Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
12-47470660-G-A c.*14-3C>T splice_region AMIGO2 1 16248 6.1546E-5 8124 0 9.55231E-5
12-47471205-T-A c.*12A>T splice_region AMIGO2 2 83268 2.40188E-5 41634 0 8.81197E-6
12-47471237-G-A p.Pro517Ser missense AMIGO2 3 83290 3.60187E-5 41645 0 8.34641E-6
12-47471242-TC-T p.Asp515fs frameshift AMIGO2 1 83296 1.20054E-5 41648 0 NA
12-47471257-T-C p.Asn510Ser missense AMIGO2 1 83306 1.20039E-5 41653 0 1.59239E-5
12-47471266-T-C p.Asp507Gly missense AMIGO2 1 83308 1.20036E-5 41654 0 NA
12-47471270-A-G p.Ser506Pro missense AMIGO2 13 83312 1.5604E-4 41656 0 1.59256E-4
12-47471275-G-C p.Ser504Cys missense AMIGO2 1 83300 1.20048E-5 41650 0 1.19373E-5
12-47471277-T-C p.Lys503Lys synonymous AMIGO2 2 83302 2.4009E-5 41651 0 1.27405E-4
12-47471287-G-A p.Thr500Met missense AMIGO2 2 83302 2.4009E-5 41651 0 NA
12-47471298-G-C p.Ile496Met missense AMIGO2 4 83290 4.8025E-5 41645 0 4.13285E-5
12-47471304-C-T p.Glu494Glu synonymous AMIGO2 743 83282 0.0089215 41641 15 0.0158341
12-47471306-C-T p.Glu494Lys missense AMIGO2 1 83286 1.20068E-5 41643 0 8.26255E-6
12-47471322-G-C p.Ser488Arg missense AMIGO2 1 83288 1.20065E-5 41644 0 NA
12-47471328-A-G p.Phe486Phe synonymous AMIGO2 4 83296 4.80215E-5 41648 0 1.65057E-5
12-47471341-T-C p.Lys482Arg missense AMIGO2 1 83300 1.20048E-5 41650 0 3.18451E-5
12-47471344-CCGT-C p.Asn480_Gly481delinsArg disruptive_inframe_deletion AMIGO2 1 83292 1.2006E-5 41646 0 3.1839E-5
12-47471346-G-A p.Asn480Asn synonymous AMIGO2 3 83302 3.60135E-5 41651 0 4.95033E-5
12-47471356-G-A p.Ala477Val missense AMIGO2 1 83302 1.20045E-5 41651 0 NA
12-47471357-C-T p.Ala477Thr missense AMIGO2 1 83306 1.20039E-5 41653 0 9.55171E-5
12-47471393-T-G p.Arg465Arg synonymous AMIGO2 1687 83348 0.0202404 41674 30 0.0227374
12-47471396-T-C p.Lys464Glu missense AMIGO2 1 83368 1.1995E-5 41684 0 3.97659E-6
12-47471406-T-C p.Ala460Ala synonymous AMIGO2 26 83368 3.1187E-4 41684 0 1.74971E-4
12-47471416-T-C p.Glu457Gly missense AMIGO2 2 83382 2.3986E-5 41691 0 NA
12-47471420-C-A p.Asp456Tyr missense AMIGO2 1 83382 1.1993E-5 41691 0 8.23696E-6
12-47471423-C-T p.Ala455Thr missense AMIGO2 2 83378 2.39871E-5 41689 0 2.47105E-5
12-47471431-T-C p.Asp452Gly missense AMIGO2 2 83390 2.39837E-5 41695 0 1.98823E-5
12-47471439-G-A p.Pro449Pro synonymous AMIGO2 24280 83236 0.291701 41618 3741 0.320625
12-47471439-G-C p.Pro449Pro synonymous AMIGO2 1 83390 1.19918E-5 41695 0 NA
12-47471447-G-A p.Pro447Ser missense AMIGO2 2 83392 2.39831E-5 41696 0 NA
12-47471457-C-T p.Ser443Ser synonymous AMIGO2 1 83394 1.19913E-5 41697 0 6.25E-4
12-47471465-G-T p.His441Asn missense AMIGO2 2 83394 2.39825E-5 41697 0 3.97621E-5
