Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
1-110158857-G-GTGCCAGGGCAGGGGCCCTTGGA c.-130_-130+1insTGCCAGGGCAGGGGCCCTTGGA splice_donor AMPD2 1 16 0.0625 8 0 NA
1-110162495-T-C c.-396T>C 5_prime_UTR_premature_start_codon_gain AMPD2 2 10136 1.97316E-4 5068 0 NA
1-110162513-T-C c.-378T>C 5_prime_UTR_premature_start_codon_gain AMPD2 1 18798 5.31971E-5 9399 0 NA
1-110162548-C-T c.-343C>T 5_prime_UTR_premature_start_codon_gain AMPD2 2732 32634 0.0837164 16317 46 0.132328
1-110162618-G-A c.-273G>A 5_prime_UTR_premature_start_codon_gain AMPD2 2 59984 3.33422E-5 29992 0 NA
1-110162663-C-T c.-228C>T 5_prime_UTR_premature_start_codon_gain AMPD2 1 67696 1.47719E-5 33848 0 NA
1-110162759-C-G c.-132C>G 5_prime_UTR_premature_start_codon_gain AMPD2 1 80956 1.23524E-5 40478 0 NA
1-110162761-G-C n.154-1G>C splice_acceptor AMPD2 7 81046 8.63707E-5 40523 0 NA
1-110162764-C-T n.156C>T splice_region AMPD2 5 81142 6.16204E-5 40571 0 NA
1-110162802-G-A c.-89G>A 5_prime_UTR_premature_start_codon_gain AMPD2 1 82032 1.21904E-5 41016 0 NA
1-110162808-C-T c.-83C>T 5_prime_UTR_premature_start_codon_gain AMPD2 2 82064 2.43712E-5 41032 0 NA
1-110162816-C-T c.-75C>T 5_prime_UTR_premature_start_codon_gain AMPD2 1 82178 1.21687E-5 41089 0 NA
1-110162820-C-T c.-71C>T 5_prime_UTR_premature_start_codon_gain AMPD2 1 82192 1.21666E-5 41096 0 NA
1-110162883-C-T c.-8C>T 5_prime_UTR_premature_start_codon_gain AMPD2 1 82510 1.21197E-5 41255 0 NA
1-110162890-C-G c.-1C>G 5_prime_UTR_premature_start_codon_gain AMPD2 2 82546 2.42289E-5 41273 0 3.97795E-6
1-110162892-T-C p.Met1? start_lost AMPD2 1 82526 1.21174E-5 41263 0 1.19344E-5
1-110163275-T-G c.-271+2T>G splice_donor AMPD2 1 70990 1.40865E-5 35495 0 NA
1-110163313-C-T c.-323C>T 5_prime_UTR_premature_start_codon_gain AMPD2 24 70678 3.39568E-4 35339 0 1.27665E-4
1-110163423-T-G c.-213T>G 5_prime_UTR_premature_start_codon_gain AMPD2 1 71842 1.39194E-5 35921 0 NA
1-110163427-C-T c.-209C>T 5_prime_UTR_premature_start_codon_gain AMPD2 7 71802 9.74903E-5 35901 0 NA
1-110163460-G-T c.-176G>T 5_prime_UTR_premature_start_codon_gain AMPD2 9 74494 1.20815E-4 37247 0 3.1957E-4
1-110163524-G-GC c.-100-6dupC splice_region AMPD2 4 75822 5.27551E-5 37911 0 6.43749E-5
1-110163524-GC-G c.-100-6delC splice_region AMPD2 4 75824 5.27537E-5 37912 0 NA
1-110163529-C-A c.-100-7C>A splice_region AMPD2 1 76316 1.31034E-5 38158 0 NA
1-110163637-T-C p.Met1? start_lost AMPD2 1 80066 1.24897E-5 40033 0 3.18959E-5
1-110163648-G-A p.Gly5Ser missense AMPD2 2 80082 2.49744E-5 40041 0 3.18776E-5
1-110163674-C-T p.Ser13Ser synonymous AMPD2 1 80296 1.24539E-5 40148 0 NA
1-110163676-G-T p.Arg14Leu missense AMPD2 1 80330 1.24486E-5 40165 0 NA
1-110163686-G-C p.Leu17Leu synonymous AMPD2 1 80330 1.24486E-5 40165 0 NA
1-110163688-A-G p.His18Arg missense AMPD2 1 80334 1.2448E-5 40167 0 NA
1-110163703-T-C p.Leu23Pro missense AMPD2 1 79758 1.25379E-5 39879 0 3.18715E-5
1-110163712-G-A p.Gly26Glu missense AMPD2 1 79734 1.25417E-5 39867 0 2.23364E-5
1-110163713-G-A p.Gly26Gly synonymous AMPD2 1 79626 1.25587E-5 39813 0 3.35488E-5
1-110163714-C-T p.Arg27Trp missense AMPD2 1 79522 1.25751E-5 39761 0 NA
1-110163725-G-T p.Gly30Gly synonymous AMPD2 1 79226 1.26221E-5 39613 0 NA
1-110163731-T-C p.Met1? start_lost AMPD2 4 78914 5.06881E-5 39457 0 3.18735E-5
1-110163737-A-G p.Gln3Arg missense AMPD2 1 78686 1.27087E-5 39343 0 NA
1-110163746-C-G p.Ala6Gly missense AMPD2 15 79236 1.89308E-4 39618 0 0.00375469
1-110163748-C-A p.Pro38His missense AMPD2 1 79504 1.2578E-5 39752 0 9.22365E-6
1-110163752-C-G p.Ser39Arg missense AMPD2 2 79548 2.51421E-5 39774 0 NA
1-110163755-G-GT p.Cys41fs frameshift AMPD2 3 79578 3.76989E-5 39789 0 2.9385E-5
1-110163762-TCA-T p.Ser43fs frameshift AMPD2 2 79688 2.50979E-5 39844 0 NA
1-110163771-C-A p.Pro46Thr missense AMPD2 1 79942 1.25091E-5 39971 0 0.00101112
1-110163773-C-T p.Pro15Leu missense AMPD2 1 79824 1.25276E-5 39912 0 NA
1-110163779-C-T p.Ser17Leu missense AMPD2 5 79740 6.27038E-5 39870 0 7.66307E-5
1-110163780-G-T p.Ala49Ser missense AMPD2 1 79650 1.25549E-5 39825 0 1.53224E-5
1-110163784-C-T p.Ala50Val missense AMPD2 1 79910 1.25141E-5 39955 0 NA
1-110163785-C-T p.Pro19Leu missense AMPD2 2 79940 2.50188E-5 39970 0 5.04541E-4
1-110163805-C-T p.Ser57Phe missense AMPD2 41 80276 5.10738E-4 40138 3 0.00403633
1-110163813-T-C p.Ser60Pro missense AMPD2 1 80296 1.24539E-5 40148 0 NA
