Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
12-47470660-G-A c.*14-3C>T splice_region AMIGO2 1 16278 6.14326E-5 8139 0 9.55231E-5
12-47471205-T-A c.*12A>T splice_region AMIGO2 2 80986 2.46956E-5 40493 0 8.81197E-6
12-47471237-G-A p.Pro517Ser missense AMIGO2 1 81004 1.23451E-5 40502 0 8.34641E-6
12-47471242-TC-T p.Asp515fs frameshift AMIGO2 1 81010 1.23442E-5 40505 0 NA
12-47471257-T-C p.Asn510Ser missense AMIGO2 1 81014 1.23435E-5 40507 0 1.59239E-5
12-47471266-T-C p.Asp507Gly missense AMIGO2 1 81012 1.23439E-5 40506 0 NA
12-47471270-A-G p.Ser506Pro missense AMIGO2 13 81018 1.60458E-4 40509 0 1.59256E-4
12-47471275-G-C p.Ser504Cys missense AMIGO2 1 81006 1.23448E-5 40503 0 1.19373E-5
12-47471277-T-C p.Lys503Lys synonymous AMIGO2 2 81010 2.46883E-5 40505 0 1.27405E-4
12-47471287-G-A p.Thr500Met missense AMIGO2 2 81008 2.46889E-5 40504 0 NA
12-47471298-G-C p.Ile496Met missense AMIGO2 4 80996 4.93852E-5 40498 0 4.13285E-5
12-47471304-C-T p.Glu494Glu synonymous AMIGO2 711 80986 0.00877929 40493 15 0.0158341
12-47471306-C-T p.Glu494Lys missense AMIGO2 1 80990 1.23472E-5 40495 0 8.26255E-6
12-47471322-G-C p.Ser488Arg missense AMIGO2 1 80994 1.23466E-5 40497 0 NA
12-47471328-A-G p.Phe486Phe synonymous AMIGO2 1 81002 1.23454E-5 40501 0 1.65057E-5
12-47471341-T-C p.Lys482Arg missense AMIGO2 1 81008 1.23445E-5 40504 0 3.18451E-5
12-47471344-CCGT-C p.Asn480_Gly481delinsArg disruptive_inframe_deletion AMIGO2 1 81002 1.23454E-5 40501 0 3.1839E-5
12-47471346-G-A p.Asn480Asn synonymous AMIGO2 3 81008 3.70334E-5 40504 0 4.95033E-5
12-47471357-C-T p.Ala477Thr missense AMIGO2 1 81014 1.23435E-5 40507 0 9.55171E-5
12-47471393-T-G p.Arg465Arg synonymous AMIGO2 1678 81054 0.0207022 40527 31 0.0227374
12-47471396-T-C p.Lys464Glu missense AMIGO2 1 81074 1.23344E-5 40537 0 3.97659E-6
12-47471406-T-C p.Ala460Ala synonymous AMIGO2 23 81076 2.83684E-4 40538 0 1.74971E-4
12-47471416-T-C p.Glu457Gly missense AMIGO2 2 81090 2.4664E-5 40545 0 NA
12-47471420-C-A p.Asp456Tyr missense AMIGO2 1 81090 1.2332E-5 40545 0 8.23696E-6
12-47471423-C-T p.Ala455Thr missense AMIGO2 2 81086 2.46652E-5 40543 0 2.47105E-5
12-47471431-T-C p.Asp452Gly missense AMIGO2 2 81098 2.46615E-5 40549 0 1.98823E-5
12-47471439-G-A p.Pro449Pro synonymous AMIGO2 23599 80944 0.291547 40472 3618 0.320625
12-47471439-G-C p.Pro449Pro synonymous AMIGO2 1 81096 1.23311E-5 40548 0 NA
12-47471447-G-A p.Pro447Ser missense AMIGO2 2 81096 2.46621E-5 40548 0 NA
12-47471457-C-T p.Ser443Ser synonymous AMIGO2 1 81094 1.23314E-5 40547 0 6.25E-4
12-47471465-G-T p.His441Asn missense AMIGO2 2 81094 2.46627E-5 40547 0 3.97621E-5
