Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
1-110050063-A-G p.Ile491Thr missense AMIGO1 2 83094 2.40691E-5 41547 0 NA
1-110050068-C-T p.Thr489Thr synonymous AMIGO1 7 83102 8.42338E-5 41551 0 6.25E-4
1-110050069-G-A p.Thr489Met missense AMIGO1 3 83116 3.60941E-5 41558 0 5.03525E-4
1-110050083-C-T p.Ser484Ser synonymous AMIGO1 3 83122 3.60915E-5 41561 0 1.44549E-4
1-110050084-G-A p.Ser484Leu missense AMIGO1 1 83114 1.20317E-5 41557 0 NA
1-110050104-C-T p.Ser477Ser synonymous AMIGO1 1 83094 1.20346E-5 41547 0 3.18756E-5
1-110050113-C-A p.Arg474Arg synonymous AMIGO1 1 83118 1.20311E-5 41559 0 NA
1-110050124-TGCCTGTGGCCTCAGGCACTGGCAGG-T p.Leu463fs frameshift AMIGO1 1 83118 1.20311E-5 41559 0 NA
1-110050128-T-C p.Thr469Thr synonymous AMIGO1 7 83130 8.42055E-5 41565 0 1.5909E-4
1-110050140-C-T p.Val465Val synonymous AMIGO1 2 83110 2.40645E-5 41555 0 NA
1-110050149-G-T p.Thr462Thr synonymous AMIGO1 2 83096 2.40685E-5 41548 0 6.25E-4
1-110050153-T-A p.Asn461Ile missense AMIGO1 21 83082 2.52762E-4 41541 0 2.23086E-4
1-110050172-C-T p.Gly455Ser missense AMIGO1 1 83000 1.20482E-5 41500 0 8.24239E-6
1-110050180-C-T p.Gly452Asp missense AMIGO1 386 82946 0.00465363 41473 5 0.00570754
1-110050190-G-A p.Pro449Ser missense AMIGO1 2 82870 2.41342E-5 41435 0 6.37918E-5
1-110050198-G-A p.Pro446Leu missense AMIGO1 1 82802 1.2077E-5 41401 0 NA
1-110050206-G-A p.Phe443Phe synonymous AMIGO1 1 82656 1.20983E-5 41328 0 0.00352467
1-110050216-C-T p.Arg440Gln missense AMIGO1 2 82998 2.4097E-5 41499 0 3.29647E-5
1-110050219-C-T p.Arg439Gln missense AMIGO1 2 83018 2.40912E-5 41509 0 1.59144E-5
1-110050221-G-A p.Asp438Asp synonymous AMIGO1 1 83072 1.20378E-5 41536 0 NA
1-110050228-C-A p.Gly436Val missense AMIGO1 1 83102 1.20334E-5 41551 0 NA
1-110050236-T-C p.Lys433Lys synonymous AMIGO1 7 83134 8.42014E-5 41567 0 5.03525E-4
1-110050239-G-A p.Asp432Asp synonymous AMIGO1 1 83112 1.2032E-5 41556 0 NA
1-110050250-C-A p.Ala429Ser missense AMIGO1 95 83150 0.00114251 41575 0 0.00219899
1-110050271-T-A p.Thr422Ser missense AMIGO1 4 83160 4.81E-5 41580 0 1.64775E-5
1-110050303-C-G p.Gly411Ala missense AMIGO1 1 83176 1.20227E-5 41588 0 NA
1-110050305-T-C p.Gln410Gln synonymous AMIGO1 3 83168 3.60716E-5 41584 0 9.56267E-5
1-110050322-T-C p.Lys405Glu missense AMIGO1 1 83146 1.2027E-5 41573 0 NA
1-110050330-C-T p.Gly402Asp missense AMIGO1 7 83116 8.42196E-5 41558 0 5.96687E-5
1-110050333-C-T p.Arg401Gln missense AMIGO1 1 83110 1.20322E-5 41555 0 1.98904E-5
1-110050334-G-A p.Arg401Trp missense AMIGO1 2 83118 2.40622E-5 41559 0 6.59109E-5
1-110050336-C-A p.Cys400Phe missense AMIGO1 1 83130 1.20294E-5 41565 0 NA