1-110163814-C-A p.Ser60Tyr missense AMPD2 2 80316 2.49016E-5 40158 0 NA
1-110163820-C-G p.Ser62Cys missense AMPD2 3 80314 3.73534E-5 40157 0 3.18593E-5
1-110163824-C-A p.Ala32Glu missense AMPD2 25 80258 3.11495E-4 40129 0 0.00201816
1-110163825-A-G p.Lys64Glu missense AMPD2 1 80220 1.24657E-5 40110 0 NA
1-110163827-G-A p.Ser33Asn missense AMPD2 2 80212 2.49339E-5 40106 0 3.18593E-5
1-110163836-C-G p.Pro36Arg missense AMPD2 1 80168 1.24738E-5 40084 0 NA
1-110163846-T-C p.Phe71Leu missense AMPD2 1 79882 1.25185E-5 39941 0 NA
1-110163855-C-T p.Arg74Trp missense AMPD2 7 79142 8.84486E-5 39571 0 3.19557E-5
1-110163855-C-A p.Ser42Arg missense AMPD2 1 79142 1.26355E-5 39571 0 4.11777E-6
1-110163859-C-A p.Ala75Asp missense AMPD2 1 79082 1.26451E-5 39541 0 NA
1-110163863-C-G p.Ser76Arg missense AMPD2 2 78782 2.53865E-5 39391 0 NA
1-110163863-C-T p.Ala45Val missense AMPD2 1 78782 1.26933E-5 39391 0 3.18674E-5
1-110163869-G-A p.Arg47Lys missense AMPD2 3 78348 3.82907E-5 39174 0 3.18634E-5
1-110163874-C-T p.Ser80Phe missense AMPD2 1 77830 1.28485E-5 38915 0 1.59286E-4
1-110163879-G-A p.Ala82Thr missense AMPD2 6854 76262 0.0898744 38131 358 0.137374
1-110163882-G-A p.Ala83Thr missense AMPD2 2 76850 2.60247E-5 38425 0 1.02478E-5
1-110163897-G-A p.Val3Met missense AMPD2 1 74542 1.34153E-5 37271 0 1.08526E-5
1-110163904-C-T p.Pro5Leu missense AMPD2 1 73122 1.36758E-5 36561 0 NA
1-110163914-G-C p.Arg8Ser missense AMPD2 1 70306 1.42235E-5 35153 0 1.21518E-5
1-110163939-A-G p.Thr17Ala missense AMPD2 2 60836 3.28753E-5 30418 0 9.14495E-6
1-110163945-C-T p.Arg19Cys missense AMPD2 4 58628 6.82268E-5 29314 0 2.35793E-5
1-110163953-G-T p.Arg21Ser missense AMPD2 2 55144 3.62687E-5 27572 0 8.23859E-5
1-110163953-G-A p.Arg21Arg synonymous AMPD2 1 55144 1.81343E-5 27572 0 NA
1-110163955-G-A p.Cys22Tyr missense AMPD2 1 53754 1.86033E-5 26877 0 1.50915E-5
1-110163962-C-T p.Ser24Ser synonymous AMPD2 1 49870 2.00521E-5 24935 0 3.19346E-5
1-110163966-C-A p.Gln26Lys missense AMPD2 170 47918 0.00354773 23959 1 0.00805936
1-110163974-G-A p.Gly28Gly synonymous AMPD2 2 43522 4.59538E-5 21761 0 3.56939E-5
1-110163999-T-A p.Trp37Arg missense AMPD2 1 35916 2.78427E-5 17958 0 NA
1-110164001-G-T p.Trp37Cys missense AMPD2 1 35618 2.80757E-5 17809 0 NA
1-110164002-T-G p.Trp38Gly missense AMPD2 1 35386 2.82598E-5 17693 0 NA
1-110164004-G-GGGCACCACCACAGAGAGGA p.Cys39fs frameshift AMPD2 1 34952 2.86107E-5 17476 0 NA
1-110164005-T-A p.Cys39Ser missense AMPD2 1 34566 2.89302E-5 17283 0 NA
1-110164007-C-G p.Cys39Trp missense AMPD2 1 34274 2.91766E-5 17137 0 7.22439E-5
1-110164015-C-T p.Thr42Ile missense AMPD2 1 32598 3.06767E-5 16299 0 7.18401E-6
1-110164016-C-T p.Thr42Thr synonymous AMPD2 1 32348 3.09138E-5 16174 0 2.1606E-5
1-110164034-CGGCTTGGAAGGTG-C p.Gly49fs frameshift AMPD2 2 25178 7.94344E-5 12589 0 9.07342E-6
1-110164039-T-G p.Leu50Trp missense AMPD2 1 22916 4.36376E-5 11458 0 1.99451E-4
1-110164041-G-A p.Glu51Lys missense AMPD2 1 23070 4.33463E-5 11535 0 NA
1-110164043-A-AG p.Gly49fs frameshift AMPD2 27 20810 0.00129745 10405 0 5.73436E-4
1-110164043-A-G p.Glu51Glu splice_region+synonymous AMPD2 2 20816 9.60799E-5 10408 0 2.50878E-4
1-110164043-A-AGGG p.Ala48_Gly49insGly disruptive_inframe_insertion AMPD2 1 20842 4.798E-5 10421 0 NA
1-110164046-T-G c.154+2T>G splice_donor AMPD2 4 20304 1.97006E-4 10152 0 0.0057185
1-110164051-T-G c.154+7T>G splice_region AMPD2 12 18292 6.56024E-4 9146 0 0.00356506
1-110164051-T-TGTGGGGGGGGGGG c.154+7_154+8insGTGGGGGGGGGGG splice_region AMPD2 1 18464 5.41594E-5 9232 0 NA
1-110164051-T-TG c.154+7_154+8insG splice_region AMPD2 1 18464 5.41594E-5 9232 0 4.28321E-5
1-110164820-G-A p.Lys43Lys synonymous AMPD2 1 9582 1.04362E-4 4791 0 9.29023E-5
1-110164853-C-T p.Pro54Pro synonymous AMPD2 3 9590 3.12826E-4 4795 0 0.00269017
1-110164860-G-T p.Val57Leu missense AMPD2 1 9582 1.04362E-4 4791 0 3.11512E-5
1-110164876-G-T p.Gly62Val missense AMPD2 9 9582 9.39261E-4 4791 0 0.00181563
1-110164879-T-A p.Val63Asp missense AMPD2 1 9580 1.04384E-4 4790 0 4.64253E-4
1-110164880-C-G p.Val63Val synonymous AMPD2 7 9580 7.30689E-4 4790 0 0.0244152
1-110164889-G-A p.Val66Val synonymous AMPD2 1 9576 1.04428E-4 4788 0 9.55779E-5
1-110164963-C-T c.-114C>T 5_prime_UTR_premature_start_codon_gain AMPD2 833 9138 0.0911578 4569 69 0.196021
1-110166458-G-T c.-355G>T 5_prime_UTR_premature_start_codon_gain AMPD2 1 16440 6.08272E-5 8220 0 NA
