389E-5
3-49455040-C-T p.Arg382Gln missense AMT 112 83244 0.00134544 41622 0 0.00258093
3-49455043-C-T p.Arg381Gln missense AMT 2 83244 2.40258E-5 41622 0 6.37146E-5
3-49455044-G-T c.1137+4C>A splice_region AMT 1 83240 1.20135E-5 41620 0 3.18613E-5
3-49455049-T-G p.Glu379Ala missense+splice_region AMT 13 83256 1.56145E-4 41628 0 3.18573E-4
3-49455054-C-T p.Leu377Leu synonymous AMT 1 83258 1.20109E-5 41629 0 NA
3-49455060-C-T p.Met375Ile missense AMT 1 83248 1.20123E-5 41624 0 8.24633E-6
3-49455069-T-C p.Pro372Pro synonymous AMT 1 83252 1.20117E-5 41626 0 NA
3-49455073-C-T p.Arg371His missense AMT 20 83228 2.40304E-4 41614 0 5.03525E-4
3-49455073-C-A p.Arg371Leu missense AMT 1 83230 1.20149E-5 41615 0 6.37349E-5
3-49455074-G-A p.Arg371Cys missense AMT 1 83234 1.20143E-5 41617 0 3.97719E-6
3-49455088-G-A p.Pro366Leu missense AMT 4 83192 4.80815E-5 41596 0 7.9545E-6
3-49455091-A-G p.Val365Ala missense AMT 1 83208 1.20181E-5 41604 0 3.97747E-6
3-49455098-C-G p.Gly363Arg missense AMT 2 83210 2.40356E-5 41605 0 NA
3-49455102-C-T p.Ala361Ala synonymous AMT 3 83190 3.6062E-5 41595 0 5.03525E-4
3-49455103-G-A p.Ala361Val missense AMT 6 83162 7.21483E-5 41581 0 5.03525E-4
3-49455123-G-T p.Pro354Pro synonymous AMT 2 83102 2.40668E-5 41551 0 5.03525E-4
3-49455123-G-C p.Pro354Pro synonymous AMT 1 83102 1.20334E-5 41551 0 3.98232E-6
3-49455142-G-C p.Thr348Ser missense AMT 1 82992 1.20494E-5 41496 0 3.98089E-6
3-49455148-GTACCTGTCAAGCAAGCATAAGCCACGCATCAGCACCACCCTGCCAGTGCCCCCACCCTCCTGGGAAGAGACAAGGGTTTCCCAGCTTCCCTGGTCCACC-G p.Gly345_Thr346delinsAla splice_acceptor AMT 7 82950 8.43882E-5 41475 0 NA
3-49455155-T-C c.1034-4A>G splice_region AMT 1 82872 1.20668E-5 41436 0 NA
3-49455159-G-A c.1034-8C>T splice_region AMT 1 82848 1.20703E-5 41424 0 NA
3-49455248-TAC-CAG c.1033+1_1033+3delGTAinsCTG splice_donor AMT 1 82992 1.20494E-5 41496 0 NA
3-49455275-G-A p.Leu337Leu synonymous AMT 1 83052 1.20406E-5 41526 0 NA
3-49455284-T-G p.Ser334Arg missense AMT 2 83050 2.40819E-5 41525 0 6.37552E-5
3-49455285-G-C p.His333Gln missense AMT 1 83038 1.20427E-5 41519 0 3.98032E-6
3-49455293-G-A p.Arg331Trp missense AMT 2 83038 2.40854E-5 41519 0 3.18918E-5
3-49455295-A-G p.Met330Thr missense AMT 1 83056 1.20401E-5 41528 0 NA
3-49455301-G-GC p.Ala328fs frameshift AMT 1 83018 1.20456E-5 41509 0 NA
3-49455309-A-G p.Cys325Cys synonymous AMT 1 83032 1.20435E-5 41516 0 NA
3-49455323-C-T p.Val321Met missense AMT 14 83010 1.68654E-4 41505 0 1.19426E-4
3-49455325-C-T p.Arg320His missense AMT 10 83000 1.20482E-4 41500 0 1.27445E-4
3-49455328-C-T p.Arg319Lys missense AMT 1 82980 1.20511E-5 41490 0 3.98061E-6
3-49455330-C-T p.Arg262Arg splice_region+synonymous AMT 24000 82392 0.29129 41196 3692 0.32875
