Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
3-49755392-T-A p.Thr503Ser missense AMIGO3 1 82828 1.20732E-5 41414 0 NA
3-49755405-G-A p.Ser498Ser synonymous AMIGO3 171 82920 0.00206223 41460 0 0.00142361
3-49755413-T-C p.Ile496Val missense AMIGO3 1 83000 1.20482E-5 41500 0 NA
3-49755423-G-A p.Ser492Ser synonymous AMIGO3 3 83018 3.61367E-5 41509 0 5.03525E-4
3-49755443-G-A p.Leu486Leu synonymous AMIGO3 1 83036 1.2043E-5 41518 0 NA
3-49755446-G-A p.Gln485* stop_gained AMIGO3 2 83030 2.40877E-5 41515 0 7.96686E-6
3-49755459-GT-G p.Asn480fs frameshift AMIGO3 1 83014 1.20462E-5 41507 0 NA
3-49755471-G-A p.Phe476Phe synonymous AMIGO3 89 83002 0.00107226 41501 4 0.01625
3-49755481-G-A p.Ala473Val missense AMIGO3 90 82950 0.00108499 41475 0 0.00125
3-49755487-GC-AA p.Ala471Leu missense AMIGO3 1 82878 1.20659E-5 41439 0 NA
3-49755492-C-G p.Gln469His missense AMIGO3 2 82834 2.41447E-5 41417 0 3.18471E-5
3-49755497-CG-C p.Val468fs frameshift AMIGO3 2 82762 2.41657E-5 41381 0 1.65675E-5
3-49755513-C-T p.Arg462Arg synonymous AMIGO3 3 82424 3.63972E-5 41212 0 3.58754E-5
3-49755535-A-C p.Val455Gly missense AMIGO3 1 82070 1.21847E-5 41035 0 9.55718E-5
3-49755544-T-C p.Lys452Arg missense AMIGO3 1 81922 1.22067E-5 40961 0 8.30372E-6
3-49755549-G-C p.Val450Val synonymous AMIGO3 1 81868 1.22148E-5 40934 0 NA
3-49755552-G-A p.Ser449Ser synonymous AMIGO3 4 81678 4.89728E-5 40839 0 8.00923E-6
3-49755557-C-T p.Ala448Thr missense AMIGO3 1 81492 1.22711E-5 40746 0 NA
3-49755558-C-G p.Lys447Asn missense AMIGO3 79 81510 9.69206E-4 40755 0 0.00125
3-49755560-T-G p.Lys447Gln missense AMIGO3 1 81458 1.22763E-5 40729 0 NA
3-49755566-T-A p.Ser445Cys missense AMIGO3 3 81306 3.68976E-5 40653 0 NA
3-49755579-C-T p.Pro440Pro synonymous AMIGO3 3 80676 3.71858E-5 40338 0 5.03525E-4
3-49755582-TGTG-T p.Thr439del disruptive_inframe_deletion AMIGO3 1 80502 1.24221E-5 40251 0 1.20723E-5
3-49755585-GGTGCTGA-G p.Leu436fs frameshift AMIGO3 2 80590 2.4817E-5 40295 0 4.02327E-6
3-49755586-G-A p.Thr438Ile missense AMIGO3 5 80602 6.20332E-5 40301 0 5.03525E-4
3-49755590-T-TGAG p.Leu436dup conservative_inframe_insertion AMIGO3 1 80640 1.24008E-5 40320 0 NA
3-49755598-G-A p.Ser434Leu missense AMIGO3 1 80634 1.24017E-5 40317 0 4.02628E-6
3-49755605-G-C p.Gln432Glu missense AMIGO3 6 80492 7.45416E-5 40246 0 5.03525E-4
3-49755621-G-C p.Leu426Leu synonymous AMIGO3 1 80424 1.24341E-5 40212 0 NA
3-49755623-G-T p.Leu426Ile missense AMIGO3 1 80384 1.24403E-5 40192 0 NA
3-49755624-C-T p.Pro425Pro synonymous AMIGO3 2 80282 2.49122E-5 40141 0 5.03525E-4
3-49755626-G-T p.Pro425Thr missense AMIGO3 1 80406 1.24369E-5 40203 0 NA
3-49755627-G-A p.Ser424Ser synonymous AMIGO3 2 80332 2.48967E-5 40166 0 8.39081E-6
3-49755630-G-A p.Pro423Pro synonymous AMIGO3 3 80484 3.72745E-5 40242 0 2.7485E-4
3-49755642-C-CCAGCGGCGG p.Cys416_Arg418dup disruptive_inframe_insertion AMIGO3 141 80238 0.00175727 40119 1 0.00420972
3-49755642-CCAGCGGCGG-C p.Cys416_Arg418del disruptive_inframe_deletion AMIGO3 20 80250 2.49221E-4 40125 1 0.00115654
3-49755642-CCAGCGGCGGCAGCGGCAGGCA-C p.Ala413_Trp419del disruptive_inframe_deletion AMIGO3 2 80252 2.49215E-5 40126 0 3.18918E-5
3-49755643-C-T p.Trp419* stop_gained AMIGO3 1 80314 1.24511E-5 40157 0 NA
3-49755644-A-AGCGGCGGCAGCGGCAGGCACG p.Arg418_Trp419insArgAlaCysArgCysArgArg conservative_inframe_insertion AMIGO3 7 80320 8.71514E-5 40160 0 1.45818E-4
3-49755647-G-A p.Arg418Cys missense AMIGO3 2 80296 2.49078E-5 40148 0 NA
3-49755647-G-T p.Arg418Ser missense AMIGO3 1 80296 1.24539E-5 40148 0 8.54935E-6
3-49755647-G-GGCGGCA p.Arg417_Arg418insCysArg conservative_inframe_insertion AMIGO3 1 80296 1.24539E-5 40148 0 NA
3-49755650-G-GGCAGCGGCAGGCACGGCGGCA p.Cys416_Arg417insCysArgArgAlaCysArgCys conservative_inframe_insertion AMIGO3 1 80232 1.24639E-5 40116 0 8.58222E-6
3-49755653-A-G p.Cys416Arg missense AMIGO3 1 79890 1.25172E-5 39945 0 5.04032E-4
3-49755656-G-A p.Arg415Cys missense AMIGO3 93 79818 0.00116515 39909 1 0.0030941
3-49755656-G-T p.Arg415Ser missense AMIGO3 2 79818 2.5057E-5 39909 0 NA