1-110166563-C-T c.-250C>T 5_prime_UTR_premature_start_codon_gain AMPD2 2 24158 8.27883E-5 12079 0 NA
1-110166564-G-A c.-249G>A 5_prime_UTR_premature_start_codon_gain AMPD2 1 24158 4.13942E-5 12079 0 NA
1-110166690-C-T c.-123C>T 5_prime_UTR_premature_start_codon_gain AMPD2 1 24276 4.11929E-5 12138 0 3.18674E-5
1-110167933-GGT-G p.Gly89fs frameshift AMPD2 2 77808 2.57043E-5 38904 0 4.07661E-6
1-110167948-C-T p.Pro93Ser missense AMPD2 1 78040 1.28139E-5 39020 0 8.47515E-6
1-110167955-T-A p.Leu95Gln missense AMPD2 1 78290 1.2773E-5 39145 0 NA
1-110167966-C-G p.Arg99Gly missense AMPD2 1 79010 1.26566E-5 39505 0 4.03096E-6
1-110167967-G-A p.Arg99Gln missense AMPD2 1 78992 1.26595E-5 39496 0 8.38448E-6
1-110167976-C-T p.Pro102Leu missense AMPD2 3 79734 3.76251E-5 39867 0 4.17725E-5
1-110167977-G-A p.Pro102Pro synonymous AMPD2 2 79714 2.50897E-5 39857 0 5.03525E-4
1-110167979-G-T p.Gly103Val missense AMPD2 1 79884 1.25182E-5 39942 0 NA
1-110167980-C-A p.Gly103Gly synonymous AMPD2 1 79892 1.25169E-5 39946 0 NA
1-110168000-A-G p.His110Arg missense AMPD2 1 81300 1.23001E-5 40650 0 8.29573E-6
1-110168006-C-T p.Pro112Leu missense AMPD2 1 81400 1.2285E-5 40700 0 3.98921E-6
1-110168007-G-A p.Pro112Pro synonymous AMPD2 1 81344 1.22935E-5 40672 0 9.58099E-5
1-110168008-C-T p.Leu113Phe missense AMPD2 4 81470 4.90978E-5 40735 0 3.19035E-5
1-110168011-G-A p.Asp114Asn missense AMPD2 2 81488 2.45435E-5 40744 0 8.28651E-6
1-110168021-C-T p.Thr117Met missense AMPD2 3 81870 3.66435E-5 40935 0 3.9834E-6
1-110168021-C-G p.Thr117Arg missense AMPD2 1 81872 1.22142E-5 40936 0 8.28102E-6
1-110168022-G-C p.Thr117Thr synonymous AMPD2 1 81906 1.22091E-5 40953 0 5.17833E-5
1-110168022-G-A p.Thr117Thr synonymous AMPD2 1 81908 1.22088E-5 40954 0 1.59333E-5
1-110168048-T-TCGCC p.Glu128fs frameshift AMPD2 1 82056 1.21868E-5 41028 0 NA
1-110168052-C-T p.Ala127Ala synonymous AMPD2 1 82080 1.21832E-5 41040 0 1.59591E-4
1-110168052-C-G p.Ala127Ala synonymous AMPD2 1 82080 1.21832E-5 41040 0 NA
1-110168053-G-A p.Glu128Lys missense+splice_region AMPD2 1 82102 1.218E-5 41051 0 3.19305E-5
1-110168238-C-T c.-19C>T 5_prime_UTR_premature_start_codon_gain AMPD2 2 82360 2.42836E-5 41180 0 3.62328E-5
1-110168259-G-A p.Met1? start_lost AMPD2 1 82594 1.21074E-5 41297 0 NA
1-110168262-G-C p.Leu2Leu synonymous AMPD2 4 82636 4.84051E-5 41318 0 3.18735E-5
1-110168275-TC-T p.Gln9fs frameshift AMPD2 3 82650 3.62976E-5 41325 0 2.49058E-5
1-110168280-C-T c.385-4C>T splice_region AMPD2 260 82686 0.00314443 41343 4 0.00735809
1-110168280-C-G c.385-4C>G splice_region AMPD2 2 82696 2.4185E-5 41348 0 7.45626E-5
1-110168300-C-T p.Ser134Leu missense AMPD2 1 82748 1.20849E-5 41374 0 NA
1-110168305-G-A p.Ala136Thr missense AMPD2 3 82764 3.62476E-5 41382 0 3.30376E-5
1-110168310-G-C p.Glu137Asp missense AMPD2 1 82752 1.20843E-5 41376 0 8.25887E-6
1-110168313-C-T p.Ser138Ser synonymous AMPD2 5 82710 6.04522E-5 41355 0 7.95919E-6
1-110168325-T-TGCCC p.Pro144fs frameshift AMPD2 1 82802 1.2077E-5 41401 0 NA
1-110168331-G-T p.Pro144Pro synonymous AMPD2 9 82834 1.08651E-4 41417 0 4.77859E-4
1-110168343-C-T c.-319C>T 5_prime_UTR_premature_start_codon_gain AMPD2 6 82834 7.2434E-5 41417 0 9.55536E-5
1-110168349-G-C p.Glu150Asp missense AMPD2 1 82852 1.20697E-5 41426 0 8.26966E-6
1-110168358-T-C p.Ile153Ile synonymous AMPD2 2 82800 2.41546E-5 41400 0 3.18715E-5
1-110168364-G-A p.Gln155Gln synonymous AMPD2 1 82816 1.2075E-5 41408 0 3.9853E-6
1-110168377-C-A p.Arg160Arg synonymous AMPD2 3 82652 3.62968E-5 41326 0 1.66448E-5
1-110168378-G-A p.Arg160Gln missense AMPD2 2 82664 2.41943E-5 41332 0 8.33139E-6
1-110168383-C-T p.Arg162Trp missense AMPD2 1 82314 1.21486E-5 41157 0 2.50284E-5
1-110168383-C-A p.Arg162Arg synonymous AMPD2 2 82314 2.42972E-5 41157 0 NA
1-110168384-G-A p.Arg162Gln missense AMPD2 1 82328 1.21465E-5 41164 0 4.00138E-6
1-110168422-C-T c.515+8C>T splice_region AMPD2 1 81470 1.22745E-5 40735 0 6.37674E-5
1-110168792-G-C p.Asp176His missense AMPD2 1 82358 1.21421E-5 41179 0 NA
1-110168802-T-G p.Leu179Arg missense AMPD2 1 82452 1.21283E-5 41226 0 NA
1-110168805-G-A p.Arg180Gln missense AMPD2 4 82438 4.85213E-5 41219 0 NA
1-110168815-A-G p.Gln183Gln synonymous AMPD2 1 82560 1.21124E-5 41280 0 NA
1-110168835-G-A p.Ser190Asn missense AMPD2 1 82506 1.21203E-5 41253 0 NA
1-110168841-C-T p.Ser192Leu missense AMPD2 1 82490 1.21227E-5 41245 0 7.96001E-6