12-47471466-G-A p.Ala440Ala synonymous AMIGO2 4 83394 4.79651E-5 41697 0 3.1835E-5
12-47471477-G-T p.Gln437Lys missense AMIGO2 1 83394 1.19913E-5 41697 0 3.1839E-5
12-47471483-G-A p.Leu435Leu synonymous AMIGO2 1 83392 1.19916E-5 41696 0 NA
12-47471485-A-G p.Met434Thr missense AMIGO2 2 83394 2.39825E-5 41697 0 NA
12-47471497-C-G p.Arg430Thr missense AMIGO2 1 83384 1.19927E-5 41692 0 NA
12-47471499-C-T p.Lys429Lys synonymous AMIGO2 1 83384 1.19927E-5 41692 0 3.97627E-6
12-47471511-C-T p.Lys425Lys synonymous AMIGO2 3 83380 3.59799E-5 41690 0 3.1837E-5
12-47471518-G-A p.Pro423Leu missense AMIGO2 2 83374 2.39883E-5 41687 0 2.4719E-5
12-47471541-C-T p.Leu415Leu synonymous AMIGO2 2 83342 2.39975E-5 41671 0 3.1839E-5
12-47471547-T-A p.Val413Val synonymous AMIGO2 1 83344 1.19985E-5 41672 0 1.59101E-5
12-47471555-C-G p.Val411Leu missense AMIGO2 55 83346 6.599E-4 41673 0 0.00241083
12-47471556-G-C p.Ile410Met missense AMIGO2 1 83346 1.19982E-5 41673 0 NA
12-47471562-G-A p.Ala408Ala synonymous AMIGO2 1 83348 1.19979E-5 41674 0 NA
12-47471567-C-T p.Val407Met missense AMIGO2 2 83350 2.39952E-5 41675 0 2.47664E-5
12-47471569-C-T p.Cys406Tyr missense AMIGO2 1 83348 1.19979E-5 41674 0 NA
12-47471576-C-G p.Ala404Pro missense AMIGO2 1 83360 1.19962E-5 41680 0 NA
12-47471609-G-A p.His393Tyr missense AMIGO2 20 83372 2.39889E-4 41686 0 4.77677E-4
12-47471613-A-G p.His391His synonymous AMIGO2 3 83374 3.59824E-5 41687 0 NA
12-47471614-T-C p.His391Arg missense AMIGO2 1 83368 1.1995E-5 41684 0 NA
12-47471616-G-A p.Ser390Ser synonymous AMIGO2 1 83368 1.1995E-5 41684 0 NA
12-47471618-A-C p.Ser390Ala missense AMIGO2 2 83368 2.399E-5 41684 0 NA
12-47471627-C-T p.Val387Ile missense AMIGO2 17 83364 2.03925E-4 41682 0 2.47162E-5
12-47471630-T-A p.Thr386Ser missense AMIGO2 1 83366 1.19953E-5 41683 0 3.97668E-6
12-47471632-A-T p.Phe385Tyr missense AMIGO2 2 83364 2.39912E-5 41682 0 4.11909E-5
12-47471654-C-G p.Val378Leu missense AMIGO2 2 83364 2.39912E-5 41682 0 2.47105E-5
12-47471667-A-G p.Asn373Asn synonymous AMIGO2 3 83374 3.59824E-5 41687 0 1.19305E-5
12-47471677-C-T p.Arg370His missense AMIGO2 9 83356 1.07971E-4 41678 0 6.36862E-5
12-47471678-G-A p.Arg370Cys missense AMIGO2 1 83360 1.19962E-5 41680 0 NA
12-47471679-T-C p.Gln369Gln synonymous AMIGO2 5 83364 5.99779E-5 41682 0 8.23655E-6
12-47471683-T-C p.Lys368Arg missense AMIGO2 1 83368 1.1995E-5 41684 0 NA
12-47471707-A-G p.Val360Ala missense AMIGO2 1 83340 1.1999E-5 41670 0 NA
12-47471722-A-G p.Phe355Ser missense AMIGO2 3 83332 3.60006E-5 41666 0 3.1839E-5
12-47471722-A-C p.Phe355Cys missense AMIGO2 1 83332 1.20002E-5 41666 0 NA
12-47471776-A-G p.Met337Thr missense AMIGO2 2 83350 2.39952E-5 41675 0 3.18471E-5
12-47471783-T-C p.Lys335Glu missense AMIGO2 1 83358 1.19964E-5 41679 0 3.9801E-6