3-49755661-G-C p.Ala413Gly missense AMIGO3 2 79712 2.50903E-5 39856 0 1.63662E-5
3-49755664-C-A p.Arg412Leu missense AMIGO3 9 79184 1.13659E-4 39592 0 2.00476E-4
3-49755665-G-C p.Arg412Gly missense AMIGO3 17 79064 2.15016E-4 39532 0 5.04032E-4
3-49755667-C-T p.Arg411His missense AMIGO3 3 78970 3.79891E-5 39485 0 8.59964E-6
3-49755671-A-G p.Cys410Arg missense AMIGO3 1 78930 1.26695E-5 39465 0 3.19305E-5
3-49755673-C-T p.Cys409Tyr missense AMIGO3 1 79086 1.26445E-5 39543 0 1.71365E-5
3-49755676-C-T p.Arg408His missense AMIGO3 1 79190 1.26279E-5 39595 0 1.63156E-5
3-49755681-G-A p.Pro406Pro synonymous AMIGO3 3 79618 3.76799E-5 39809 0 8.55417E-6
3-49755689-C-T p.Ala404Thr missense AMIGO3 1 79288 1.26122E-5 39644 0 8.52515E-6
3-49755697-T-C p.Tyr401Cys missense AMIGO3 1 79980 1.25031E-5 39990 0 8.48493E-6
3-49755701-G-A p.Leu400Phe missense AMIGO3 1 80216 1.24663E-5 40108 0 3.18857E-5
3-49755710-G-A p.Leu397Phe missense AMIGO3 1 80556 1.24137E-5 40278 0 NA
3-49755713-CAA-C p.Leu395fs frameshift AMIGO3 1 80776 1.23799E-5 40388 0 NA
3-49755714-A-G p.Leu395Leu synonymous AMIGO3 1 80834 1.2371E-5 40417 0 NA
3-49755717-G-A p.Gly394Gly synonymous AMIGO3 2 80848 2.47378E-5 40424 0 NA
3-49755727-C-T p.Cys391Tyr missense AMIGO3 1 81032 1.23408E-5 40516 0 NA
3-49755732-C-T p.Leu389Leu synonymous AMIGO3 2 81130 2.46518E-5 40565 0 0.00151057
3-49755734-G-A p.Leu389Leu synonymous AMIGO3 1 81154 1.23223E-5 40577 0 8.40407E-6
3-49755735-C-A p.Leu388Leu synonymous AMIGO3 1 81140 1.23244E-5 40570 0 6.37267E-5
3-49755737-G-C p.Leu388Val missense AMIGO3 3 81234 3.69303E-5 40617 0 1.67946E-5
3-49755740-T-C p.Thr387Ala missense AMIGO3 17 81266 2.0919E-4 40633 0 1.276E-4
3-49755742-G-T p.Thr386Asn missense AMIGO3 3 81300 3.69004E-5 40650 0 1.51024E-4
3-49755764-C-T p.Glu379Lys missense AMIGO3 5 81556 6.13076E-5 40778 0 1.27453E-4
3-49755769-T-C p.Glu377Gly missense AMIGO3 7 81616 8.57675E-5 40808 0 6.37389E-5
3-49755770-C-T p.Glu377Lys missense AMIGO3 1 81690 1.22414E-5 40845 0 NA
3-49755783-G-T p.His372Gln missense AMIGO3 1 82020 1.21921E-5 41010 0 6.25E-4
3-49755784-T-C p.His372Arg missense AMIGO3 3 82020 3.65764E-5 41010 0 1.67163E-5
3-49755792-C-T p.Val369Val synonymous AMIGO3 1 82172 1.21696E-5 41086 0 3.9954E-6
3-49755799-T-C p.Tyr367Cys missense AMIGO3 4 82392 4.85484E-5 41196 0 5.84756E-5
3-49755827-G-A p.Arg358Cys missense AMIGO3 2 82578 2.42195E-5 41289 0 6.37105E-5
3-49755834-A-C p.Thr355Thr synonymous AMIGO3 1 82358 1.21421E-5 41179 0 3.18573E-5
3-49755834-A-G p.Thr355Thr synonymous AMIGO3 1 82358 1.21421E-5 41179 0 NA
3-49755841-A-C p.Leu353Arg missense AMIGO3 1 82326 1.21468E-5 41163 0 NA
3-49755845-A-C p.Cys352Gly missense AMIGO3 1 82298 1.2151E-5 41149 0 3.60161E-5
3-49755848-C-A p.Val351Leu missense AMIGO3 2 82324 2.42943E-5 41162 0 NA
3-49755851-A-AGAG p.Leu349dup conservative_inframe_insertion AMIGO3 1 82378 1.21392E-5 41189 0 4.00208E-6
3-49755856-C-G p.Gly348Ala missense AMIGO3 2 82370 2.42807E-5 41185 0 NA
3-49755872-G-A p.Gln343* stop_gained AMIGO3 1 82358 1.21421E-5 41179 0 NA
3-49755873-T-C p.Val342Val synonymous AMIGO3 3 82354 3.64281E-5 41177 0 2.51826E-4
3-49755877-T-A p.Asn341Ile missense AMIGO3 1 82366 1.21409E-5 41183 0 NA
3-49755888-C-T p.Leu337Leu synonymous AMIGO3 2 82352 2.4286E-5 41176 0 NA
3-49755895-C-T p.Gly335Asp missense AMIGO3 2 82322 2.42948E-5 41161 0 4.01265E-6
3-49755918-G-A p.Gly327Gly synonymous AMIGO3 1 82376 1.21395E-5 41188 0 3.18492E-5
3-49755919-C-T p.Gly327Asp missense AMIGO3 1 82380 1.21389E-5 41190 0 NA
3-49755923-C-G p.Asp326His missense AMIGO3 2 82354 2.42854E-5 41177 0 NA
3-49755924-G-A p.Arg325Arg synonymous AMIGO3 1 82344 1.21442E-5 41172 0 NA
3-49755940-C-G p.Arg320Thr missense AMIGO3 2 82392 2.42742E-5 41196 0 4.00237E-6
3-49755942-G-C p.Leu319Leu synonymous AMIGO3 1 82378 1.21392E-5 41189 0 NA
3-49755948-C-A p.Glu317Asp missense AMIGO3 10 82358 1.21421E-4 41179 0 5.03525E-4
3-49755964-AC-A p.Val312fs frameshift AMIGO3 1 82064 1.21856E-5 41032 0 NA