1-110168850-AGTGAGGAGGGCAGAGGGGCACAGGGGATGCGGAGCTGCAGCCTGCCCTTCTGCCGGCTCTAAACCCCTCCCTTGAATGCACCCCCTGCAG-A p.Gln195fs frameshift AMPD2 8 82354 9.71416E-5 41177 0 NA
1-110168853-G-A c.584+3G>A splice_region AMPD2 1 82374 1.21398E-5 41187 0 NA
1-110168933-C-G c.585-8C>G splice_region AMPD2 1 82480 1.21242E-5 41240 0 1.67043E-5
1-110168935-C-G c.585-6C>G splice_region AMPD2 1 82474 1.2125E-5 41237 0 8.35464E-6
1-110168951-G-A p.Glu199Lys missense AMPD2 1 82476 1.21247E-5 41238 0 NA
1-110168973-A-T p.Asp206Val missense AMPD2 1 82492 1.21224E-5 41246 0 1.00252E-4
1-110168975-C-T p.Arg207Trp missense AMPD2 13 82474 1.57625E-4 41237 0 1.27058E-4
1-110168975-C-G p.Arg207Gly missense AMPD2 1 82474 1.2125E-5 41237 0 8.47056E-6
1-110168976-G-A p.Arg207Gln missense AMPD2 2 82478 2.42489E-5 41239 0 NA
1-110168983-G-T p.Leu209Leu synonymous AMPD2 1 82472 1.21253E-5 41236 0 NA
1-110168984-C-T p.Arg210Trp missense AMPD2 1 82420 1.2133E-5 41210 0 1.20687E-5
1-110168986-G-A p.Arg210Arg synonymous AMPD2 1 82472 1.21253E-5 41236 0 2.00856E-5
1-110168997-T-G p.Val214Gly missense AMPD2 2 82374 2.42795E-5 41187 0 4.02049E-6
1-110168998-G-C p.Val214Val synonymous AMPD2 1 82366 1.21409E-5 41183 0 2.58763E-5
1-110169005-C-T p.Arg217Trp missense AMPD2 1 82268 1.21554E-5 41134 0 3.18898E-5
1-110169025-C-T p.Thr223Thr synonymous AMPD2 1 81802 1.22246E-5 40901 0 NA
1-110169033-GGGA-G p.Glu228del conservative_inframe_deletion AMPD2 1 81546 1.2263E-5 40773 0 NA
1-110169038-G-T p.Glu228* stop_gained AMPD2 2 81302 2.45996E-5 40651 0 9.56389E-5
1-110169050-G-T c.693+1G>T splice_donor AMPD2 1 80496 1.2423E-5 40248 0 NA
1-110169078-C-T n.580C>T splice_region AMPD2 123 77298 0.00159124 38649 0 0.00425518
1-110169079-G-A n.581G>A splice_region AMPD2 4 76850 5.20494E-5 38425 0 6.66223E-5
1-110169340-A-C c.694-8A>C splice_region AMPD2 2 82594 2.42148E-5 41297 0 1.70262E-5
1-110169352-C-T p.Pro233Leu missense AMPD2 2 82686 2.41879E-5 41343 0 1.20294E-5
1-110169353-G-A p.Pro233Pro synonymous AMPD2 6 82718 7.25356E-5 41359 0 2.23485E-4
1-110169387-G-T p.Val245Leu missense AMPD2 1 82808 1.20761E-5 41404 0 NA
1-110169390-C-T p.Arg246Trp missense AMPD2 1 82770 1.20817E-5 41385 0 7.97048E-6
1-110169394-C-A p.Ala247Glu missense AMPD2 1 82748 1.20849E-5 41374 0 NA
1-110169398-C-T p.Leu248Leu synonymous AMPD2 14 82838 1.69005E-4 41419 0 3.05639E-4
1-110169405-C-T p.Arg251Trp missense AMPD2 1 82804 1.20767E-5 41402 0 8.25791E-6
1-110169417-A-G p.Met1? start_lost AMPD2 2 82774 2.41622E-5 41387 0 3.98162E-6
1-110169418-T-C p.Met1? start_lost AMPD2 4 82758 4.83337E-5 41379 0 3.19428E-5
1-110169445-C-T p.Pro264Leu missense AMPD2 1 82468 1.21259E-5 41234 0 8.31076E-6
1-110169449-C-G p.Thr265Thr synonymous AMPD2 17 82400 2.06311E-4 41200 0 3.83264E-4
1-110169453-C-T p.Arg267Cys missense AMPD2 3 82794 3.62345E-5 41397 0 1.99183E-5
1-110169454-G-A p.Arg267His missense AMPD2 2 82796 2.41558E-5 41398 0 8.27952E-6
1-110169456-C-A p.Arg268Ser missense AMPD2 1 82838 1.20718E-5 41419 0 3.98308E-6
1-110169456-C-T p.Arg268Cys missense AMPD2 3 82838 3.62153E-5 41419 0 3.19081E-5
1-110169457-G-A p.Arg268His missense AMPD2 4 82904 4.82486E-5 41452 0 8.27486E-6
1-110169472-T-C p.Leu273Pro missense AMPD2 1 82992 1.20494E-5 41496 0 3.98102E-6
1-110169495-C-T p.Arg281Trp missense AMPD2 1 82862 1.20683E-5 41431 0 3.1904E-5
1-110169496-G-A p.Arg281Gln missense AMPD2 1 82824 1.20738E-5 41412 0 3.98552E-6
1-110169499-C-T p.Thr282Ile missense AMPD2 1 82764 1.20825E-5 41382 0 3.98667E-6
1-110169508-A-C p.Gln285Pro missense AMPD2 1 82652 1.20989E-5 41326 0 NA
1-110169510-G-A p.Gly286Ser missense AMPD2 1 82598 1.21068E-5 41299 0 3.19E-5
1-110169515-C-T p.Pro287Pro synonymous AMPD2 3 82454 3.63839E-5 41227 0 4.20911E-5
1-110169523-CT-C p.Val291fs frameshift AMPD2 1 82340 1.21448E-5 41170 0 4.01461E-6
1-110169524-T-G p.Pro290Pro synonymous AMPD2 61 82320 7.41011E-4 41160 0 0.00204095
1-110169524-T-C p.Pro290Pro synonymous AMPD2 1 82322 1.21474E-5 41161 0 8.48551E-6
1-110169525-G-T p.Val291Leu missense AMPD2 1 82286 1.21527E-5 41143 0 3.18878E-5
1-110169538-G-C c.880+4G>C splice_region AMPD2 1 81812 1.22231E-5 40906 0 NA
1-110169791-C-T c.881-6C>T splice_region AMPD2 2 81374 2.45779E-5 40687 0 NA
1-110169792-T-G c.881-5T>G splice_region AMPD2 1 81408 1.22838E-5 40704 0 NA
1-110169803-C-T p.Pro296Leu missense AMPD2 2 81456 2.45531E-5 40728 0 3.18979E-5