12-47471466-G-A p.Ala440Ala synonymous AMIGO2 4 81094 4.93255E-5 40547 0 3.1835E-5
12-47471477-G-T p.Gln437Lys missense AMIGO2 1 81094 1.23314E-5 40547 0 3.1839E-5
12-47471483-G-A p.Leu435Leu synonymous AMIGO2 1 81092 1.23317E-5 40546 0 NA
12-47471485-A-G p.Met434Thr missense AMIGO2 2 81094 2.46627E-5 40547 0 NA
12-47471497-C-G p.Arg430Thr missense AMIGO2 1 81084 1.23329E-5 40542 0 NA
12-47471511-C-T p.Lys425Lys synonymous AMIGO2 3 81078 3.70014E-5 40539 0 3.1837E-5
12-47471518-G-A p.Pro423Leu missense AMIGO2 2 81076 2.46682E-5 40538 0 2.4719E-5
12-47471541-C-T p.Leu415Leu synonymous AMIGO2 2 81042 2.46786E-5 40521 0 3.1839E-5
12-47471547-T-A p.Val413Val synonymous AMIGO2 1 81046 1.23387E-5 40523 0 1.59101E-5
12-47471555-C-G p.Val411Leu missense AMIGO2 51 81048 6.29257E-4 40524 0 0.00241083
12-47471556-G-C p.Ile410Met missense AMIGO2 1 81048 1.23384E-5 40524 0 NA
12-47471562-G-A p.Ala408Ala synonymous AMIGO2 1 81050 1.23381E-5 40525 0 NA
12-47471567-C-T p.Val407Met missense AMIGO2 2 81054 2.46749E-5 40527 0 2.47664E-5
12-47471569-C-T p.Cys406Tyr missense AMIGO2 1 81052 1.23378E-5 40526 0 NA
12-47471576-C-G p.Ala404Pro missense AMIGO2 1 81064 1.23359E-5 40532 0 NA
12-47471609-G-A p.His393Tyr missense AMIGO2 20 81078 2.46676E-4 40539 0 4.77677E-4
12-47471613-A-G p.His391His synonymous AMIGO2 3 81080 3.70005E-5 40540 0 NA
12-47471614-T-C p.His391Arg missense AMIGO2 1 81074 1.23344E-5 40537 0 NA
12-47471616-G-A p.Ser390Ser synonymous AMIGO2 1 81076 1.23341E-5 40538 0 NA
12-47471618-A-C p.Ser390Ala missense AMIGO2 2 81074 2.46688E-5 40537 0 NA
12-47471627-C-T p.Val387Ile missense AMIGO2 17 81068 2.09701E-4 40534 0 2.47162E-5
12-47471630-T-A p.Thr386Ser missense AMIGO2 1 81068 1.23353E-5 40534 0 3.97668E-6
12-47471632-A-T p.Phe385Tyr missense AMIGO2 2 81068 2.46706E-5 40534 0 4.11909E-5
12-47471654-C-G p.Val378Leu missense AMIGO2 2 81070 2.467E-5 40535 0 2.47105E-5
12-47471667-A-G p.Asn373Asn synonymous AMIGO2 3 81074 3.70032E-5 40537 0 1.19305E-5
12-47471677-C-T p.Arg370His missense AMIGO2 9 81060 1.11029E-4 40530 0 6.36862E-5
12-47471678-G-A p.Arg370Cys missense AMIGO2 1 81060 1.23365E-5 40530 0 NA
12-47471679-T-C p.Gln369Gln synonymous AMIGO2 5 81064 6.16797E-5 40532 0 8.23655E-6
12-47471683-T-C p.Lys368Arg missense AMIGO2 1 81066 1.23356E-5 40533 0 NA
12-47471707-A-G p.Val360Ala missense AMIGO2 1 81042 1.23393E-5 40521 0 NA
12-47471722-A-G p.Phe355Ser missense AMIGO2 4 81030 4.93644E-5 40515 0 3.1839E-5
12-47471722-A-C p.Phe355Cys missense AMIGO2 1 81030 1.23411E-5 40515 0 NA