3-49755966-C-T p.Trp311* stop_gained AMIGO3 5 82064 6.09281E-5 41032 0 1.68654E-5
3-49755973-A-G p.Ile309Thr missense AMIGO3 1 81960 1.22011E-5 40980 0 2.00183E-5
3-49755984-C-T p.Pro305Pro synonymous AMIGO3 1 81596 1.22555E-5 40798 0 NA
3-49755985-G-A p.Pro305Leu missense AMIGO3 1 81576 1.22585E-5 40788 0 8.44438E-6
3-49755989-C-T p.Val304Ile missense AMIGO3 1 81404 1.22844E-5 40702 0 NA
3-49755995-T-C p.Thr302Ala missense AMIGO3 1 81346 1.22932E-5 40673 0 1.68936E-5
3-49756002-G-A p.Tyr299Tyr synonymous AMIGO3 2 81230 2.46214E-5 40615 0 3.18431E-5
3-49756013-G-A p.Leu296Leu synonymous AMIGO3 1 80902 1.23606E-5 40451 0 2.53953E-5
3-49756016-A-ACCGCG p.Ser295fs frameshift AMIGO3 1 80714 1.23894E-5 40357 0 NA
3-49756031-C-T p.Ala290Thr missense AMIGO3 1 80774 1.23802E-5 40387 0 4.02385E-6
3-49756044-T-C p.Glu285Glu synonymous AMIGO3 1 81004 1.23451E-5 40502 0 1.7055E-5
3-49756055-C-G p.Glu282Gln missense AMIGO3 1 81126 1.23265E-5 40563 0 2.56117E-5
3-49756062-A-G p.Leu279Leu synonymous AMIGO3 1 81220 1.23122E-5 40610 0 NA
3-49756063-A-C p.Leu279Arg missense AMIGO3 1 81238 1.23095E-5 40619 0 NA
3-49756066-G-A p.Ala278Val missense AMIGO3 1 81256 1.23068E-5 40628 0 NA
3-49756073-C-T p.Ala276Thr missense AMIGO3 1 81204 1.23147E-5 40602 0 NA
3-49756074-C-T p.Ser275Ser synonymous AMIGO3 2 81238 2.4619E-5 40619 0 8.04997E-6
3-49756082-A-C p.Cys273Gly missense AMIGO3 2 81512 2.45363E-5 40756 0 NA
3-49756094-C-T p.Val269Ile missense AMIGO3 2 81554 2.45236E-5 40777 0 8.55081E-6
3-49756096-C-T p.Arg268His missense AMIGO3 1 81574 1.22588E-5 40787 0 NA
3-49756118-C-T p.Val261Met missense AMIGO3 3 81616 3.67575E-5 40808 0 3.1839E-5
3-49756127-C-T p.Ala258Thr missense AMIGO3 1 81658 1.22462E-5 40829 0 2.41772E-5
3-49756128-G-T p.Pro257Pro synonymous AMIGO3 1 81680 1.22429E-5 40840 0 NA
3-49756129-G-A p.Pro257Leu missense AMIGO3 2 81680 2.44858E-5 40840 0 1.28293E-4
3-49756133-C-G p.Val256Leu missense AMIGO3 1 81720 1.22369E-5 40860 0 NA
3-49756142-C-G p.Ala253Pro missense AMIGO3 1 81822 1.22217E-5 40911 0 NA
3-49756149-T-A p.Val250Val synonymous AMIGO3 1 81938 1.22043E-5 40969 0 NA
3-49756160-G-T p.Arg247Ser missense AMIGO3 1 81868 1.22148E-5 40934 0 2.56783E-5
3-49756164-A-T p.Phe245Leu missense AMIGO3 3 81952 3.66068E-5 40976 0 4.03028E-6
3-49756175-C-T p.Val242Met missense AMIGO3 2 82094 2.43623E-5 41047 0 8.05302E-6
3-49756175-C-A p.Val242Leu missense AMIGO3 1 82094 1.21812E-5 41047 0 NA
3-49756176-G-A p.Ala241Ala synonymous AMIGO3 1 82100 1.21803E-5 41050 0 NA
3-49756178-C-T p.Ala241Thr missense AMIGO3 3 82094 3.65435E-5 41047 0 3.42003E-5
3-49756187-C-T p.Gly238Ser missense AMIGO3 1 82212 1.21637E-5 41106 0 NA
3-49756196-GC-TT p.TrpHis234* stop_gained AMIGO3 1 82240 1.21595E-5 41120 0 NA
3-49756201-C-T p.Arg233His missense AMIGO3 1 82252 1.21578E-5 41126 0 3.18451E-5
3-49756212-G-A p.His229His synonymous AMIGO3 336 82168 0.00408918 41084 1 0.00929996
3-49756213-T-C p.His229Arg missense AMIGO3 1 82114 1.21782E-5 41057 0 NA
3-49756217-A-G p.Tyr228His missense AMIGO3 1 82134 1.21752E-5 41067 0 NA
3-49756224-G-A p.Cys225Cys synonymous AMIGO3 2 82002 2.43896E-5 41001 0 3.1839E-5
3-49756227-GTCGCAAGGCAA-G p.Cys223fs frameshift AMIGO3 4 81926 4.88245E-5 40963 0 6.3678E-5
3-49756229-C-A p.Asp224Tyr missense AMIGO3 2 81888 2.44236E-5 40944 0 NA
3-49756230-G-T p.Cys223* stop_gained AMIGO3 24 81872 2.93141E-4 40936 0 0.00100806
3-49756231-C-G p.Cys223Ser missense AMIGO3 1 81896 1.22106E-5 40948 0 NA
3-49756241-GGTT-G p.Asn219del conservative_inframe_deletion AMIGO3 3 82008 3.65818E-5 41004 0 1.69308E-5
3-49756242-G-A p.Asn219Asn synonymous AMIGO3 1 82024 1.21916E-5 41012 0 NA
3-49756244-T-G p.Asn219His missense AMIGO3 1 81958 1.22014E-5 40979 0 1.69153E-5
3-49756245-G-A p.Asn218Asn synonymous AMIGO3 1 81960 1.22011E-5 40980 0 NA
3-49756248-G-A p.His217His synonymous AMIGO3 3 81950 3.66077E-5 40975 0 4.00051E-6
3-49756252-A-G p.Leu216Ser missense AMIGO3 1 81970 1.21996E-5 40985 0 NA
3-49756260-G-A p.Gly213Gly synonymous AMIGO3 1 82028 1.2191E-5 41014 0 NA