3-49455331-C-T p.Arg318Gln missense AMT 2 82966 2.41063E-5 41483 0 3.18756E-5
3-49455332-G-A p.Arg318Trp missense AMT 4 82930 4.82335E-5 41465 0 3.32956E-5
3-49455340-C-T p.Arg315Lys missense AMT 3 82928 3.6176E-5 41464 0 2.50367E-5
3-49455351-C-A p.Gln311His missense AMT 1 82796 1.20779E-5 41398 0 NA
3-49455361-A-G p.Ile308Thr missense AMT 1 82710 1.20904E-5 41355 0 NA
3-49455386-T-C p.Met300Val missense AMT 124 82250 0.0015076 41125 0 0.00366709
3-49455387-A-G p.Ala299Ala synonymous AMT 1 82232 1.21607E-5 41116 0 2.03554E-5
3-49455393-T-C p.Arg297Arg synonymous AMT 5 81902 6.10486E-5 40951 0 5.04032E-4
3-49455397-C-T p.Arg296His missense AMT 1 81596 1.22555E-5 40798 0 3.30186E-5
3-49455398-G-A p.Arg296Cys missense AMT 2 81562 2.45212E-5 40781 0 4.12545E-6
3-49455400-C-A p.Arg295Leu missense AMT 1 81362 1.22908E-5 40681 0 1.21652E-5
3-49455400-C-T p.Arg295His missense AMT 1 81362 1.22908E-5 40681 0 NA
3-49455407-C-T c.878-1G>A splice_acceptor AMT 2 81058 2.46737E-5 40529 0 3.19E-5
3-49456420-G-T p.Ser287Arg missense AMT 1 82472 1.21253E-5 41236 0 NA
3-49456420-G-C p.Ser287Arg missense AMT 1 82472 1.21253E-5 41236 0 NA
3-49456423-G-T p.Gly286Gly synonymous AMT 9 82550 1.09025E-4 41275 0 2.23342E-4
3-49456438-A-T p.Thr281Thr synonymous AMT 1 82782 1.20799E-5 41391 0 8.27335E-6
3-49456456-A-T p.Asn275Lys missense AMT 25 82954 3.01372E-4 41477 0 5.03525E-4
3-49456459-C-G p.Gly274Gly synonymous AMT 2 82942 2.41132E-5 41471 0 1.07407E-4
3-49456461-C-T p.Gly274Arg missense AMT 1 82954 1.20549E-5 41477 0 NA
3-49456474-G-T p.Gly269Gly synonymous AMT 1 82962 1.20537E-5 41481 0 1.65276E-5
3-49456475-C-T p.Gly269Asp missense AMT 2 82950 2.41109E-5 41475 0 NA
3-49456483-C-T p.Leu266Leu synonymous AMT 5 83006 6.02366E-5 41503 0 8.262E-6
3-49456487-C-T p.Arg265His missense AMT 3 82988 3.61498E-5 41494 0 2.47893E-5
3-49456495-G-A p.Asp262Asp synonymous AMT 1 83012 1.20465E-5 41506 0 3.18979E-5
3-49456529-G-C p.Pro251Arg missense AMT 2 83044 2.40836E-5 41522 0 3.58132E-5
3-49456531-G-A p.Asn250Asn synonymous AMT 2 83030 2.40877E-5 41515 0 1.65418E-5
3-49456556-T-G p.His242Pro missense AMT 2 82956 2.41092E-5 41478 0 NA
3-49456567-C-T p.Ala238Ala synonymous AMT 12 82882 1.44784E-4 41441 0 8.76739E-5
3-49456568-G-A p.Ala238Val missense AMT 13 82866 1.5688E-4 41433 0 7.17303E-5
3-49456573-C-T p.Pro236Pro synonymous AMT 1 82832 1.20726E-5 41416 0 8.31421E-6
3-49456576-C-T p.Val235Val synonymous AMT 7 82818 8.45227E-5 41409 0 1.59469E-5
3-49456577-A-G p.Val235Ala missense AMT 2 82830 2.41458E-5 41415 0 1.66207E-5
3-49456583-A-G p.Ile233Thr missense+splice_region AMT 1 82814 1.20753E-5 41407 0 NA
3-49456587-G-A c.697-3C>T splice_region AMT 16 82794 1.93251E-4 41397 0 6.1601E-4