12-47471776-A-G p.Met337Thr missense AMIGO2 2 81046 2.46773E-5 40523 0 3.18471E-5
12-47471783-T-C p.Lys335Glu missense AMIGO2 1 81056 1.23371E-5 40528 0 3.9801E-6
12-47471785-T-C p.Asp334Gly missense AMIGO2 1 81068 1.23353E-5 40534 0 3.97994E-6
12-47471805-A-T p.Asp327Glu missense AMIGO2 1 81082 1.23332E-5 40541 0 3.97867E-6
12-47471812-C-T p.Gly325Asp missense AMIGO2 1 81092 1.23317E-5 40546 0 8.23669E-6
12-47471816-C-T p.Val324Met missense AMIGO2 1 81090 1.2332E-5 40545 0 1.64737E-5
12-47471820-G-A p.Ile322Ile synonymous AMIGO2 2 81090 2.4664E-5 40545 0 1.59123E-5
12-47471823-G-T p.Phe321Leu missense AMIGO2 1 81094 1.23314E-5 40547 0 NA
12-47471829-C-T p.Thr319Thr synonymous AMIGO2 1 81102 1.23302E-5 40551 0 5.76559E-5
12-47471879-C-T p.Gly303Arg missense AMIGO2 1 81102 1.23302E-5 40551 0 NA
12-47471891-C-G p.Glu299Gln missense AMIGO2 1 81104 1.23298E-5 40552 0 NA
12-47471894-G-T p.His298Asn missense AMIGO2 1 81100 1.23305E-5 40550 0 NA
12-47471904-A-C p.Leu294Leu synonymous AMIGO2 1 81080 1.23335E-5 40540 0 1.64731E-5
12-47471908-G-A p.Ala293Val missense AMIGO2 1 81078 1.23338E-5 40539 0 NA
12-47471911-C-T p.Arg292His missense AMIGO2 1 81080 1.23335E-5 40540 0 3.70645E-4
12-47471911-C-A p.Arg292Leu missense AMIGO2 1 81080 1.23335E-5 40540 0 3.97643E-6
12-47471915-A-G p.Phe291Leu missense AMIGO2 1 81078 1.23338E-5 40539 0 2.47097E-5
12-47471917-G-T p.Ser290Tyr missense AMIGO2 10 81072 1.23347E-4 40536 0 0.00100705
12-47471923-T-C p.Asn288Ser missense AMIGO2 2 81066 2.46713E-5 40533 0 3.18512E-5
12-47471932-CT-AG p.Ser285Leu missense AMIGO2 2 81060 2.46731E-5 40530 0 NA
12-47471934-G-A p.Asp284Asp synonymous AMIGO2 1 81060 1.23365E-5 40530 0 NA
12-47471947-A-C p.Met280Arg missense AMIGO2 1 81044 1.2339E-5 40522 0 3.97662E-6
12-47471954-T-C p.Ser278Gly missense AMIGO2 1 81028 1.23414E-5 40514 0 3.18127E-5
12-47471957-C-T p.Asp277Asn missense AMIGO2 34 81030 4.19598E-4 40515 1 0.00125
12-47471960-G-T p.Gln276Lys missense AMIGO2 1 81024 1.2342E-5 40512 0 NA
12-47471968-A-C p.Leu273Arg missense AMIGO2 7 81004 8.64155E-5 40502 0 4.8517E-4
12-47471972-C-T p.Val272Ile missense AMIGO2 2 80986 2.46956E-5 40493 0 NA
12-47471978-G-T p.Arg270Ser missense AMIGO2 2 80976 2.46987E-5 40488 0 1.19318E-5
12-47471980-G-A p.Ser269Leu missense AMIGO2 39 80968 4.81672E-4 40484 0 5.03525E-4
12-47471990-A-G p.Ser266Pro missense AMIGO2 5 80956 6.17619E-5 40478 0 6.3678E-5
12-47471999-A-G p.Trp263Arg missense AMIGO2 3 80968 3.70517E-5 40484 0 3.18512E-5
12-47472005-G-T p.Arg261Ser missense AMIGO2 3 80944 3.70627E-5 40472 0 8.24253E-6
12-47472052-C-G p.Arg245Pro missense AMIGO2 1 80878 1.23643E-5 40439 0 NA