3-49756278-C-T p.Pro207Pro synonymous AMIGO3 2 82176 2.4338E-5 41088 0 0.00100705
3-49756278-C-A p.Pro207Pro synonymous AMIGO3 1 82176 1.2169E-5 41088 0 NA
3-49756293-C-G p.Glu202Asp missense AMIGO3 1 82330 1.21462E-5 41165 0 NA
3-49756302-G-C p.Ser199Ser synonymous AMIGO3 1 82404 1.21353E-5 41202 0 NA
3-49756304-A-C p.Ser199Ala missense AMIGO3 2 82410 2.42689E-5 41205 0 6.25E-4
3-49756319-G-C p.Arg194Gly missense AMIGO3 1 82548 1.21142E-5 41274 0 NA
3-49756327-G-A p.Ser191Phe missense AMIGO3 1 82606 1.21057E-5 41303 0 3.98257E-6
3-49756334-C-T p.Asp189Asn missense AMIGO3 1 82572 1.21106E-5 41286 0 NA
3-49756339-G-GTT p.Thr187fs frameshift AMIGO3 5 82576 6.05503E-5 41288 0 9.55231E-5
3-49756346-G-A p.Leu185Leu synonymous AMIGO3 2 82580 2.42189E-5 41290 0 6.3711E-5
3-49756351-G-A p.Thr183Ile missense AMIGO3 1 82552 1.21136E-5 41276 0 8.30413E-6
3-49756373-G-T p.His176Asn missense AMIGO3 4 82598 4.84273E-5 41299 0 6.63273E-5
3-49756376-C-G p.Asp175His missense AMIGO3 2 82610 2.42101E-5 41305 0 1.91217E-4
3-49756376-C-T p.Asp175Asn missense AMIGO3 1 82610 1.21051E-5 41305 0 NA
3-49756377-G-A p.Phe174Phe synonymous AMIGO3 1 82632 1.21018E-5 41316 0 1.65785E-5
3-49756378-AAGG-A p.Ser173del disruptive_inframe_deletion AMIGO3 1 82680 1.20948E-5 41340 0 7.96242E-6
3-49756414-A-C p.Leu162Arg missense AMIGO3 1 82950 1.20555E-5 41475 0 0.00125
3-49756415-G-A p.Leu162Phe missense AMIGO3 1 82964 1.20534E-5 41482 0 1.65593E-5
3-49756430-G-A p.Arg157Cys missense AMIGO3 1 82996 1.20488E-5 41498 0 0.00100705
3-49756434-G-A p.Gly155Gly synonymous AMIGO3 1 83030 1.20438E-5 41515 0 3.18471E-5
3-49756441-A-G p.Phe153Ser missense AMIGO3 2 83094 2.40691E-5 41547 0 NA
3-49756451-C-T p.Glu150Lys missense AMIGO3 4 83082 4.81452E-5 41541 0 2.38857E-5
3-49756458-G-GT p.His147fs frameshift AMIGO3 6 83116 7.21883E-5 41558 0 3.98121E-5
3-49756488-C-A p.Lys137Asn missense AMIGO3 1 83038 1.20427E-5 41519 0 NA
3-49756491-C-T p.Glu136Glu synonymous AMIGO3 2 83024 2.40894E-5 41512 0 3.98524E-6
3-49756499-C-T p.Ala134Thr missense AMIGO3 1 82930 1.20584E-5 41465 0 3.19056E-5
3-49756511-C-T p.Asp130Asn missense AMIGO3 400 82846 0.00482824 41423 3 0.00862892
3-49756519-T-C p.His127Arg missense AMIGO3 1 82800 1.20773E-5 41400 0 NA
3-49756522-C-T p.Arg126His missense AMIGO3 3 82760 3.62494E-5 41380 0 2.39728E-5
3-49756522-C-A p.Arg126Leu missense AMIGO3 1 82760 1.20831E-5 41380 0 NA
3-49756531-G-A p.Ala123Val missense AMIGO3 1 82672 1.2096E-5 41336 0 NA
3-49756533-C-T p.Arg122Arg synonymous AMIGO3 1 82738 1.20863E-5 41369 0 NA
3-49756540-G-A p.Thr120Met missense AMIGO3 2 82732 2.41744E-5 41366 0 1.19811E-5
3-49756545-AGAT-A p.Ser118del disruptive_inframe_deletion AMIGO3 3 82758 3.62503E-5 41379 0 7.98346E-6
3-49756546-G-C p.Ser118Cys missense AMIGO3 1 82746 1.20852E-5 41373 0 NA
3-49756550-A-AT p.Ser117fs frameshift AMIGO3 1 82770 1.20817E-5 41385 0 3.99116E-6
3-49756555-T-G p.Asp115Ala missense AMIGO3 1 82714 1.20899E-5 41357 0 6.37064E-5
3-49756556-C-A p.Asp115Tyr missense AMIGO3 4 82722 4.83547E-5 41361 0 1.59286E-4
3-49756564-C-T p.Arg112Lys missense AMIGO3 2 82784 2.41593E-5 41392 0 3.18451E-5
3-49756566-C-T p.Leu111Leu synonymous AMIGO3 3 82766 3.62468E-5 41383 0 6.25E-4
3-49756570-C-T p.Gly110Asp missense AMIGO3 1 82724 1.20884E-5 41362 0 5.03525E-4
3-49756577-C-T p.Ala108Thr missense AMIGO3 4 82742 4.8343E-5 41371 0 3.32823E-5
3-49756578-G-A p.Asn107Asn synonymous AMIGO3 2 82764 2.41651E-5 41382 0 3.98909E-6
3-49756584-G-C p.Phe105Leu missense AMIGO3 3 82784 3.62389E-5 41392 0 6.36862E-5
3-49756589-C-T p.Val104Ile missense AMIGO3 1 82716 1.20896E-5 41358 0 NA
3-49756590-G-T p.Gly103Gly synonymous AMIGO3 1 82702 1.20916E-5 41351 0 NA
3-49756595-G-A p.Arg102Cys missense AMIGO3 10 82688 1.20937E-4 41344 0 6.36902E-5
3-49756596-A-G p.Gly101Gly synonymous AMIGO3 4 82670 4.83851E-5 41335 0 3.99039E-6
3-49756600-A-C p.Leu100Arg missense AMIGO3 1 82718 1.20893E-5 41359 0 3.99122E-6
3-49756602-C-T p.Ala99Ala synonymous AMIGO3 3 82672 3.6288E-5 41336 0 3.991E-6
3-49756616-T-C p.Asn95Asp missense AMIGO3 1 82670 1.20963E-5 41335 0 NA