1-110169804-G-A p.Pro296Pro synonymous AMPD2 10 81444 1.22784E-4 40722 0 0.00626566
1-110169810-C-T p.His298His synonymous AMPD2 1 81634 1.22498E-5 40817 0 3.32265E-5
1-110169812-C-T p.Pro299Leu missense AMPD2 1 81670 1.22444E-5 40835 0 NA
1-110169813-C-T p.Pro299Pro synonymous AMPD2 1 81696 1.22405E-5 40848 0 1.65961E-5
1-110169819-G-T p.Ala301Ala synonymous AMPD2 1 81770 1.22294E-5 40885 0 2.48892E-5
1-110169819-G-A p.Ala301Ala synonymous AMPD2 2 81770 2.44588E-5 40885 0 3.18878E-5
1-110169822-G-A p.Leu302Leu synonymous AMPD2 1 81916 1.22076E-5 40958 0 NA
1-110169833-C-T p.Pro306Leu missense AMPD2 1 82082 1.21829E-5 41041 0 3.18857E-5
1-110169834-G-A p.Pro306Pro synonymous AMPD2 5 82080 6.09162E-5 41040 0 3.18918E-5
1-110169857-C-T p.Thr314Ile missense AMPD2 1 82320 1.21477E-5 41160 0 8.34321E-6
1-110169868-G-A p.Asp318Asn missense AMPD2 1 82370 1.21403E-5 41185 0 1.59408E-4
1-110169887-G-A p.Arg324His missense AMPD2 7 82430 8.49205E-5 41215 0 1.68127E-5
1-110169889-A-C p.Met325Leu missense AMPD2 1 82496 1.21218E-5 41248 0 NA
1-110169895-C-T p.Arg327Trp missense AMPD2 1 82382 1.21386E-5 41191 0 4.47879E-5
1-110169896-G-A p.Arg327Gln missense AMPD2 5 82358 6.07106E-5 41179 0 6.73514E-5
1-110169898-G-A p.Gly328Ser missense AMPD2 2 82430 2.4263E-5 41215 0 NA
1-110169902-T-C p.Val329Ala missense AMPD2 1 82474 1.2125E-5 41237 0 NA
1-110169909-C-T p.His331His synonymous AMPD2 4 82450 4.85143E-5 41225 0 7.59442E-5
1-110169917-C-T p.Thr334Ile missense AMPD2 1 82494 1.21221E-5 41247 0 1.22246E-5
1-110169919-C-T p.Arg335Cys missense AMPD2 3 82438 3.6391E-5 41219 0 2.44702E-5
1-110169920-G-A p.Arg335His missense AMPD2 2 82436 2.42612E-5 41218 0 NA
1-110169931-G-T p.Asp339Tyr missense AMPD2 1 82362 1.21415E-5 41181 0 NA
1-110169933-C-T p.Asp339Asp synonymous AMPD2 13 82330 1.57901E-4 41165 1 0.00172271
1-110169946-G-A c.1022+8G>A splice_region AMPD2 2 82214 2.43268E-5 41107 0 NA
1-110170045-T-G c.1023-6T>G splice_region AMPD2 1 82874 1.20665E-5 41437 0 NA
1-110170061-G-A p.Val345Met missense AMPD2 1 83042 1.20421E-5 41521 0 8.24198E-6
1-110170079-G-A p.Asp351Asn missense AMPD2 1 83208 1.20181E-5 41604 0 NA
1-110170102-C-T p.Asp358Asp synonymous AMPD2 11 83210 1.32196E-4 41605 0 6.25E-4
1-110170103-G-A p.Val359Ile missense AMPD2 4 83212 4.807E-5 41606 0 2.47133E-4
1-110170103-G-C p.Val359Leu missense AMPD2 3 83212 3.60525E-5 41606 0 8.23778E-6
1-110170106-A-C p.Asn360His missense AMPD2 1 83218 1.20166E-5 41609 0 NA
1-110170107-A-G p.Asn360Ser missense AMPD2 1 83220 1.20163E-5 41610 0 3.97693E-6
1-110170119-C-T p.Ala364Val missense AMPD2 1 83228 1.20152E-5 41614 0 8.23778E-6
1-110170135-C-A p.Gly369Gly synonymous AMPD2 3 83184 3.60646E-5 41592 0 NA
1-110170395-G-T c.1113-1G>T splice_acceptor AMPD2 1 82938 1.20572E-5 41469 0 NA
1-110170415-C-T p.Arg378Trp missense AMPD2 2 83054 2.40807E-5 41527 0 2.47635E-5
1-110170426-C-T p.Tyr381Tyr synonymous AMPD2 1 83152 1.20262E-5 41576 0 1.64919E-5
1-110170432-C-T p.Ser383Ser synonymous AMPD2 1 83168 1.20239E-5 41584 0 NA
1-110170450-T-C p.His389His synonymous AMPD2 9 83242 1.08118E-4 41621 0 1.27266E-4
1-110170456-A-G p.Leu391Leu synonymous AMPD2 1 83238 1.20137E-5 41619 0 3.97706E-6
1-110170490-A-C p.Lys403Gln missense AMPD2 10 83232 1.20146E-4 41616 1 0.00503525
1-110170495-G-A p.Val404Val synonymous AMPD2 1 83226 1.20155E-5 41613 0 NA
1-110170501-C-T p.His406His synonymous AMPD2 1 83232 1.20146E-5 41616 0 NA
1-110170525-G-A p.Lys414Lys splice_region+synonymous AMPD2 2 83156 2.40512E-5 41578 0 3.97877E-6
1-110170528-G-A c.1242+3G>A splice_region AMPD2 5 83136 6.01424E-5 41568 0 1.65153E-5
1-110170697-C-A c.1243-8C>A splice_region AMPD2 14 82272 1.70167E-4 41136 0 4.13881E-4
1-110170705-G-A p.Val415Met missense+splice_region AMPD2 1 82332 1.21459E-5 41166 0 NA
1-110170728-G-A p.Ser422Ser synonymous AMPD2 1559 82542 0.0188874 41271 32 0.035625
1-110170734-C-T p.Cys424Cys synonymous AMPD2 1 82706 1.2091E-5 41353 0 3.1835E-5
1-110170758-C-A p.Arg432Arg synonymous AMPD2 1 82848 1.20703E-5 41424 0 NA
1-110170770-G-A p.Arg436Arg synonymous AMPD2 6 82884 7.23903E-5 41442 0 1.48505E-4
1-110170780-C-T p.Arg440Trp missense AMPD2 2 82920 2.41196E-5 41460 0 1.64997E-5
1-110170780-C-A p.Arg440Arg synonymous AMPD2 2 82920 2.41196E-5 41460 0 NA
1-110170792-G-A p.Glu444Lys missense AMPD2 1 82982 1.20508E-5 41491 0 NA
1-110170797-C-T p.Ile445Ile synonymous AMPD2 8 82996 9.63902E-5 41498 0 4.77479E-5