3-49456687-A-G c.696+6T>C splice_region AMT 1 82602 1.21062E-5 41301 0 NA
3-49456705-C-T p.Glu228Glu synonymous AMT 1 82742 1.20858E-5 41371 0 NA
3-49456708-T-C p.Gly227Gly synonymous AMT 1 82724 1.20884E-5 41362 0 NA
3-49456725-G-A p.Arg222Cys missense AMT 4 82788 4.83162E-5 41394 0 1.65642E-5
3-49456731-C-T p.Val220Met missense AMT 6 82782 7.24795E-5 41391 0 9.5584E-5
3-49456732-G-A p.Arg219Arg synonymous AMT 4 82756 4.83349E-5 41378 0 3.18695E-5
3-49456734-G-A p.Arg219Cys missense AMT 1 82758 1.20834E-5 41379 0 4.38069E-5
3-49456747-G-A p.Gly214Gly synonymous AMT 5 82688 6.04683E-5 41344 0 1.65981E-5
3-49456751-A-C p.Phe213Cys missense AMT 8 82718 9.67141E-5 41359 0 1.1951E-5
3-49456754-A-G p.Val212Ala missense AMT 39 82682 4.71687E-4 41341 0 0.00251762
3-49456758-C-T p.Glu211Lys missense AMT 999 82704 0.0120792 41352 14 0.03625
3-49456758-C-G p.Glu211Gln missense AMT 1 82728 1.20878E-5 41364 0 3.98419E-6
3-49456776-T-C p.Met205Val missense AMT 3 82660 3.62932E-5 41330 0 3.18613E-5
3-49456796-T-A p.Asp198Val missense AMT 2 82598 2.42137E-5 41299 0 1.99545E-5
3-49456800-C-G p.Asp197His missense AMT 10 82590 1.2108E-4 41295 0 2.63572E-4
3-49456806-C-T p.Val195Met missense AMT 3 82578 3.63293E-5 41289 0 1.45304E-4
3-49456807-G-A p.Gly194Gly synonymous AMT 3 82582 3.63275E-5 41291 0 9.99568E-5
3-49456810-G-A p.Ala193Ala synonymous AMT 1 82578 1.21098E-5 41289 0 4.29361E-5
3-49456811-G-A p.Ala193Val missense AMT 1 82562 1.21121E-5 41281 0 NA
3-49456823-T-G p.Gln189Pro missense AMT 4 82532 4.8466E-5 41266 0 8.02794E-6
3-49456834-G-A p.Pro185Pro synonymous AMT 5 82526 6.0587E-5 41263 0 1.59398E-4
3-49456846-C-G c.551-8G>C splice_region AMT 1 82434 1.21309E-5 41217 0 NA
3-49457136-C-T c.550+7G>A splice_region AMT 2 83168 2.40477E-5 41584 0 NA
3-49457145-T-C p.Gln183Arg missense+splice_region AMT 1 83196 1.20198E-5 41598 0 NA
3-49457159-G-A p.Ala178Ala synonymous AMT 1 83232 1.20146E-5 41616 0 NA
3-49457160-G-A p.Ala178Val missense AMT 3 83238 3.60412E-5 41619 0 8.23723E-6
3-49457167-C-T p.Asp176Asn missense AMT 2 83242 2.40263E-5 41621 0 4.9425E-5
3-49457173-C-A p.Val174Leu missense AMT 1 83248 1.20123E-5 41624 0 NA
3-49457183-C-G p.Val170Val synonymous AMT 25 83242 3.00329E-4 41621 0 9.87702E-4
3-49457190-C-G p.Arg168Thr missense AMT 1 83252 1.20117E-5 41626 0 1.19287E-5
3-49457191-T-G p.Arg168Arg synonymous AMT 1 83242 1.20132E-5 41621 0 NA
3-49457197-G-A p.Gln166* stop_gained AMT 1 83216 1.20169E-5 41608 0 8.23805E-6
3-49457227-A-C c.472-6T>G splice_region AMT 1 83094 1.20346E-5 41547 0 NA
3-49457636-G-A c.471+8C>T splice_region AMT 1 83292 1.2006E-5 41646 0 8.24131E-6
3-49457642-A-G c.471+2T>C splice_donor AMT 1 83296 1.20054E-5 41648 0 3.97652E-6