12-47472053-G-C p.Arg245Gly missense AMIGO2 1 80876 1.23646E-5 40438 0 4.77688E-5
12-47472068-G-C p.Leu240Val missense AMIGO2 1 80866 1.23661E-5 40433 0 2.47549E-5
12-47472081-G-T p.Ser235Ser synonymous AMIGO2 1 80850 1.23686E-5 40425 0 NA
12-47472083-A-C p.Ser235Ala missense AMIGO2 1 80852 1.23683E-5 40426 0 8.2526E-6
12-47472093-G-A p.Val231Val synonymous AMIGO2 4 80868 4.94633E-5 40434 0 6.25E-4
12-47472094-A-G p.Val231Ala missense AMIGO2 2 80860 2.47341E-5 40430 0 NA
12-47472114-G-A p.Tyr224Tyr synonymous AMIGO2 1 80920 1.23579E-5 40460 0 1.19544E-5
12-47472137-C-T p.Gly217Arg missense AMIGO2 1 80932 1.23561E-5 40466 0 3.98422E-6
12-47472139-G-A p.Pro216Leu missense AMIGO2 5 80930 6.17818E-5 40465 0 4.13114E-5
12-47472156-G-C p.His210Gln missense AMIGO2 5 80886 6.18154E-5 40443 0 5.03525E-4
12-47472178-C-T p.Arg203Gln missense AMIGO2 2 80840 2.47402E-5 40420 0 NA
12-47472179-G-C p.Arg203Gly missense AMIGO2 2 80836 2.47415E-5 40418 0 6.37227E-5
12-47472184-T-C p.Tyr201Cys missense AMIGO2 1 80850 1.23686E-5 40425 0 8.2672E-6
12-47472214-A-G p.Leu191Pro missense AMIGO2 1 80888 1.23628E-5 40444 0 3.97988E-6
12-47472223-C-T p.Arg188Lys missense AMIGO2 1 80930 1.23564E-5 40465 0 NA
12-47472224-T-C p.Arg188Gly missense AMIGO2 1 80938 1.23551E-5 40469 0 9.55231E-5
12-47472226-C-A p.Gly187Val missense AMIGO2 1 80942 1.23545E-5 40471 0 NA
12-47472234-C-T p.Leu184Leu synonymous AMIGO2 1 80964 1.23512E-5 40482 0 NA
12-47472241-A-G p.Met182Thr missense AMIGO2 1 80970 1.23503E-5 40485 0 1.65199E-5
12-47472243-C-T p.Pro181Pro synonymous AMIGO2 3 80972 3.70498E-5 40486 0 1.65202E-5
12-47472246-A-C p.Phe180Leu missense AMIGO2 1 80986 1.23478E-5 40493 0 NA
12-47472257-G-C p.Leu177Val missense AMIGO2 2 81004 2.46901E-5 40502 0 NA
12-47472259-A-G p.Phe176Ser missense AMIGO2 2 81002 2.46907E-5 40501 0 NA
12-47472260-A-T p.Phe176Ile missense AMIGO2 1 81004 1.23451E-5 40502 0 4.12773E-5
12-47472306-C-A p.Ala160Ala synonymous AMIGO2 1 81034 1.23405E-5 40517 0 NA
12-47472318-G-C p.Leu156Leu synonymous AMIGO2 1 81044 1.2339E-5 40522 0 NA
12-47472326-A-G p.Ser154Pro missense AMIGO2 1 81036 1.23402E-5 40518 0 NA
12-47472333-A-G p.Asn151Asn synonymous AMIGO2 1 81040 1.23396E-5 40520 0 NA
12-47472351-C-T p.Val145Val synonymous AMIGO2 19 81044 2.34441E-4 40522 0 1.07366E-4
12-47472380-C-A p.Val136Leu missense AMIGO2 2 81062 2.46725E-5 40531 0 3.9763E-6
12-47472420-A-G p.Leu122Leu synonymous AMIGO2 1 81086 1.23326E-5 40543 0 3.1837E-5
12-47472434-T-G p.Asn118His missense AMIGO2 1 81094 1.23314E-5 40547 0 3.18573E-5