1-110170800-G-A p.Val446Val synonymous AMPD2 2 83016 2.40917E-5 41508 0 NA
1-110170803-C-T p.His447His synonymous AMPD2 1 83002 1.20479E-5 41501 0 3.97915E-6
1-110170804-G-A p.Val448Met missense AMPD2 14 83008 1.68658E-4 41504 0 9.94795E-5
1-110170809-G-A p.Glu449Glu synonymous AMPD2 1 83008 1.2047E-5 41504 0 NA
1-110170812-G-A p.Gln450Gln synonymous AMPD2 1 83032 1.20435E-5 41516 0 3.97899E-6
1-110170816-C-T p.Arg452Cys missense AMPD2 24 83008 2.89129E-4 41504 0 9.55414E-5
1-110170817-G-A p.Arg452His missense AMPD2 3 83016 3.61376E-5 41508 0 6.36862E-5
1-110170821-A-G p.Glu453Glu synonymous AMPD2 1 83058 1.20398E-5 41529 0 NA
1-110170826-C-T p.Thr455Met missense AMPD2 1 83030 1.20438E-5 41515 0 1.64978E-5
1-110170827-G-T p.Thr455Thr synonymous AMPD2 1 83020 1.20453E-5 41510 0 3.98E-6
1-110170831-C-T p.Arg457Trp missense AMPD2 19 83002 2.2891E-4 41501 0 6.60022E-5
1-110170832-G-A p.Arg457Gln missense AMPD2 1 83022 1.2045E-5 41511 0 8.25123E-6
1-110170847-G-T p.Ser462Ile missense AMPD2 1 82996 1.20488E-5 41498 0 NA
1-110170859-C-T p.Thr466Met missense AMPD2 1 82968 1.20528E-5 41484 0 2.47619E-5
1-110170860-G-A p.Thr466Thr synonymous AMPD2 3 82940 3.61707E-5 41470 0 1.65071E-5
1-110170866-C-T p.Tyr468Tyr synonymous AMPD2 263 82928 0.00317143 41464 0 0.00303766
1-110170867-G-A p.Asp469Asn missense AMPD2 1 82930 1.20584E-5 41465 0 NA
1-110170896-T-C p.His478His synonymous AMPD2 57445 82310 0.69791 41155 20320 0.795065
1-110170896-TGC-CGT p.HisAla478HisVal missense+splice_region AMPD2 1 82914 1.20607E-5 41457 0 NA
1-110170898-CGGTCTGTGCCAGTGGCGTGGGCTGTGGGACTGAGTCAGTCAGGGGACCAGGAGTCACGGGTGACCTGAGCCTTCCCATGTCCCCCA-C p.Asp480fs frameshift AMPD2 8 82874 9.65321E-5 41437 0 NA
1-110170898-C-T p.Ala479Val missense+splice_region AMPD2 2 82874 2.4133E-5 41437 0 3.98883E-6
1-110170988-C-G p.Asp480Glu missense+splice_region AMPD2 1 83000 1.20482E-5 41500 0 NA
1-110171000-C-T p.Phe484Phe synonymous AMPD2 1 82952 1.20552E-5 41476 0 NA
1-110171005-G-A p.Arg486His missense AMPD2 1 82898 1.2063E-5 41449 0 NA
1-110171006-C-A p.Arg486Arg synonymous AMPD2 1 82894 1.20636E-5 41447 0 3.18573E-5
1-110171036-T-C p.Pro496Pro synonymous AMPD2 19 82610 2.29996E-4 41305 0 5.77234E-4
1-110171038-T-C p.Ile497Thr missense AMPD2 6 82590 7.2648E-5 41295 0 6.59707E-5
1-110171039-T-C p.Ile497Ile synonymous AMPD2 2 82582 2.42184E-5 41291 0 NA
1-110171042-G-A p.Gly498Gly synonymous AMPD2 1 82524 1.21177E-5 41262 0 4.9478E-5
1-110171048-C-T p.Ser500Ser synonymous AMPD2 1 82404 1.21353E-5 41202 0 1.99181E-5
1-110171055-C-T p.Arg503* stop_gained AMPD2 2 82484 2.42471E-5 41242 0 3.18451E-5
1-110171075-G-A p.Thr509Thr synonymous AMPD2 10 82444 1.21294E-4 41222 0 1.23777E-4
1-110171087-A-G p.Val513Val synonymous AMPD2 1 82504 1.21206E-5 41252 0 NA
1-110171088-T-C p.Ser514Pro missense AMPD2 1 82508 1.212E-5 41254 0 NA
1-110171093-G-A p.Gly515Gly synonymous AMPD2 2 82542 2.42301E-5 41271 0 NA
1-110171120-A-G c.1569+3A>G splice_region AMPD2 264 82666 0.00319357 41333 0 0.00414673
1-110171217-CTCTGACTCAGCTCACCTCATG-C c.1570-23_1570-3delGACTCAGCTCACCTCATGTCT splice_region AMPD2 8 82358 9.71369E-5 41179 0 1.48464E-4
1-110171272-T-C p.Met526Thr missense AMPD2 1 82896 1.20633E-5 41448 0 NA
1-110171280-C-T p.Leu529Leu synonymous AMPD2 7 82950 8.43882E-5 41475 0 3.98226E-6
1-110171282-G-C p.Leu529Leu synonymous AMPD2 1 82970 1.20525E-5 41485 0 3.18796E-5
1-110171283-G-A p.Glu530Lys missense AMPD2 1 82982 1.20508E-5 41491 0 NA
1-110171295-T-C p.Tyr534His missense AMPD2 1 83018 1.20456E-5 41509 0 7.96229E-6
1-110171328-G-A p.Gly545Arg missense AMPD2 1 83054 1.20404E-5 41527 0 NA
1-110171335-C-G p.Ser547Trp missense AMPD2 1 82980 1.20511E-5 41490 0 NA
1-110171336-G-A p.Ser547Ser synonymous AMPD2 1 82982 1.20508E-5 41491 0 7.30933E-5
1-110171359-C-A p.Ala555Glu missense AMPD2 1 82666 1.20969E-5 41333 0 NA
1-110171360-G-A p.Ala555Ala synonymous AMPD2 1 82640 1.21007E-5 41320 0 NA
1-110171361-C-T p.Arg556Cys missense AMPD2 5 82616 6.0521E-5 41308 0 0.00101112
1-110171362-G-A p.Arg556His missense AMPD2 4 82580 4.84379E-5 41290 0 4.7563E-5
1-110171369-C-T p.Ala558Ala synonymous AMPD2 1 82472 1.21253E-5 41236 0 1.64134E-5
1-110171370-G-A p.Val559Ile missense AMPD2 5 82442 6.06487E-5 41221 0 0.00202429
1-110171370-G-T p.Val559Phe missense AMPD2 1 82442 1.21297E-5 41221 0 NA
1-110171396-C-T p.Asn567Asn synonymous AMPD2 1 81654 1.22468E-5 40827 0 NA