3-49457648-ATGAGGGCCAAATCTT-A p.Lys151_Leu155del disruptive_inframe_deletion AMT 3 83332 3.60006E-5 41666 0 3.18573E-5
3-49457652-G-A p.Leu155Phe missense AMT 1 83330 1.20005E-5 41665 0 1.2747E-4
3-49457672-C-G p.Cys148Ser missense AMT 1 83344 1.19985E-5 41672 0 NA
3-49457672-C-A p.Cys148Phe missense AMT 1 83344 1.19985E-5 41672 0 6.37064E-5
3-49457679-C-T p.Ala146Thr missense AMT 2 83350 2.39952E-5 41675 0 6.59033E-5
3-49457681-T-C p.Asn145Ser missense AMT 2 83348 2.39958E-5 41674 0 6.37105E-5
3-49457684-G-A p.Ser144Phe missense AMT 3 83352 3.59919E-5 41676 0 6.37024E-5
3-49457689-C-T p.Val142Val synonymous AMT 1 83348 1.19979E-5 41674 0 NA
3-49457690-A-C p.Val142Gly missense AMT 2 83348 2.39958E-5 41674 0 8.2375E-6
3-49457712-T-C p.Thr135Ala missense AMT 1 83326 1.20011E-5 41663 0 2.3858E-5
3-49457713-A-G p.Asn134Asn synonymous AMT 1 83334 1.19999E-5 41667 0 NA
3-49457714-T-C p.Asn134Ser missense AMT 2 83332 2.40004E-5 41666 0 2.78341E-5
3-49457735-A-G p.Leu127Ser missense AMT 1 83294 1.20057E-5 41647 0 NA
3-49457752-G-A p.Asn121Asn synonymous AMT 30 83244 3.60386E-4 41622 0 5.03525E-4
3-49457761-C-T p.Leu118Leu synonymous AMT 205 83196 0.00246406 41598 2 0.0171198
3-49457764-C-T p.Ser117Ser synonymous AMT 1 83190 1.20207E-5 41595 0 NA
3-49457765-G-A p.Ser117Leu missense AMT 1 83184 1.20215E-5 41592 0 8.24593E-6
3-49457771-G-A p.Thr115Ile missense AMT 1 83150 1.20265E-5 41575 0 1.64935E-5
3-49458956-A-G p.Val103Ala missense AMT 2 83364 2.39912E-5 41682 0 3.97627E-6
3-49458958-C-T p.Val102Val synonymous AMT 1 83366 1.19953E-5 41683 0 NA
3-49458965-C-G p.Ser100Thr missense AMT 1 83368 1.1995E-5 41684 0 NA
3-49458965-C-T p.Ser100Asn missense AMT 1 83368 1.1995E-5 41684 0 NA
3-49458966-T-C p.Ser100Gly missense AMT 1 83368 1.1995E-5 41684 0 3.97633E-6
3-49458975-G-T p.Leu97Met missense AMT 2 83368 2.399E-5 41684 0 NA
3-49458981-C-T p.Val95Met missense AMT 2 83368 2.399E-5 41684 0 1.59256E-4
3-49458983-C-T p.Arg94Gln missense AMT 6 83360 7.1977E-5 41680 0 6.25E-4
3-49458984-G-A p.Arg94Trp missense AMT 3 83362 3.59876E-5 41681 0 3.97636E-5
3-49459001-T-G p.Lys88Thr missense AMT 3 83334 3.59997E-5 41667 0 NA
3-49459008-G-GCAGCATAT c.259-4_259-3insATATGCTG splice_region AMT 1 83312 1.20031E-5 41656 0 NA
3-49459009-G-A c.259-4C>T splice_region AMT 1 83304 1.20042E-5 41652 0 8.23845E-6
3-49459011-G-GACACGTCA c.259-7_259-6insTGACGTGT splice_region AMT 1 83286 1.20068E-5 41643 0 NA
3-49459418-T-C c.-37A>G 5_prime_UTR_premature_start_codon_gain AMT 1 80416 1.24353E-5 40208 0 2.17675E-5
3-49459457-AG-A p.Leu39fs frameshift AMT 4 81084 4.93316E-5 40542 0 6.36983E-5
3-49459484-TG-T c.91-3delC splice_region AMT 5 81266 6.15263E-5 40633 0 1.91144E-4