12-47471785-T-C p.Asp334Gly missense AMIGO2 1 83368 1.1995E-5 41684 0 3.97994E-6
12-47471805-A-T p.Asp327Glu missense AMIGO2 1 83384 1.19927E-5 41692 0 3.97867E-6
12-47471812-C-T p.Gly325Asp missense AMIGO2 1 83392 1.19916E-5 41696 0 8.23669E-6
12-47471814-CA-C p.Val324fs frameshift AMIGO2 1 83392 1.19916E-5 41696 0 NA
12-47471816-C-T p.Val324Met missense AMIGO2 2 83392 2.39831E-5 41696 0 1.64737E-5
12-47471820-G-A p.Ile322Ile synonymous AMIGO2 2 83392 2.39831E-5 41696 0 1.59123E-5
12-47471823-G-T p.Phe321Leu missense AMIGO2 1 83396 1.1991E-5 41698 0 NA
12-47471829-C-T p.Thr319Thr synonymous AMIGO2 1 83404 1.19898E-5 41702 0 5.76559E-5
12-47471879-C-T p.Gly303Arg missense AMIGO2 1 83406 1.19895E-5 41703 0 NA
12-47471891-C-G p.Glu299Gln missense AMIGO2 1 83414 1.19884E-5 41707 0 NA
12-47471894-G-T p.His298Asn missense AMIGO2 1 83410 1.1989E-5 41705 0 NA
12-47471904-A-C p.Leu294Leu synonymous AMIGO2 1 83386 1.19924E-5 41693 0 1.64731E-5
12-47471908-G-A p.Ala293Val missense AMIGO2 1 83382 1.1993E-5 41691 0 NA
12-47471911-C-T p.Arg292His missense AMIGO2 1 83384 1.19927E-5 41692 0 3.70645E-4
12-47471911-C-A p.Arg292Leu missense AMIGO2 1 83384 1.19927E-5 41692 0 3.97643E-6
12-47471915-A-G p.Phe291Leu missense AMIGO2 1 83382 1.1993E-5 41691 0 2.47097E-5
12-47471917-G-T p.Ser290Tyr missense AMIGO2 11 83374 1.31936E-4 41687 0 0.00100705
12-47471923-T-C p.Asn288Ser missense AMIGO2 2 83366 2.39906E-5 41683 0 3.18512E-5
12-47471932-CT-AG p.Ser285Leu missense AMIGO2 2 83358 2.39929E-5 41679 0 NA
12-47471934-G-A p.Asp284Asp synonymous AMIGO2 1 83360 1.19962E-5 41680 0 NA
12-47471947-A-C p.Met280Arg missense AMIGO2 1 83344 1.19985E-5 41672 0 3.97662E-6
12-47471954-T-C p.Ser278Gly missense AMIGO2 1 83326 1.20011E-5 41663 0 3.18127E-5
12-47471957-C-T p.Asp277Asn missense AMIGO2 34 83328 4.08026E-4 41664 1 0.00125
12-47471960-G-T p.Gln276Lys missense AMIGO2 1 83322 1.20016E-5 41661 0 NA
12-47471968-A-C p.Leu273Arg missense AMIGO2 7 83302 8.40316E-5 41651 0 4.8517E-4
12-47471972-C-T p.Val272Ile missense AMIGO2 2 83284 2.40142E-5 41642 0 NA
12-47471978-G-T p.Arg270Ser missense AMIGO2 2 83274 2.40171E-5 41637 0 1.19318E-5
12-47471980-G-A p.Ser269Leu missense AMIGO2 39 83264 4.6839E-4 41632 0 5.03525E-4
12-47471990-A-G p.Ser266Pro missense AMIGO2 5 83246 6.00629E-5 41623 0 6.3678E-5
12-47471999-A-G p.Trp263Arg missense AMIGO2 3 83254 3.60343E-5 41627 0 3.18512E-5
12-47472005-G-T p.Arg261Ser missense AMIGO2 4 83228 4.80607E-5 41614 0 8.24253E-6
12-47472029-C-T p.Asp253Asn missense AMIGO2 1 83172 1.20233E-5 41586 0 8.24375E-6
12-47472052-C-G p.Arg245Pro missense AMIGO2 1 83098 1.2034E-5 41549 0 NA
12-47472053-G-C p.Arg245Gly missense AMIGO2 1 83090 1.20351E-5 41545 0 4.77688E-5