3-49756627-T-A p.His91Leu missense AMIGO3 12 82568 1.45335E-4 41284 0 6.25E-4
3-49756628-G-A p.His91Tyr missense AMIGO3 1 82570 1.21109E-5 41285 0 5.03525E-4
3-49756664-C-T p.Gly79Ser missense AMIGO3 1 82332 1.21459E-5 41166 0 NA
3-49756674-G-A p.Arg75Arg synonymous AMIGO3 16 82318 1.94368E-4 41159 0 7.56417E-5
3-49756678-T-C p.Gln74Arg missense AMIGO3 3 82368 3.64219E-5 41184 0 NA
3-49756682-G-T p.Leu73Ile missense AMIGO3 1 82306 1.21498E-5 41153 0 NA
3-49756685-C-T p.Ala72Thr missense AMIGO3 2 82286 2.43055E-5 41143 0 8.39433E-6
3-49756693-C-G p.Ser69Thr missense AMIGO3 1 82388 1.21377E-5 41194 0 8.38532E-6
3-49756700-C-G p.Asp67His missense AMIGO3 1 82340 1.21448E-5 41170 0 3.18593E-5
3-49756707-C-A p.Ala64Ala synonymous AMIGO3 1 82366 1.21409E-5 41183 0 NA
3-49756717-G-C p.Ala61Gly missense AMIGO3 1 82368 1.21406E-5 41184 0 NA
3-49756717-G-A p.Ala61Val missense AMIGO3 1 82368 1.21406E-5 41184 0 1.67822E-5
3-49756723-A-G p.Leu59Ser missense AMIGO3 2 81904 2.44188E-5 40952 0 6.25E-4
3-49756728-G-C p.Ala57Ala synonymous AMIGO3 1 81680 1.22429E-5 40840 0 NA
3-49756736-C-T p.Val55Met missense AMIGO3 4 81682 4.89704E-5 40841 0 1.20321E-5
3-49756736-C-G p.Val55Leu missense AMIGO3 1 81682 1.22426E-5 40841 0 NA
3-49756748-C-G p.Gly51Arg missense AMIGO3 2 81982 2.43956E-5 40991 0 4.00032E-6
3-49756748-C-T p.Gly51Arg missense AMIGO3 3 81982 3.65934E-5 40991 0 4.00032E-6
3-49756752-G-A p.Gly49Gly synonymous AMIGO3 1 81902 1.22097E-5 40951 0 NA
3-49756756-G-A p.Thr48Ile missense AMIGO3 2 81956 2.44033E-5 40978 0 1.25257E-4
3-49756757-T-C p.Thr48Ala missense AMIGO3 2 81938 2.44087E-5 40969 0 1.59889E-5
3-49756758-G-A p.Cys47Cys synonymous AMIGO3 5 81936 6.10232E-5 40968 0 4.17439E-5
3-49756761-G-A p.Ser46Ser synonymous AMIGO3 1 82002 1.21948E-5 41001 0 1.99786E-5
3-49756777-G-A p.Ala41Val missense AMIGO3 1 82160 1.21714E-5 41080 0 4.99817E-5
3-49756785-A-G p.Cys38Cys synonymous AMIGO3 1 82298 1.2151E-5 41149 0 0.00100705
3-49756787-A-C p.Cys38Gly missense AMIGO3 3 82318 3.6444E-5 41159 0 2.49638E-5
3-49756803-G-A p.His32His synonymous AMIGO3 2 82322 2.42948E-5 41161 0 3.98613E-6
3-49756807-A-G p.Leu31Pro missense AMIGO3 1 82288 1.21524E-5 41144 0 NA
3-49756813-C-T p.Arg29His missense AMIGO3 1 82134 1.21752E-5 41067 0 3.98791E-6
3-49756814-G-A p.Arg29Cys missense AMIGO3 8 82120 9.74184E-5 41060 1 NA
3-49756821-G-A p.Phe26Phe synonymous AMIGO3 1 81890 1.22115E-5 40945 0 8.31297E-6
3-49756826-C-T p.Gly25Ser missense AMIGO3 1 81820 1.2222E-5 40910 0 3.98762E-6
3-49756828-T-C p.Glu24Gly missense AMIGO3 1 81756 1.22315E-5 40878 0 3.98797E-6
3-49756836-C-T p.Pro21Pro synonymous AMIGO3 2 81418 2.45646E-5 40709 0 2.49567E-5
3-49756839-G-T p.Thr20Thr synonymous AMIGO3 1 81332 1.22953E-5 40666 0 3.98902E-6
3-49756840-G-A p.Thr20Ile missense AMIGO3 1 81304 1.22995E-5 40652 0 0.003125
3-49756859-G-T p.Leu14Met missense AMIGO3 1 81108 1.23292E-5 40554 0 NA
3-49756860-C-T p.Met13Ile missense AMIGO3 1 81072 1.23347E-5 40536 0 1.1985E-5
3-49756870-A-G p.Leu10Pro missense AMIGO3 1 80942 1.23545E-5 40471 0 NA
3-49756871-G-A p.Leu10Leu synonymous AMIGO3 1 80912 1.23591E-5 40456 0 NA
3-49756882-A-C p.Leu6Arg missense AMIGO3 1 80766 1.23814E-5 40383 0 NA
3-49756889-A-G p.Leu4Leu synonymous AMIGO3 1 80674 1.23956E-5 40337 0 8.51803E-6
3-49756910-C-T c.-12G>A 5_prime_UTR_premature_start_codon_gain AMIGO3 4 80292 4.98182E-5 40146 0 3.18431E-5
3-49757016-C-T c.-118G>A 5_prime_UTR_premature_start_codon_gain AMIGO3 2 72148 2.77208E-5 36074 0 6.37105E-5
3-49757017-G-A c.-119C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 16 72070 2.22006E-4 36035 0 3.18471E-4
3-49757038-G-A c.-140C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1 69418 1.44055E-5 34709 0 NA
3-49757080-C-G c.-182G>C 5_prime_UTR_premature_start_codon_gain AMIGO3 1 64848 1.54207E-5 32424 0 NA
3-49757108-T-C c.-210A>G 5_prime_UTR_premature_start_codon_gain AMIGO3 1 60928 1.64128E-5 30464 0 NA
3-49757141-T-C c.-243A>G 5_prime_UTR_premature_start_codon_gain AMIGO3 3 55294 5.42554E-5 27647 0 1.27445E-4