1-110171400-C-T p.Arg569Cys missense AMPD2 1 81364 1.22904E-5 40682 0 NA
1-110171405-G-T p.Trp570Cys missense AMPD2 1 81184 1.23177E-5 40592 0 NA
1-110171421-C-T p.Arg576Cys missense AMPD2 1 80792 1.23775E-5 40396 0 5.89727E-6
1-110171422-G-A p.Arg576His missense AMPD2 1 80690 1.23931E-5 40345 0 NA
1-110171427-T-TTTGA c.1733_1733+1insTGAT splice_donor AMPD2 1 80744 1.23848E-5 40372 0 NA
1-110171746-C-A p.Thr583Thr synonymous AMPD2 72 82186 8.76062E-4 41093 0 0.00159347
1-110171751-G-A p.Gly585Asp missense AMPD2 1 82226 1.21616E-5 41113 0 1.66356E-5
1-110171752-C-A p.Gly585Gly synonymous AMPD2 1 82276 1.21542E-5 41138 0 3.18552E-5
1-110171761-C-T p.Ala588Ala synonymous AMPD2 2 82474 2.42501E-5 41237 0 NA
1-110171770-G-A p.Gln591Gln synonymous AMPD2 2 82622 2.42066E-5 41311 0 3.98346E-6
1-110171777-C-T p.Leu594Leu synonymous AMPD2 1 82646 1.20998E-5 41323 0 NA
1-110171782-G-T p.Glu595Asp missense AMPD2 1 82710 1.20904E-5 41355 0 3.9821E-6
1-110171785-C-T p.Asn596Asn synonymous AMPD2 1 82758 1.20834E-5 41379 0 3.9813E-6
1-110171790-T-C p.Phe598Ser missense AMPD2 1 82710 1.20904E-5 41355 0 0.0040282
1-110171796-C-T p.Pro600Leu missense AMPD2 1 82878 1.20659E-5 41439 0 1.65172E-5
1-110171816-C-T p.His607Tyr missense AMPD2 1 82932 1.20581E-5 41466 0 3.97893E-6
1-110171818-C-G p.His607Gln missense AMPD2 1 82930 1.20584E-5 41465 0 NA
1-110171827-C-G p.Ser610Arg missense AMPD2 1 82926 1.20589E-5 41463 0 NA
1-110171832-C-T p.Pro612Leu missense AMPD2 2 82916 2.41208E-5 41458 0 2.4737E-5
1-110171839-G-A p.Leu614Leu synonymous AMPD2 2 82986 2.41005E-5 41493 0 3.9795E-6
1-110171857-CGTGAGCAGGCAGCGCAGAGCTGGGTATGGGGAGGGCAGCCGGCTTCGCATCCAGCTGCAGCTCTGGTTCTGACCCCAGGGTTCTGTATTAG-C p.Val621_Asp622del splice_acceptor AMPD2 8 82994 9.63925E-5 41497 1 NA
1-110171860-G-A c.1860+3G>A splice_region AMPD2 2 83006 2.40946E-5 41503 0 NA
1-110171864-A-C c.1860+7A>C splice_region AMPD2 1 83042 1.20421E-5 41521 0 NA
1-110171865-G-A c.1860+8G>A splice_region AMPD2 1 83028 1.20441E-5 41514 0 NA
1-110171949-G-A p.Val621Met missense+splice_region AMPD2 1 83264 1.201E-5 41632 0 8.23913E-6
1-110171950-T-C p.Val621Ala missense+splice_region AMPD2 1 83260 1.20106E-5 41630 0 8.23927E-6
1-110171954-T-C p.Asp622Asp synonymous AMPD2 1 83278 1.2008E-5 41639 0 NA
1-110171957-T-C p.Gly623Gly synonymous AMPD2 1 83276 1.20083E-5 41638 0 NA
1-110171966-C-T p.Ser626Ser synonymous AMPD2 132 83276 0.00158509 41638 2 0.00956697
1-110171981-C-T n.555C>T splice_region AMPD2 1 83264 1.201E-5 41632 0 NA
1-110171984-G-A p.Lys632Lys synonymous AMPD2 2 83276 2.40165E-5 41638 0 1.59418E-4
1-110171987-T-C p.Pro633Pro synonymous AMPD2 1 83272 1.20088E-5 41636 0 NA
1-110171995-A-G p.His636Arg missense AMPD2 1 83274 1.20085E-5 41637 0 8.23873E-6
1-110172011-G-A p.Glu641Glu synonymous AMPD2 3 83244 3.60386E-5 41622 0 3.18918E-5
1-110172011-G-T p.Glu641Asp missense AMPD2 1 83244 1.20129E-5 41622 0 3.97659E-6
1-110172028-C-T p.Ala647Val missense AMPD2 22 83196 2.64436E-4 41598 0 1.35205E-4
1-110172029-G-A p.Ala647Ala synonymous AMPD2 8 83192 9.61631E-5 41596 0 5.96521E-5
1-110172041-G-A p.Glu651Glu synonymous AMPD2 1 83168 1.20239E-5 41584 0 NA
1-110172068-G-A p.Leu660Leu synonymous AMPD2 5 83084 6.01801E-5 41542 1 9.06424E-5
1-110172074-C-T p.Tyr662Tyr synonymous AMPD2 3 83050 3.61228E-5 41525 0 3.97861E-6
1-110172094-T-C p.Met669Thr missense AMPD2 2 82994 2.40981E-5 41497 0 6.37592E-5
1-110172096-T-C p.Leu670Leu synonymous AMPD2 7 82974 8.43638E-5 41487 0 2.30935E-4
1-110172109-G-A p.Arg674His missense AMPD2 2 82938 2.41144E-5 41469 0 0.00100705
1-110172111-A-G p.Arg675Gly missense+splice_region AMPD2 2 82940 2.41138E-5 41470 0 8.26091E-6
1-110172113-G-A c.2024+1G>A splice_donor AMPD2 1 82920 1.20598E-5 41460 0 NA
1-110172314-A-G n.865A>G splice_region AMPD2 1 79740 1.25408E-5 39870 0 NA
1-110172410-T-TC c.2025-8_2025-7insC splice_region AMPD2 2 82426 2.42642E-5 41213 0 8.78889E-6
1-110172413-C-A c.2025-5C>A splice_region AMPD2 1 82486 1.21233E-5 41243 0 NA
1-110172414-C-G c.2025-4C>G splice_region AMPD2 2 82480 2.42483E-5 41240 0 NA
1-110172423-G-T p.Arg677Met missense AMPD2 1 82576 1.21101E-5 41288 0 NA
1-110172435-C-T p.Thr681Met missense AMPD2 12 82674 1.45148E-4 41337 0 2.83117E-5
1-110172435-C-A p.Thr681Lys missense AMPD2 1 82676 1.20954E-5 41338 0 NA
1-110172440-G-C p.Val683Leu missense AMPD2 2 82690 2.41867E-5 41345 0 3.38799E-5