12-47472068-G-C p.Leu240Val missense AMIGO2 1 83066 1.20386E-5 41533 0 2.47549E-5
12-47472081-G-T p.Ser235Ser synonymous AMIGO2 1 83060 1.20395E-5 41530 0 NA
12-47472083-A-C p.Ser235Ala missense AMIGO2 1 83062 1.20392E-5 41531 0 8.2526E-6
12-47472093-G-A p.Val231Val synonymous AMIGO2 5 83078 6.01844E-5 41539 0 6.25E-4
12-47472094-A-G p.Val231Ala missense AMIGO2 2 83070 2.40761E-5 41535 0 NA
12-47472114-G-A p.Tyr224Tyr synonymous AMIGO2 1 83134 1.20288E-5 41567 0 1.19544E-5
12-47472137-C-T p.Gly217Arg missense AMIGO2 1 83190 1.20207E-5 41595 0 3.98422E-6
12-47472139-G-A p.Pro216Leu missense AMIGO2 5 83184 6.01077E-5 41592 0 4.13114E-5
12-47472156-G-C p.His210Gln missense AMIGO2 6 83148 7.21605E-5 41574 0 5.03525E-4
12-47472178-C-T p.Arg203Gln missense AMIGO2 2 83118 2.40622E-5 41559 0 NA
12-47472179-G-C p.Arg203Gly missense AMIGO2 2 83110 2.40645E-5 41555 0 6.37227E-5
12-47472184-T-C p.Tyr201Cys missense AMIGO2 1 83132 1.20291E-5 41566 0 8.2672E-6
12-47472214-A-G p.Leu191Pro missense AMIGO2 1 83180 1.20221E-5 41590 0 3.97988E-6
12-47472223-C-T p.Arg188Lys missense AMIGO2 1 83232 1.20146E-5 41616 0 NA
12-47472224-T-C p.Arg188Gly missense AMIGO2 1 83240 1.20135E-5 41620 0 9.55231E-5
12-47472226-C-A p.Gly187Val missense AMIGO2 1 83244 1.20129E-5 41622 0 NA
12-47472234-C-T p.Leu184Leu synonymous AMIGO2 1 83266 1.20097E-5 41633 0 NA
12-47472239-C-A p.Asp183Tyr missense AMIGO2 1 83264 1.201E-5 41632 0 NA
12-47472241-A-G p.Met182Thr missense AMIGO2 1 83274 1.20085E-5 41637 0 1.65199E-5
12-47472243-C-T p.Pro181Pro synonymous AMIGO2 3 83274 3.60256E-5 41637 0 1.65202E-5
12-47472246-A-C p.Phe180Leu missense AMIGO2 1 83286 1.20068E-5 41643 0 NA
12-47472257-G-C p.Leu177Val missense AMIGO2 2 83304 2.40085E-5 41652 0 NA
12-47472259-A-G p.Phe176Ser missense AMIGO2 2 83302 2.4009E-5 41651 0 NA
12-47472260-A-T p.Phe176Ile missense AMIGO2 1 83304 1.20042E-5 41652 0 4.12773E-5
12-47472306-C-A p.Ala160Ala synonymous AMIGO2 1 83328 1.20008E-5 41664 0 NA
12-47472318-G-C p.Leu156Leu synonymous AMIGO2 1 83338 1.19993E-5 41669 0 NA
12-47472326-A-G p.Ser154Pro missense AMIGO2 1 83330 1.20005E-5 41665 0 NA
12-47472333-A-G p.Asn151Asn synonymous AMIGO2 1 83334 1.19999E-5 41667 0 NA
12-47472351-C-T p.Val145Val synonymous AMIGO2 22 83344 2.63966E-4 41672 0 1.07366E-4
12-47472380-C-A p.Val136Leu missense AMIGO2 2 83366 2.39906E-5 41683 0 3.9763E-6
12-47472420-A-G p.Leu122Leu synonymous AMIGO2 1 83394 1.19913E-5 41697 0 3.1837E-5
12-47472434-T-G p.Asn118His missense AMIGO2 1 83400 1.19904E-5 41700 0 3.18573E-5
12-47472436-G-A p.Pro117Leu missense AMIGO2 1 83400 1.19904E-5 41700 0 NA
12-47472437-G-C p.Pro117Ala missense AMIGO2 4 83400 4.79616E-5 41700 0 NA