12-47472436-G-A p.Pro117Leu missense AMIGO2 1 81094 1.23314E-5 40547 0 NA
12-47472437-G-C p.Pro117Ala missense AMIGO2 4 81094 4.93255E-5 40547 0 NA
12-47472443-T-C p.Thr115Ala missense AMIGO2 1 81092 1.23317E-5 40546 0 NA
12-47472454-C-T p.Gly111Asp missense AMIGO2 4 81096 4.93243E-5 40548 0 8.23669E-6
12-47472482-G-A p.His102Tyr missense AMIGO2 1 81100 1.23305E-5 40550 0 NA
12-47472483-A-G p.Arg101Arg synonymous AMIGO2 3 81094 3.69941E-5 40547 0 NA
12-47472501-C-T p.Leu95Leu synonymous AMIGO2 2 81094 2.46627E-5 40547 0 6.36862E-5
12-47472525-C-A p.Trp87Cys missense AMIGO2 1 81102 1.23302E-5 40551 0 3.29468E-5
12-47472528-C-T p.Glu86Glu synonymous AMIGO2 2 81100 2.46609E-5 40550 0 8.23683E-6
12-47472531-A-G p.Ser85Ser synonymous AMIGO2 5 81096 6.16553E-5 40548 0 5.76568E-5
12-47472532-G-C p.Ser85Cys missense AMIGO2 1 81094 1.23314E-5 40547 0 NA
12-47472533-A-G p.Ser85Pro missense AMIGO2 1 81094 1.23314E-5 40547 0 3.1835E-5
12-47472539-G-A p.Leu83Leu synonymous AMIGO2 1 81092 1.23317E-5 40546 0 6.25E-4
12-47472546-A-C p.Ile80Met missense AMIGO2 1 81096 1.23311E-5 40548 0 3.97621E-6
12-47472555-A-G p.Tyr77Tyr synonymous AMIGO2 5 81092 6.16584E-5 40546 0 6.75966E-5
12-47472558-A-C p.Ser76Arg missense AMIGO2 1 81094 1.23314E-5 40547 0 NA
12-47472572-T-C p.Arg72Gly missense AMIGO2 1 81088 1.23323E-5 40544 0 NA
12-47472576-A-C p.Ile70Met missense AMIGO2 1 81084 1.23329E-5 40542 0 3.97621E-6
12-47472588-A-G p.Leu66Leu synonymous AMIGO2 1 81082 1.23332E-5 40541 0 3.9763E-6
12-47472594-C-T p.Gly64Gly synonymous AMIGO2 2 81082 2.46664E-5 40541 0 NA
12-47472597-A-G p.Pro63Pro synonymous AMIGO2 2 81082 2.46664E-5 40541 0 1.1929E-5
12-47472602-C-T p.Val62Met missense AMIGO2 1 81074 1.23344E-5 40537 0 8.2371E-6
12-47472605-T-C p.Lys61Glu missense AMIGO2 3 81074 3.70032E-5 40537 0 3.29489E-5
12-47472619-T-G p.Asn56Thr missense AMIGO2 1 81052 1.23378E-5 40526 0 NA
12-47472635-T-G p.Ile51Leu missense AMIGO2 1 81018 1.23429E-5 40509 0 8.23913E-6
12-47472642-G-C p.Ala48Ala synonymous AMIGO2 1 80986 1.23478E-5 40493 0 3.29625E-5
12-47472651-G-C p.Cys45Trp missense AMIGO2 1 80964 1.23512E-5 40482 0 NA
12-47472655-G-C p.Ala44Gly missense AMIGO2 1 80920 1.23579E-5 40460 0 NA
12-47472669-C-T p.Gly39Gly synonymous AMIGO2 17 80824 2.10334E-4 40412 0 9.55901E-5
12-47472675-G-A p.Ala37Ala synonymous AMIGO2 1 80776 1.23799E-5 40388 0 NA
12-47472683-G-C p.Pro35Ala missense AMIGO2 5 80664 6.19855E-5 40332 0 3.30142E-5
12-47472690-A-C p.Thr32Thr synonymous AMIGO2 1 80614 1.24048E-5 40307 0 NA
12-47472693-C-T p.Val31Val synonymous AMIGO2 1683 80540 0.0208964 40270 77 0.0413186