3-49757154-C-A c.-256G>T 5_prime_UTR_premature_start_codon_gain AMIGO3 2 52308 3.82351E-5 26154 0 NA
3-49757224-A-G c.-326T>C 5_prime_UTR_premature_start_codon_gain AMIGO3 1 44664 2.23894E-5 22332 0 NA
3-49757239-C-A c.-341G>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1 44092 2.26799E-5 22046 0 NA
3-49757279-G-A c.-381C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 2 42910 4.66092E-5 21455 0 NA
3-49757323-T-C c.-425A>G 5_prime_UTR_premature_start_codon_gain AMIGO3 2 39120 5.11247E-5 19560 0 NA
3-49757698-G-A c.-800C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 2 31780 6.29327E-5 15890 0 3.21523E-5
3-49757732-G-A c.-834C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1 44226 2.26111E-5 22113 0 NA
3-49757743-G-A c.-845C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 2 49574 4.03437E-5 24787 0 NA
3-49757764-A-C c.-866T>G 5_prime_UTR_premature_start_codon_gain AMIGO3 4 61976 6.45411E-5 30988 0 4.18787E-4
3-49757819-G-C c.-921C>G 5_prime_UTR_premature_start_codon_gain AMIGO3 1 73980 1.35172E-5 36990 0 NA
3-49757824-G-A c.-926C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 606 74226 0.00816425 37113 10 0.0149373
3-49757878-A-G c.-980T>C 5_prime_UTR_premature_start_codon_gain AMIGO3 3 79412 3.77777E-5 39706 0 6.37674E-5
3-49757882-C-A c.-984G>T 5_prime_UTR_premature_start_codon_gain AMIGO3 2 79744 2.50803E-5 39872 0 NA
3-49757887-G-C c.-989C>G 5_prime_UTR_premature_start_codon_gain AMIGO3 1 79828 1.25269E-5 39914 0 NA
3-49757895-T-C c.-997A>G 5_prime_UTR_premature_start_codon_gain AMIGO3 70 80112 8.73777E-4 40056 0 0.008125
3-49757929-C-T c.-1031G>A 5_prime_UTR_premature_start_codon_gain AMIGO3 2 81118 2.46554E-5 40559 0 1.99742E-5
3-49757941-T-C c.-1043A>G 5_prime_UTR_premature_start_codon_gain AMIGO3 1 81446 1.22781E-5 40723 0 6.38447E-5
3-49758019-G-A c.-1121C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 2 82668 2.41932E-5 41334 0 8.46754E-6
3-49758063-G-A c.-1165C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 126 82220 0.00153247 41110 0 0.01125
3-49758082-G-C c.-1184C>G 5_prime_UTR_premature_start_codon_gain AMIGO3 1 81954 1.2202E-5 40977 0 NA
3-49758112-G-A c.-1214C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1 81808 1.22237E-5 40904 0 NA
3-49758237-G-A c.-1339C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 3 82912 3.61829E-5 41456 0 3.29538E-5
3-49758288-C-A c.-1390G>T 5_prime_UTR_premature_start_codon_gain AMIGO3 11 82378 1.33531E-4 41189 0 9.55962E-5
3-49758309-G-A c.-1411C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 6 82034 7.31404E-5 41017 0 5.76834E-5
3-49758313-G-A c.-1415C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 2 81946 2.44063E-5 40973 0 1.99014E-5
3-49758313-G-T c.-1415C>A 5_prime_UTR_premature_start_codon_gain AMIGO3 1 81946 1.22032E-5 40973 0 NA
3-49758336-G-C c.-1438C>G 5_prime_UTR_premature_start_codon_gain AMIGO3 1 81490 1.22714E-5 40745 0 6.37511E-5
3-49758342-G-A c.-1444C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 20 81250 2.46154E-4 40625 3 5.44088E-4
3-49758348-C-T c.-1450G>A 5_prime_UTR_premature_start_codon_gain AMIGO3 1 81182 1.2318E-5 40591 0 NA
3-49758395-G-A c.-1497C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1 80744 1.23848E-5 40372 0 NA
3-49758406-T-C c.-1508A>G 5_prime_UTR_premature_start_codon_gain AMIGO3 3 80916 3.70755E-5 40458 0 3.19122E-5
3-49758486-T-C c.-1588A>G 5_prime_UTR_premature_start_codon_gain AMIGO3 1 82640 1.21007E-5 41320 0 3.98839E-6
3-49758515-G-A c.-1617C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1 82924 1.20592E-5 41462 0 3.98321E-6
3-49758575-G-A c.-1677C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1 82980 1.20511E-5 41490 0 3.18573E-5
3-49758679-G-A c.-1781C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 5 83202 6.00947E-5 41601 0 3.18634E-5
3-49758836-C-A c.-1938G>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1 80862 1.23667E-5 40431 0 NA
3-49758966-C-A c.-2068G>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1 74778 1.33729E-5 37389 0 NA