1-110050340-A-G p.Trp399Arg missense AMIGO1 1 83158 1.20253E-5 41579 0 NA
1-110050443-G-A p.His364His synonymous AMIGO1 1 83290 1.20062E-5 41645 0 3.29533E-5
1-110050458-G-A p.His359His synonymous AMIGO1 1 83320 1.20019E-5 41660 0 3.18654E-5
1-110050469-A-G p.Leu356Leu synonymous AMIGO1 2 83328 2.40015E-5 41664 0 8.23764E-6
1-110050491-G-A p.Phe348Phe synonymous AMIGO1 1 83292 1.2006E-5 41646 0 3.18532E-5
1-110050518-A-G p.Tyr339Tyr synonymous AMIGO1 3 83240 3.60404E-5 41620 0 3.18654E-5
1-110050529-C-T p.Gly336Ser missense AMIGO1 2 83184 2.40431E-5 41592 0 1.64742E-5
1-110050530-G-A p.Asp335Asp synonymous AMIGO1 2 83180 2.40442E-5 41590 0 3.18695E-5
1-110050535-C-T p.Glu334Lys missense AMIGO1 2 83174 2.4046E-5 41587 0 3.97738E-6
1-110050536-G-A p.Val333Val synonymous AMIGO1 2 83156 2.40512E-5 41578 0 6.36395E-5
1-110050536-G-T p.Val333Val synonymous AMIGO1 1 83156 1.20256E-5 41578 0 NA
1-110050538-C-T p.Val333Ile missense AMIGO1 1 83156 1.20256E-5 41578 0 NA
1-110050580-T-A p.Ser319Cys missense AMIGO1 1 82826 1.20735E-5 41413 0 NA
1-110050614-T-G p.Glu307Asp missense AMIGO1 1 82730 1.20875E-5 41365 0 3.18532E-5
1-110050617-A-G p.Asn306Asn synonymous AMIGO1 1 82772 1.20814E-5 41386 0 NA
1-110050637-C-T p.Val300Met missense AMIGO1 1 82862 1.20683E-5 41431 0 4.11868E-5
1-110050647-C-T p.Gly296Gly synonymous AMIGO1 1 82930 1.20584E-5 41465 0 NA
1-110050654-T-C p.Gln294Arg missense AMIGO1 1 82950 1.20555E-5 41475 0 3.97646E-6
1-110050680-G-C p.Thr285Thr synonymous AMIGO1 1 83008 1.2047E-5 41504 0 NA
1-110050692-G-A p.His281His synonymous AMIGO1 1 82994 1.20491E-5 41497 0 NA
1-110050708-C-T p.Arg276His missense AMIGO1 8 83028 9.6353E-5 41514 0 6.59033E-5
1-110050721-C-T p.Glu272Lys missense AMIGO1 3 83070 3.61141E-5 41535 0 1.64753E-5
1-110050721-C-G p.Glu272Gln missense AMIGO1 1 83070 1.2038E-5 41535 0 NA
1-110050743-G-A p.Asn264Asn synonymous AMIGO1 3 83132 3.60872E-5 41566 0 2.38639E-5
1-110050775-T-C p.Met254Val missense AMIGO1 1 83132 1.20291E-5 41566 0 3.18471E-5
1-110050785-A-T p.Asp250Glu missense AMIGO1 1 83118 1.20311E-5 41559 0 2.47182E-5
1-110050792-T-C p.Gln248Arg missense AMIGO1 1 83096 1.20343E-5 41548 0 8.24049E-6
1-110050797-G-A p.Asp246Asp synonymous AMIGO1 2 83074 2.40749E-5 41537 0 NA
1-110050799-C-A p.Asp246Tyr missense AMIGO1 1 83054 1.20404E-5 41527 0 NA
1-110050806-G-A p.Ser243Ser synonymous AMIGO1 1 82992 1.20494E-5 41496 0 8.24457E-6
1-110050820-G-A p.Arg239Trp missense AMIGO1 1 82978 1.20514E-5 41489 0 3.97852E-6
1-110050841-G-A p.Leu232Leu synonymous AMIGO1 3 82828 3.62196E-5 41414 0 3.1837E-5
1-110050860-G-A p.Cys225Cys synonymous AMIGO1 1 82738 1.20863E-5 41369 0 3.1837E-5