12-47472695-C-T p.Val31Met missense AMIGO2 6 80562 7.44768E-5 40281 0 3.96596E-4
12-47472701-T-C p.Ile29Val missense AMIGO2 52 80522 6.45786E-4 40261 0 3.02336E-4
12-47472704-T-C p.Met28Val missense AMIGO2 1 80476 1.24261E-5 40238 0 NA
12-47472707-G-A p.Leu27Leu synonymous AMIGO2 3 80426 3.73014E-5 40213 0 NA
12-47472718-A-G p.Leu23Pro missense AMIGO2 1 80296 1.24539E-5 40148 0 NA
12-47472722-C-G p.Glu22Gln missense AMIGO2 1 80220 1.24657E-5 40110 0 1.66489E-5
12-47472726-G-A p.Cys20Cys synonymous AMIGO2 6 80148 7.48615E-5 40074 0 7.97181E-6
12-47472728-A-C p.Cys20Gly missense AMIGO2 1 80110 1.24828E-5 40055 0 NA
12-47472731-C-T p.Gly19Ser missense AMIGO2 1 80076 1.24881E-5 40038 0 3.3456E-5
12-47472744-G-A p.Ala14Ala synonymous AMIGO2 9 79910 1.12627E-4 39955 0 4.00035E-6
12-47472751-A-G p.Leu12Pro missense AMIGO2 4 79902 5.00613E-5 39951 0 NA
12-47472752-G-A p.Leu12Phe missense AMIGO2 7 79886 8.76249E-5 39943 0 1.27453E-4
12-47472755-G-A p.Leu11Leu synonymous AMIGO2 2 79852 2.50463E-5 39926 0 NA
12-47472763-A-C p.Leu8Arg missense AMIGO2 1 79740 1.25408E-5 39870 0 NA
12-47472765-A-T p.Thr7Thr synonymous AMIGO2 1 79738 1.25411E-5 39869 0 1.73313E-5
12-47472774-A-C p.Arg4Arg synonymous AMIGO2 2 79678 2.5101E-5 39839 0 4.18932E-6
12-47472780-C-T p.Ser2Ser synonymous AMIGO2 1 79606 1.25619E-5 39803 0 3.18634E-5
12-47472843-G-A c.-58C>T 5_prime_UTR_premature_start_codon_gain AMIGO2 1 78446 1.27476E-5 39223 0 NA
12-47472846-AACCTGGCAAACAATTAATAATTCAGAGGGAGTAAAAAGCAGAAACTGACTACCACTAGTTAACCCATAAGAGCCAT-A c.-63-74_-62delATGGCTCTTATGGGTTAACTAGTGGTAGTCAGTTTCTGCTTTTTACTCCCTCTGAATTATTAATTGTTTGCCAGGT splice_acceptor AMIGO2 6 78366 7.65638E-5 39183 0 NA
12-47472848-C-CGGTG c.-63-1_-63insCACC splice_acceptor AMIGO2 1 78324 1.27675E-5 39162 0 NA
12-47472852-G-A c.-63-4C>T splice_region AMIGO2 1 78160 1.27943E-5 39080 0 NA
12-47472924-C-T c.-64+1G>A splice_donor AMIGO2 1 73740 1.35612E-5 36870 0 NA
12-47472925-C-A c.-64G>T 5_prime_UTR_premature_start_codon_gain AMIGO2 1 73414 1.36214E-5 36707 0 NA
12-47472929-C-T c.-64+1G>A splice_donor AMIGO2 3 72552 4.13497E-5 36276 0 NA
12-47472970-T-C c.-104A>G 5_prime_UTR_premature_start_codon_gain AMIGO2 1 58944 1.69653E-5 29472 0 3.18492E-5
12-47473030-TCCTGCTTATAAAAATGTACAGTCACATTCTCTCCATACAACCCACCGTCTCACCCACCATCAGAAACTCAATTTTTTCCTAAGGTGCATCCTGCGTTGTTGTTGTTGTTGTTGTTGTTTTAAACTCCCTCCAACAGACACAACTATACGCAAACGTACGCTACAAACAATTAAACGGAAATACTTAGCAACCACCCATCCAGGAAAAAACTCA-T c.-166+2_-165del splice_acceptor AMIGO2 2 25754 7.76578E-5 12877 0 NA
12-47473039-T-A c.-165-8A>T splice_region AMIGO2 1 21906 4.56496E-5 10953 0 1.27389E-4