3-49759013-G-T c.-2115C>A 5_prime_UTR_premature_start_codon_gain AMIGO3 1 74508 1.34214E-5 37254 0 3.18431E-5
3-49759016-G-A c.-2118C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1 74886 1.33536E-5 37443 0 NA
3-49759095-A-C c.-2197T>G 5_prime_UTR_premature_start_codon_gain AMIGO3 1 77346 1.29289E-5 38673 0 NA
3-49759157-G-A c.-2259C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 4 79850 5.00939E-5 39925 0 2.31668E-5
3-49759164-G-A c.-2266C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 5 80044 6.24656E-5 40022 0 3.18512E-5
3-49759188-C-T c.-2290G>A 5_prime_UTR_premature_start_codon_gain AMIGO3 4 81424 4.91256E-5 40712 0 NA
3-49759251-G-A c.-2353C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 56 82760 6.76655E-4 41380 0 0.00117857
3-49759281-G-A c.-2383C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 2 82868 2.41348E-5 41434 0 1.65289E-5
3-49759302-G-A c.-2404C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1 82858 1.20688E-5 41429 0 3.18654E-5
3-49759313-GTACCTCCAGGAGAGGATAGGCCTTGTCAGGGAGGCAGGCACACTCCCCGCCCCTCTCCCCACCCAGCCCAGCCCACAGGCT-G c.-2419+4_-2416delAGCCTGTGGGCTGGGCTGGGTGGGGAGAGGGGCGGGGAGTGTGCCTGCCTCCCTGACAAGGCCTATCCTCTCCTGGAGGTA splice_acceptor AMIGO3 7 82794 8.45472E-5 41397 0 NA
3-49759313-G-A c.-2415C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1 82796 1.20779E-5 41398 0 8.26132E-6
3-49759315-A-G c.-2417T>C splice_region AMIGO3 10 82768 1.2082E-4 41384 0 2.4784E-5
3-49759324-A-G c.-2418-8T>C splice_region AMIGO3 1 82768 1.2082E-5 41384 0 3.97848E-6
3-49759401-C-T c.-2422G>A 5_prime_UTR_premature_start_codon_gain AMIGO3 1 81702 1.22396E-5 40851 0 NA
3-49759409-C-T c.-2430G>A 5_prime_UTR_premature_start_codon_gain AMIGO3 1 81570 1.22594E-5 40785 0 NA
3-49759409-C-G c.-2430G>C 5_prime_UTR_premature_start_codon_gain AMIGO3 1 81570 1.22594E-5 40785 0 NA
3-49759412-G-A c.-2433C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 5 81606 6.127E-5 40803 0 3.89757E-4
3-49759457-G-A c.-2478C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1 81898 1.22103E-5 40949 0 9.56084E-5
3-49759463-G-A c.-2484C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1 81822 1.22217E-5 40911 0 7.98862E-6
3-49759471-C-A c.-2492G>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1 81846 1.22181E-5 40923 0 8.28885E-6
3-49759480-G-A c.-2501C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 9 81804 1.10019E-4 40902 0 6.37227E-5
3-49759490-G-A c.-2511C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 3 81942 3.66113E-5 40971 0 1.82349E-4
3-49759509-G-A c.-2530C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1 81890 1.22115E-5 40945 0 4.0068E-6
3-49759522-G-A c.-2543C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1 82188 1.21672E-5 41094 0 NA
3-49759529-G-T c.-2550C>A 5_prime_UTR_premature_start_codon_gain AMIGO3 1 82262 1.21563E-5 41131 0 NA
3-49759568-G-A c.-2589C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 3 82512 3.63583E-5 41256 0 3.18532E-5
3-49759579-TCCTGAGAGCGGTGGGAAAAATACAAGTGGGCCACTTGTCTCCCAAGACTGAGGGGGTTAATGATGGGCTGGGCAAGGGCCTCA-T c.-2602+2_-2601delTGAGGCCCTTGCCCAGCCCATCATTAACCCCCTCAGTCTTGGGAGACAAGTGGCCCACTTGTATTTTTCCCACCGCTCTCAGG splice_acceptor AMIGO3 8 82474 9.70003E-5 41237 0 NA
3-49759585-G-A c.-2601-5C>T splice_region AMIGO3 1 82504 1.21206E-5 41252 0 8.38912E-6
3-49759587-G-A c.-2601-7C>T splice_region AMIGO3 1 82506 1.21203E-5 41253 0 NA
3-49759588-C-T c.-2601-8G>A splice_region AMIGO3 3 82470 3.63769E-5 41235 1 4.05196E-6
3-49759661-C-T c.-2602+3G>A splice_region AMIGO3 1 82876 1.20662E-5 41438 0 NA
3-49759672-C-T c.-2610G>A 5_prime_UTR_premature_start_codon_gain AMIGO3 1 82898 1.2063E-5 41449 0 3.18674E-5
3-49759673-G-A c.-2611C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1 82916 1.20604E-5 41458 0 2.39372E-5
3-49759776-A-G c.-2714T>C 5_prime_UTR_premature_start_codon_gain AMIGO3 8 83102 9.62672E-5 41551 0 7.43421E-5