1-110050896-C-T p.Lys213Lys synonymous AMIGO1 1 82950 1.20555E-5 41475 0 NA
1-110050913-G-A p.Leu208Leu synonymous AMIGO1 1 83026 1.20444E-5 41513 0 3.18431E-5
1-110050919-G-C p.Gln206Glu missense AMIGO1 3 83054 3.61211E-5 41527 0 NA
1-110050920-C-G p.Leu205Leu synonymous AMIGO1 1 83064 1.20389E-5 41532 0 3.18451E-5
1-110050978-T-C p.Lys186Arg missense AMIGO1 1 83298 1.20051E-5 41649 0 NA
1-110051042-A-G p.Leu165Leu synonymous AMIGO1 2 83308 2.40073E-5 41654 0 3.9764E-6
1-110051071-T-C p.Asp155Gly missense AMIGO1 1 83244 1.20129E-5 41622 0 NA
1-110051084-G-T p.Arg151Arg synonymous AMIGO1 4 83212 4.807E-5 41606 0 6.36983E-5
1-110051092-G-A p.Ala148Val missense AMIGO1 5 83244 6.00644E-5 41622 0 5.76606E-5
1-110051124-C-T p.Glu137Glu synonymous AMIGO1 2 83236 2.40281E-5 41618 0 7.95488E-6
1-110051130-T-C p.Val135Val synonymous AMIGO1 37 83242 4.44487E-4 41621 2 0.00302115
1-110051136-C-G p.Leu133Leu synonymous AMIGO1 1 83242 1.20132E-5 41621 0 NA
1-110051138-G-A p.Leu133Leu synonymous AMIGO1 1 83256 1.20111E-5 41628 0 7.95526E-6
1-110051178-G-A p.Ser119Ser synonymous AMIGO1 1 83270 1.20091E-5 41635 0 NA
1-110051196-G-C p.Arg113Arg synonymous AMIGO1 1 83254 1.20114E-5 41627 0 3.97769E-6
1-110051201-G-A p.Leu112Leu synonymous AMIGO1 1 83266 1.20097E-5 41633 0 NA
1-110051212-G-A p.Pro108Leu missense AMIGO1 2 83266 2.40194E-5 41633 0 4.37612E-5
1-110051215-G-A p.Ser107Phe missense AMIGO1 1 83266 1.20097E-5 41633 0 NA
1-110051226-A-G p.Ser103Ser synonymous AMIGO1 1 83250 1.2012E-5 41625 0 NA
1-110051254-C-T p.Ser94Asn missense AMIGO1 1 83206 1.20184E-5 41603 0 NA
1-110051256-C-G p.Leu93Leu synonymous AMIGO1 1 83218 1.20166E-5 41609 0 NA
1-110051262-C-T p.Leu91Leu synonymous AMIGO1 5 83212 6.00875E-5 41606 0 1.98927E-5
1-110051278-G-A p.Thr86Ile missense AMIGO1 2 83166 2.40483E-5 41583 0 NA
1-110051284-C-T p.Arg84His missense AMIGO1 1 83134 1.20288E-5 41567 0 NA
1-110051287-G-T p.Thr83Lys missense AMIGO1 1 83144 1.20273E-5 41572 0 3.18756E-5
1-110051288-T-TG p.Thr83fs frameshift AMIGO1 1 83138 1.20282E-5 41569 0 NA
1-110051289-G-A p.Pro82Pro synonymous AMIGO1 3 83146 3.60811E-5 41573 0 8.25273E-6
1-110051298-C-A p.Glu79Asp missense AMIGO1 1 83128 1.20296E-5 41564 0 NA
1-110051309-G-C p.Leu76Val missense AMIGO1 1 83090 1.20351E-5 41545 0 NA
1-110051327-G-A p.His70Tyr missense AMIGO1 28 83064 3.37089E-4 41532 0 0.001875
1-110051329-C-T p.Ser69Asn missense AMIGO1 1 83050 1.20409E-5 41525 0 NA
1-110051337-C-T p.Leu66Leu synonymous AMIGO1 1 83072 1.20378E-5 41536 0 NA
1-110051340-T-C p.Leu65Leu synonymous AMIGO1 23 83068 2.76882E-4 41534 0 7.72865E-4
1-110051346-T-A p.Thr63Thr synonymous AMIGO1 1 83074 1.20375E-5 41537 0 NA