12-47472443-T-C p.Thr115Ala missense AMIGO2 1 83398 1.19907E-5 41699 0 NA
12-47472454-C-T p.Gly111Asp missense AMIGO2 4 83400 4.79616E-5 41700 0 8.23669E-6
12-47472482-G-A p.His102Tyr missense AMIGO2 1 83408 1.19893E-5 41704 0 NA
12-47472483-A-G p.Arg101Arg synonymous AMIGO2 3 83402 3.59704E-5 41701 0 NA
12-47472485-G-A p.Arg101Cys missense AMIGO2 1 83406 1.19895E-5 41703 0 NA
12-47472501-C-T p.Leu95Leu synonymous AMIGO2 2 83392 2.39831E-5 41696 0 6.36862E-5
12-47472525-C-A p.Trp87Cys missense AMIGO2 1 83394 1.19913E-5 41697 0 3.29468E-5
12-47472528-C-T p.Glu86Glu synonymous AMIGO2 2 83396 2.3982E-5 41698 0 8.23683E-6
12-47472531-A-G p.Ser85Ser synonymous AMIGO2 6 83394 7.19476E-5 41697 0 5.76568E-5
12-47472532-G-C p.Ser85Cys missense AMIGO2 1 83394 1.19913E-5 41697 0 NA
12-47472533-A-G p.Ser85Pro missense AMIGO2 1 83394 1.19913E-5 41697 0 3.1835E-5
12-47472539-G-A p.Leu83Leu synonymous AMIGO2 1 83392 1.19916E-5 41696 0 6.25E-4
12-47472546-A-C p.Ile80Met missense AMIGO2 1 83394 1.19913E-5 41697 0 3.97621E-6
12-47472555-A-G p.Tyr77Tyr synonymous AMIGO2 5 83388 5.99607E-5 41694 0 6.75966E-5
12-47472556-T-A p.Tyr77Phe missense AMIGO2 2 83388 2.39843E-5 41694 0 3.97624E-6
12-47472558-A-C p.Ser76Arg missense AMIGO2 1 83392 1.19916E-5 41696 0 NA
12-47472572-T-C p.Arg72Gly missense AMIGO2 1 83382 1.1993E-5 41691 0 NA
12-47472576-A-C p.Ile70Met missense AMIGO2 1 83376 1.19939E-5 41688 0 3.97621E-6
12-47472588-A-G p.Leu66Leu synonymous AMIGO2 1 83370 1.19947E-5 41685 0 3.9763E-6
12-47472594-C-T p.Gly64Gly synonymous AMIGO2 2 83370 2.39894E-5 41685 0 NA
12-47472597-A-G p.Pro63Pro synonymous AMIGO2 2 83370 2.39894E-5 41685 0 1.1929E-5
12-47472602-C-T p.Val62Met missense AMIGO2 1 83362 1.19959E-5 41681 0 8.2371E-6
12-47472605-T-C p.Lys61Glu missense AMIGO2 3 83362 3.59876E-5 41681 0 3.29489E-5
12-47472619-T-G p.Asn56Thr missense AMIGO2 1 83330 1.20005E-5 41665 0 NA
12-47472635-T-G p.Ile51Leu missense AMIGO2 1 83284 1.20071E-5 41642 0 8.23913E-6
12-47472642-G-C p.Ala48Ala synonymous AMIGO2 1 83240 1.20135E-5 41620 0 3.29625E-5
12-47472651-G-C p.Cys45Trp missense AMIGO2 1 83216 1.20169E-5 41608 0 NA
12-47472655-G-C p.Ala44Gly missense AMIGO2 1 83168 1.20239E-5 41584 0 NA
12-47472661-GGGCACACCCCAGA-G p.Ser38fs frameshift AMIGO2 1 83080 1.20366E-5 41540 0 NA
12-47472669-C-T p.Gly39Gly synonymous AMIGO2 17 83048 2.04701E-4 41524 0 9.55901E-5
12-47472675-G-A p.Ala37Ala synonymous AMIGO2 1 83000 1.20482E-5 41500 0 NA
12-47472683-G-C p.Pro35Ala missense AMIGO2 5 82848 6.03515E-5 41424 0 3.30142E-5
12-47472690-A-C p.Thr32Thr synonymous AMIGO2 1 82768 1.2082E-5 41384 0 NA
12-47472693-C-T p.Val31Val synonymous AMIGO2 1739 82674 0.0210344 41337 79 0.0413186
12-47472695-C-T p.Val31Met missense AMIGO2 7 82702 8.46412E-5 41351 0 3.96596E-4