3-49759790-GCCTGTAGGGAGGGATGCATCAGGGGCCTCAGCCCAGCCACAGACCACCCCCACCCTGTGGCCTCCCTGCCTCA-G c.-2730+2_-2729delTGAGGCAGGGAGGCCACAGGGTGGGGGTGGTCTGTGGCTGGGCTGAGGCCCCTGATGCATCCCTCCCTACAGG splice_acceptor AMIGO3 6 83054 7.22422E-5 41527 0 NA
3-49759797-G-A c.-2729-6C>T splice_region AMIGO3 1 83052 1.20406E-5 41526 0 NA
3-49759864-C-T c.-2730+1G>A splice_donor AMIGO3 1 83112 1.2032E-5 41556 0 1.19365E-5
3-49759864-C-G c.-2730+1G>C splice_donor AMIGO3 1 83112 1.2032E-5 41556 0 3.30104E-5
3-49759884-T-C c.-2749A>G 5_prime_UTR_premature_start_codon_gain AMIGO3 5 83130 6.01468E-5 41565 0 8.24906E-5
3-49759933-G-A c.-2798C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 2 83080 2.40732E-5 41540 0 3.30475E-5
3-49759943-GCTGTGGGAGTGGGCAGCTTGTGAGCAGGGTCATGGCGGTGATGGCCTGCCCCACCCCAGCCCACCAACAGCTGTCTCCTACACAC-G c.-2809+1_-2808-1delGTGTGTAGGAGACAGCTGTTGGTGGGCTGGGGTGGGGCAGGCCATCACCGCCATGACCCTGCTCACAAGCTGCCCACTCCCACAG splice_acceptor AMIGO3 7 83070 8.42663E-5 41535 0 NA
3-49760025-A-G c.-2809+4T>C splice_region AMIGO3 1 82740 1.20861E-5 41370 0 3.98788E-6
3-49760026-C-T c.-2809+3G>A splice_region AMIGO3 1 82736 1.20866E-5 41368 0 8.28212E-6
3-49760030-T-C c.-2810A>G splice_region AMIGO3 2 82738 2.41727E-5 41369 0 3.98835E-6
3-49760074-G-A c.-2854C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 13 80108 1.62281E-4 40054 0 0.00125
3-49760112-C-A c.-2892G>T 5_prime_UTR_premature_start_codon_gain AMIGO3 2 71400 2.80112E-5 35700 0 NA
3-49760112-C-T c.-2892G>A 5_prime_UTR_premature_start_codon_gain AMIGO3 1 71400 1.40056E-5 35700 0 1.67381E-5
3-49760127-G-A c.-2907C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1 65664 1.5229E-5 32832 0 1.61633E-5
3-49760158-G-A c.-2938C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 4 58304 6.86059E-5 29152 0 5.98884E-5
3-49760188-C-CAGGA c.-2967-2_-2967-1insTCCT splice_acceptor AMIGO3 1 51886 1.9273E-5 25943 0 NA
3-49760192-A-AC c.-2967-6_-2967-5insG splice_region AMIGO3 2 51600 3.87597E-5 25800 0 NA
3-49760193-T-C c.-2967-6A>G splice_region AMIGO3 2 51522 3.88184E-5 25761 0 1.27372E-4
3-49760195-C-T c.-2967-8G>A splice_region AMIGO3 1 51160 1.95465E-5 25580 0 3.1841E-5
3-49760397-C-T c.-2968+8G>A splice_region AMIGO3 1 79184 1.26288E-5 39592 0 3.36576E-5
3-49760398-G-A c.-2968+7C>T splice_region AMIGO3 3 79502 3.77349E-5 39751 0 1.68098E-5
3-49760404-C-T c.-2968+1G>A splice_donor AMIGO3 1 80290 1.24549E-5 40145 0 3.18634E-5
3-49760476-C-T c.-3039G>A 5_prime_UTR_premature_start_codon_gain AMIGO3 4 82368 4.85625E-5 41184 0 8.28693E-6
3-49760477-G-A c.-3040C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1097 82332 0.0133241 41166 11 0.0143586
3-49760735-GCTGGAAGGAAGAGGCCCCCCCAGTCAGGTTCTACCAGGATGGGAAGTTGGGCGGGGACCGAGAATAAGGGCCAAGAGTCTGTGCCTCAC-G c.-3160+1_-3159-1delGTGAGGCACAGACTCTTGGCCCTTATTCTCGGTCCCCGCCCAACTTCCCATCCTGGTAGAACCTGACTGGGGGGGCCTCTTCCTTCCAG splice_acceptor AMIGO3 8 83226 9.61238E-5 41613 1 NA
3-49760738-GGA-TCC c.-3159-5_-3159-3delTCCinsGGA splice_region AMIGO3 1 83218 1.20166E-5 41609 0 NA
3-49760825-C-T c.-3160G>A splice_region AMIGO3 1 83210 1.20178E-5 41605 0 6.59174E-5
3-49760905-C-A c.-3240G>T splice_region AMIGO3 1 83158 1.20253E-5 41579 0 8.25273E-6
3-49760908-G-C c.-3240-3C>G splice_region AMIGO3 1 83152 1.20262E-5 41576 0 8.25341E-6
3-49760911-A-C c.-3240-6T>G splice_region AMIGO3 1 83152 1.20262E-5 41576 0 4.70491E-4
3-49761024-G-T c.-3241+7C>A splice_region AMIGO3 4 83144 4.81093E-5 41572 0 1.27364E-4
3-49761026-C-T c.-3241+5G>A splice_region AMIGO3 8 83154 9.6207E-5 41577 0 9.54988E-5
3-49761076-G-T c.-3286C>A 5_prime_UTR_premature_start_codon_gain AMIGO3 2 83142 2.40552E-5 41571 0 8.95889E-6
3-49761139-C-A c.-3349G>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1 82952 1.20552E-5 41476 0 NA
3-49761272-C-T c.-3375+1G>A splice_donor AMIGO3 6 76108 7.88353E-5 38054 0 NA
3-49761273-C-T c.-3375G>A splice_region AMIGO3 6 76002 7.89453E-5 38001 0 9.55779E-5
3-49761283-G-A c.-3385C>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1 74612 1.34027E-5 37306 0 NA
3-49761334-C-A c.-3436G>T 5_prime_UTR_premature_start_codon_gain AMIGO3 1 58328 1.71444E-5 29164 0 NA