1-110051363-A-G p.Ser58Pro missense AMIGO1 1 83048 1.20412E-5 41524 0 NA
1-110051370-C-A p.Val55Val synonymous AMIGO1 1 83020 1.20453E-5 41510 0 NA
1-110051378-G-A p.Pro53Ser missense AMIGO1 1 82986 1.20502E-5 41493 0 3.98286E-6
1-110051403-G-A p.Ile44Ile synonymous AMIGO1 2 82890 2.41284E-5 41445 0 NA
1-110051415-G-A p.Cys40Cys synonymous AMIGO1 35 82766 4.22879E-4 41383 0 0.0020141
1-110051426-C-G p.Ala37Pro missense AMIGO1 2 82656 2.41967E-5 41328 0 7.97652E-6
1-110051426-C-A p.Ala37Ser missense AMIGO1 1 82656 1.20983E-5 41328 0 1.67743E-5
1-110051427-G-A p.Ala36Ala synonymous AMIGO1 1 82674 1.20957E-5 41337 0 3.98816E-6
1-110051428-G-T p.Ala36Asp missense AMIGO1 2 82650 2.41984E-5 41325 0 NA
1-110051449-C-T p.Arg29Gln missense AMIGO1 13 82194 1.58162E-4 41097 0 1.23216E-4
1-110051453-C-T p.Gly28Ser missense AMIGO1 2 81888 2.44236E-5 40944 0 2.69872E-5
1-110051455-G-T p.Ala27Asp missense AMIGO1 2 81798 2.44505E-5 40899 0 NA
1-110051459-T-C p.Arg26Gly missense AMIGO1 1 81854 1.22169E-5 40927 0 NA
1-110051462-C-T p.Ala25Thr missense AMIGO1 289 81666 0.0035388 40833 3 0.0083398
1-110051465-C-T p.Val24Met missense AMIGO1 1 81780 1.22279E-5 40890 0 8.10931E-6
1-110051472-AAGC-A p.Leu21del disruptive_inframe_deletion AMIGO1 1 81916 1.22076E-5 40958 0 3.19305E-5
1-110051501-G-A p.Leu12Phe missense AMIGO1 5 81444 6.13919E-5 40722 0 1.25116E-5
1-110051515-G-C p.Pro7Arg missense AMIGO1 1 81038 1.23399E-5 40519 0 4.87467E-6
1-110051591-G-A c.-57C>T 5_prime_UTR_premature_start_codon_gain AMIGO1 2 71196 2.80915E-5 35598 0 NA
1-110051604-T-A c.-65-5A>T splice_region AMIGO1 1 67616 1.47894E-5 33808 0 NA
1-110051612-G-A c.-78C>T 5_prime_UTR_premature_start_codon_gain AMIGO1 4 64196 6.23092E-5 32098 0 NA
1-110051621-ACTTGAGAGAAAGAGGATGGGTTTGTGGTCACCAAGGACTCCAGAGGGAAGGACACCCTCTCCCACTTCCCCTCCCACCCTTAC-A c.-87-83_-87-1delGTAAGGGTGGGAGGGGAAGTGGGAGAGGGTGTCCTTCCCTCTGGAGTCCTTGGTGACCACAAACCCATCCTCTTTCTCTCAAG splice_acceptor AMIGO1 1 60298 1.65843E-5 30149 0 NA
1-110051623-T-TGCTCGGCGAGGACGTGTCTCAGCCCA c.-87-3_-87-2insTGGGCTGAGACACGTCCTCGCCGAGC splice_region AMIGO1 1 59480 1.68124E-5 29740 0 NA
1-110051624-T-G c.-87-3A>C splice_region AMIGO1 1 59056 1.69331E-5 29528 0 NA
1-110052075-G-A c.-99C>T 5_prime_UTR_premature_start_codon_gain AMIGO1 1 14220 7.03235E-5 7110 0 6.39059E-5
1-110052104-G-A c.-128C>T 5_prime_UTR_premature_start_codon_gain AMIGO1 1 11214 8.91742E-5 5607 0 9.61107E-5
1-110052209-T-A c.-233A>T 5_prime_UTR_premature_start_codon_gain AMIGO1 1 5652 1.76929E-4 2826 0 NA
1-110052233-C-A c.-257G>T 5_prime_UTR_premature_start_codon_gain AMIGO1 1 5572 1.79469E-4 2786 0 3.25436E-5