1-110172457-T-C p.Cys688Cys synonymous AMPD2 1 82874 1.20665E-5 41437 0 3.99473E-6
1-110172499-G-A p.Met702Ile missense AMPD2 2 83132 2.40581E-5 41566 1 NA
1-110172512-A-G p.Ile707Val missense AMPD2 1 83160 1.2025E-5 41580 0 8.40802E-6
1-110172517-C-T p.Ser708Ser synonymous AMPD2 1 83172 1.20233E-5 41586 0 NA
1-110172520-C-T p.His709His synonymous AMPD2 2 83158 2.40506E-5 41579 0 9.56572E-5
1-110172544-G-A c.2145+6G>A splice_region AMPD2 1 83062 1.20392E-5 41531 0 NA
1-110172863-C-T p.Val718Val synonymous AMPD2 35 82190 4.25843E-4 41095 0 5.8636E-4
1-110172875-G-A p.Leu722Leu synonymous AMPD2 1 82430 1.21315E-5 41215 0 8.25232E-6
1-110172884-G-A p.Leu725Leu synonymous AMPD2 1 82574 1.21103E-5 41287 0 3.29973E-5
1-110172894-G-C p.Gly729Arg missense AMPD2 1 82594 1.21074E-5 41297 0 NA
1-110172897-A-C p.Ile730Leu missense AMPD2 1 82632 1.21018E-5 41316 0 NA
1-110172945-C-T p.Arg746Trp missense AMPD2 1 82908 1.20616E-5 41454 0 NA
1-110172947-G-C p.Arg746Arg synonymous AMPD2 1 82906 1.20619E-5 41453 0 NA
1-110172952-C-G p.Pro748Arg missense AMPD2 1 82900 1.20627E-5 41450 0 8.24103E-6
1-110172953-G-A p.Pro748Pro synonymous AMPD2 1 82902 1.20624E-5 41451 0 0.0019454
1-110172960-G-C p.Glu751Gln missense AMPD2 3 82886 3.61943E-5 41443 0 NA
1-110172978-C-T p.Leu757Phe missense AMPD2 1 82812 1.20755E-5 41406 0 NA
1-110172980-C-T p.Leu757Leu synonymous AMPD2 2 82800 2.41546E-5 41400 0 2.23257E-4
1-110172985-T-G p.Val759Gly missense AMPD2 1 82748 1.20849E-5 41374 0 NA
1-110172995-C-T p.Ser762Ser synonymous AMPD2 7 82672 8.4672E-5 41336 0 2.55477E-4
1-110173043-G-A p.Gln748Gln synonymous AMPD2 2 80648 2.47991E-5 40324 0 4.00452E-6
1-110173053-CGGGCGGGCGTCCCAGGACGCTGGGGTCTCCCGGGTTGGGTGGGGGGCGGTGGGGG-C p.Gly754fs frameshift AMPD2 19 79446 2.39156E-4 39723 0 NA
1-110173057-C-T p.Ala753Val missense AMPD2 2 78846 2.53659E-5 39423 0 3.41378E-5
1-110173298-C-G c.2320-7C>G splice_region AMPD2 3 78770 3.80856E-5 39385 0 NA
1-110173299-G-A c.2320-6G>A splice_region AMPD2 1 78774 1.26945E-5 39387 0 4.19748E-6
1-110173304-G-C c.2320-1G>C splice_acceptor AMPD2 1 79422 1.2591E-5 39711 0 NA
1-110173323-T-C p.Tyr780His missense AMPD2 1 80518 1.24196E-5 40259 0 NA
1-110173331-C-T p.Ile782Ile synonymous AMPD2 4 81010 4.93766E-5 40505 0 3.19224E-5
1-110173362-G-A p.Asp793Asn missense AMPD2 2 81748 2.44654E-5 40874 1 NA
1-110173384-A-G p.Asn800Ser missense AMPD2 1 82100 1.21803E-5 41050 0 4.34245E-5
1-110173393-T-C p.Leu803Pro missense AMPD2 2 82178 2.43374E-5 41089 0 NA
1-110173395-A-T p.Met804Leu missense AMPD2 1 82168 1.21702E-5 41084 0 NA
1-110173396-T-C p.Met804Thr missense AMPD2 1 82182 1.21681E-5 41091 0 NA
1-110173400-C-A p.Ser805Arg missense AMPD2 1 82154 1.21723E-5 41077 0 4.19354E-6
1-110173414-A-G p.Lys810Arg missense+splice_region AMPD2 1 82010 1.21936E-5 41005 0 NA
1-110173418-A-AAAGAGCCACTGG c.2430+3_2430+4insAAGAGCCACTGG splice_region AMPD2 1 81998 1.21954E-5 40999 0 NA
1-110173564-G-C c.2431-1G>C splice_acceptor AMPD2 2 82908 2.41231E-5 41454 0 NA
1-110173588-C-G p.Pro818Pro synonymous AMPD2 1 83048 1.20412E-5 41524 0 NA
1-110173602-A-C p.Glu823Ala missense AMPD2 1 83140 1.20279E-5 41570 0 NA
1-110173609-T-C p.Pro825Pro synonymous AMPD2 1 83134 1.20288E-5 41567 0 3.98102E-6
1-110173629-G-A p.Arg832Gln missense AMPD2 1 83174 1.2023E-5 41587 0 NA
1-110173662-G-A p.Arg843His missense AMPD2 1 83050 1.20409E-5 41525 0 8.51252E-6
1-110173666-C-T p.Tyr844Tyr synonymous AMPD2 3 83022 3.6135E-5 41511 0 3.1841E-5
1-110173672-C-T p.Thr846Thr synonymous AMPD2 2 82970 2.41051E-5 41485 0 NA
1-110173673-C-T p.Leu847Leu synonymous AMPD2 2 82956 2.41092E-5 41478 0 NA
1-110173682-G-C p.Glu850Gln missense AMPD2 1 82922 1.20595E-5 41461 0 NA
1-110173684-G-T p.Glu850Asp missense AMPD2 3 82884 3.61952E-5 41442 0 9.14612E-6
1-110173689-C-T p.Ala852Val missense AMPD2 1 82826 1.20735E-5 41413 0 1.20336E-5
1-110173693-C-T p.Leu853Leu synonymous AMPD2 1 82820 1.20744E-5 41410 0 NA
1-110173743-C-T p.Ala870Val missense AMPD2 1 82274 1.21545E-5 41137 0 4.63968E-6
1-110173744-G-A p.Ala870Ala synonymous AMPD2 1 82236 1.21601E-5 41118 0 0.00151515
1-110173771-A-G p.Gln879Gln synonymous AMPD2 10 81796 1.22255E-4 40898 1 0.00124545
1-110173837-G-A c.*63G>A splice_region AMPD2 2 76056 2.62964E-5 38028 0 NA
1-110173838-C-T c.*64C>T splice_region AMPD2 4 75928 5.26815E-5 37964 0 3.18593E-5
1-110174189-A-G c.*415A>G splice_region AMPD2 2 7888 2.5355E-4 3944 0 NA