3-49459531-G-C c.258+6C>G splice_region AMT 3 82126 3.65292E-5 41063 0 NA
3-49459554-C-T p.Val81Met missense AMT 2 82660 2.41955E-5 41330 0 3.18451E-5
3-49459555-G-A p.Asp80Asp synonymous AMT 1 82698 1.20922E-5 41349 0 3.98273E-6
3-49459564-C-T p.Ser77Ser synonymous AMT 4 82868 4.82695E-5 41434 0 2.90628E-4
3-49459565-G-A p.Ser77Leu missense AMT 3 82912 3.61829E-5 41456 0 3.18512E-5
3-49459577-C-T p.Arg73His missense AMT 2 83008 2.40941E-5 41504 0 7.96058E-6
3-49459578-G-A p.Arg73Cys missense AMT 3 83022 3.6135E-5 41511 0 4.14442E-5
3-49459583-T-G p.His71Pro missense AMT 2 83054 2.40807E-5 41527 0 7.95957E-6
3-49459591-C-T p.Ser68Ser synonymous AMT 2 83050 2.40819E-5 41525 0 3.3112E-5
3-49459592-G-A p.Ser68Leu missense AMT 2 83072 2.40755E-5 41536 0 3.18634E-5
3-49459597-A-G p.Thr66Thr synonymous AMT 2 83106 2.40657E-5 41553 0 7.9583E-6
3-49459600-G-A p.His65His synonymous AMT 2 83116 2.40628E-5 41558 0 2.48155E-5
3-49459601-T-C p.His65Arg missense AMT 9 83122 1.08275E-4 41561 0 9.55962E-5
3-49459605-T-C p.Ser64Gly missense AMT 1 83134 1.20288E-5 41567 0 1.65399E-5
3-49459610-C-T p.Arg62Gln missense AMT 3 83152 3.60785E-5 41576 0 3.30693E-5
3-49459620-C-G p.Val59Leu missense AMT 1 83158 1.20253E-5 41579 0 1.19351E-5
3-49459622-G-A p.Pro58Leu missense AMT 3 83150 3.60794E-5 41575 0 3.97833E-6
3-49459636-C-T p.Ala53Ala synonymous AMT 2 83154 2.40518E-5 41577 0 9.55657E-5
3-49459639-A-G p.Phe52Phe synonymous AMT 1 83156 1.20256E-5 41578 0 3.9789E-6
3-49459643-G-A p.Ala51Val missense AMT 10 83150 1.20265E-4 41575 0 3.18532E-4
3-49459646-A-C p.Val50Gly missense AMT 1 83164 1.20244E-5 41582 0 NA
3-49459646-A-G p.Val50Ala missense AMT 1 83164 1.20244E-5 41582 0 NA
3-49459647-C-G p.Val50Leu missense AMT 3 83166 3.60724E-5 41583 0 1.23877E-4
3-49459647-C-A p.Val50Leu missense AMT 1 83166 1.20241E-5 41583 0 9.91015E-5
3-49459656-C-T p.Gly47Arg missense AMT 1 83212 1.20175E-5 41606 0 4.95262E-5
3-49459657-G-A p.Gly46Gly synonymous AMT 2 83188 2.40419E-5 41594 0 NA
3-49459659-C-T p.Gly46Ser missense AMT 7 83200 8.41346E-5 41600 0 3.18471E-5
3-49459659-C-G p.Gly46Arg missense AMT 2 83200 2.40385E-5 41600 0 NA
3-49459662-G-A p.His45Tyr missense AMT 2 83212 2.4035E-5 41606 0 3.18654E-5
3-49459664-G-A p.Ala44Val missense AMT 1 83206 1.20184E-5 41603 0 NA
3-49459691-C-G n.170-1G>C splice_acceptor AMT 2 83184 2.40431E-5 41592 0 NA
3-49459694-C-T p.Arg34His missense AMT 119 83128 0.00143153 41564 2 0.00453172
3-49459695-G-A p.Arg34Cys missense AMT 1 83132 1.20291E-5 41566 0 5.03525E-4
3-49459697-A-G p.Leu33Pro missense AMT 1 83142 1.20276E-5 41571 0 NA
3-49459698-G-C p.Leu33Val missense AMT 1 83138 1.20282E-5 41569 0 NA
3-49459703-TCCTGTGGGCGGCTGGGCTTAGTGCCACCAGGGCCCTAGCCCCCAGCCGCTTCCCTCCCCCACCCTCCAAGATCAGCACCCTCTATCCCA-T p.Glu31fs frameshift AMT 1 83130 1.20294E-5 41565 0 NA