12-47472699-G-GCTTTGGACATTTGA p.Thr30fs frameshift AMIGO2 1 82678 1.20951E-5 41339 0 NA
12-47472701-T-C p.Ile29Val missense AMIGO2 52 82640 6.29235E-4 41320 0 3.02336E-4
12-47472704-T-C p.Met28Val missense AMIGO2 1 82586 1.21086E-5 41293 0 NA
12-47472707-G-A p.Leu27Leu synonymous AMIGO2 3 82526 3.63522E-5 41263 0 NA
12-47472718-A-G p.Leu23Pro missense AMIGO2 1 82366 1.21409E-5 41183 0 NA
12-47472722-C-G p.Glu22Gln missense AMIGO2 1 82268 1.21554E-5 41134 0 1.66489E-5
12-47472726-G-A p.Cys20Cys synonymous AMIGO2 6 82174 7.30158E-5 41087 0 7.97181E-6
12-47472728-A-C p.Cys20Gly missense AMIGO2 1 82134 1.21752E-5 41067 0 NA
12-47472731-C-T p.Gly19Ser missense AMIGO2 1 82090 1.21818E-5 41045 0 3.3456E-5
12-47472744-G-A p.Ala14Ala synonymous AMIGO2 9 81868 1.09933E-4 40934 0 4.00035E-6
12-47472751-A-G p.Leu12Pro missense AMIGO2 4 81834 4.88794E-5 40917 0 NA
12-47472752-G-A p.Leu12Phe missense AMIGO2 8 81818 9.7778E-5 40909 0 1.27453E-4
12-47472755-G-A p.Leu11Leu synonymous AMIGO2 2 81782 2.44553E-5 40891 0 NA
12-47472763-A-C p.Leu8Arg missense AMIGO2 1 81636 1.22495E-5 40818 0 NA
12-47472765-A-T p.Thr7Thr synonymous AMIGO2 1 81624 1.22513E-5 40812 0 1.73313E-5
12-47472774-A-C p.Arg4Arg synonymous AMIGO2 2 81540 2.45278E-5 40770 0 4.18932E-6
12-47472775-C-T p.Arg4His missense AMIGO2 1 81530 1.22654E-5 40765 0 6.25E-4
12-47472780-C-T p.Ser2Ser synonymous AMIGO2 1 81444 1.22784E-5 40722 0 3.18634E-5
12-47472843-G-A c.-58C>T 5_prime_UTR_premature_start_codon_gain AMIGO2 1 80222 1.24654E-5 40111 0 NA
12-47472846-AACCTGGCAAACAATTAATAATTCAGAGGGAGTAAAAAGCAGAAACTGACTACCACTAGTTAACCCATAAGAGCCAT-A c.-63-74_-62delATGGCTCTTATGGGTTAACTAGTGGTAGTCAGTTTCTGCTTTTTACTCCCTCTGAATTATTAATTGTTTGCCAGGT splice_acceptor AMIGO2 6 80138 7.48708E-5 40069 0 NA
12-47472848-C-CGGTG c.-63-1_-63insCACC splice_acceptor AMIGO2 1 80092 1.24856E-5 40046 0 NA
12-47472852-G-A c.-63-4C>T splice_region AMIGO2 1 79922 1.25122E-5 39961 0 NA
12-47472924-C-T c.-64+1G>A splice_donor AMIGO2 1 75404 1.32619E-5 37702 0 NA
12-47472925-C-A c.-64G>T 5_prime_UTR_premature_start_codon_gain AMIGO2 1 75064 1.3322E-5 37532 0 NA
12-47472929-C-T c.-64+1G>A splice_donor AMIGO2 3 74178 4.04433E-5 37089 0 NA
12-47472970-T-C c.-104A>G 5_prime_UTR_premature_start_codon_gain AMIGO2 1 60036 1.66567E-5 30018 0 3.18492E-5
12-47473030-TCCTGCTTATAAAAATGTACAGTCACATTCTCTCCATACAACCCACCGTCTCACCCACCATCAGAAACTCAATTTTTTCCTAAGGTGCATCCTGCGTTGTTGTTGTTGTTGTTGTTGTTTTAAACTCCCTCCAACAGACACAACTATACGCAAACGTACGCTACAAACAATTAAACGGAAATACTTAGCAACCACCCATCCAGGAAAAAACTCA-T c.-166+2_-165del splice_acceptor AMIGO2 2 26052 7.67695E-5 13026 0 NA
12-47473039-T-A c.-165-8A>T splice_region AMIGO2 1 22168 4.51101E-5 11084 0 1.27389E-4