3-49459708-T-C c.91-4A>G splice_region AMT 2 83080 2.40732E-5 41540 0 NA
3-49459787-A-G c.90+7T>C splice_region AMT 2 83060 2.4079E-5 41530 0 NA
3-49459800-G-A p.Cys28Cys synonymous AMT 9 83086 1.08321E-4 41543 0 0.00152594
3-49459807-A-T p.Leu26His missense AMT 4 83098 4.81359E-5 41549 0 6.25E-4
3-49459811-G-T p.Pro25Thr missense AMT 1 83088 1.20354E-5 41544 0 8.31601E-6
3-49459813-C-T p.Arg24His missense AMT 12 83072 1.44453E-4 41536 0 6.25E-4
3-49459814-G-A p.Arg24Cys missense AMT 1 83076 1.20372E-5 41538 0 3.19387E-5
3-49459822-G-C p.Ala21Gly missense AMT 3 83058 3.61193E-5 41529 0 1.99111E-5
3-49459825-G-A p.Pro20Leu missense AMT 2 83060 2.4079E-5 41530 0 1.59497E-5
3-49459835-C-T p.Ala17Thr missense AMT 1 83002 1.20479E-5 41501 0 8.38448E-6
3-49459843-C-G p.Arg14Pro missense AMT 4 82916 4.82416E-5 41458 0 NA
3-49459843-C-A p.Arg14Leu missense AMT 1 82916 1.20604E-5 41458 0 NA
3-49459853-G-A c.-161C>T 5_prime_UTR_premature_start_codon_gain AMT 1 82844 1.20709E-5 41422 0 NA
3-49459855-C-T p.Arg10His missense AMT 3 82790 3.62363E-5 41395 0 6.37511E-5
3-49459865-CACTT-C p.Ser6fs frameshift AMT 1 82672 1.2096E-5 41336 0 NA
3-49459865-C-T p.Val7Met missense AMT 1 82672 1.2096E-5 41336 0 8.75365E-6
3-49459871-C-G n.247+1G>C splice_donor AMT 3 82562 3.63363E-5 41281 0 4.01287E-6
3-49459885-G-A c.-2C>T 5_prime_UTR_premature_start_codon_gain AMT 1 82168 1.21702E-5 41084 0 2.98638E-5
3-49459922-C-T c.-39G>A 5_prime_UTR_premature_start_codon_gain AMT 2 80524 2.48373E-5 40262 0 4.37855E-6
3-49459940-C-A c.-57G>T 5_prime_UTR_premature_start_codon_gain AMT 1 78822 1.26868E-5 39411 0 3.18431E-5
3-49459967-G-A c.-84C>T 5_prime_UTR_premature_start_codon_gain AMT 1 73348 1.36336E-5 36674 0 NA
3-49459983-G-A c.-100C>T 5_prime_UTR_premature_start_codon_gain AMT 22 67922 3.23901E-4 33961 0 0.00114694
3-49459989-A-G c.-106T>C 5_prime_UTR_premature_start_codon_gain AMT 4 65930 6.06704E-5 32965 0 5.32751E-5
3-49460006-G-A c.-123C>T 5_prime_UTR_premature_start_codon_gain AMT 3 58296 5.14615E-5 29148 0 4.13417E-5
3-49460019-A-G c.-136T>C 5_prime_UTR_premature_start_codon_gain AMT 10 53390 1.87301E-4 26695 0 1.59246E-4
3-49460037-G-C c.-154C>G 5_prime_UTR_premature_start_codon_gain AMT 1 43788 2.28373E-5 21894 0 NA
3-49460051-G-A c.-168C>T 5_prime_UTR_premature_start_codon_gain AMT 1 36660 2.72777E-5 18330 0 NA
3-49460090-G-A c.-207C>T 5_prime_UTR_premature_start_codon_gain AMT 1 25828 3.87177E-5 12914 0 NA
3-49460112-G-A c.-229C>T 5_prime_UTR_premature_start_codon_gain AMT 2 22292 8.97183E-5 11146 0 1.59783E-5
3-49460162-C-A c.-279G>T 5_prime_UTR_premature_start_codon_gain AMT 1 15834 6.31552E-5 7917 0 NA