Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
16-2570363-G-T c.-668G>T 5_prime_UTR_premature_start_codon_gain AMDHD2 1 29152 3.4303E-5 14576 0 NA
16-2570416-CCGCCGCGGGGCTCCGGAGCCGCTCGCTCCCGACACGGCTCACGATGCGCGGCGAGCAGGG-C p.Met1fs frameshift AMDHD2 1 33084 3.02261E-5 16542 0 NA
16-2570420-C-T c.-40C>T 5_prime_UTR_premature_start_codon_gain AMDHD2 1 33280 3.00481E-5 16640 0 NA
16-2570440-C-T c.-20C>T 5_prime_UTR_premature_start_codon_gain AMDHD2 1 34358 2.91053E-5 17179 0 0.00236967
16-2570469-G-C p.Glu4Gln missense AMDHD2 2 35610 5.6164E-5 17805 0 5.37057E-4
16-2570478-G-C p.Ala7Pro missense AMDHD2 2 35686 5.60444E-5 17843 0 NA
16-2570487-G-A p.Ala10Thr missense AMDHD2 1 35064 2.85193E-5 17532 0 0.00116144
16-2570490-C-T p.Arg11Cys missense AMDHD2 2 34830 5.74218E-5 17415 0 NA
16-2570492-C-G p.Arg11Arg synonymous AMDHD2 1 34734 2.87902E-5 17367 0 NA
16-2570506-C-G p.Thr16Ser missense AMDHD2 3 36040 8.32408E-5 18020 0 1.33905E-4
16-2570519-C-A p.Ile20Ile synonymous AMDHD2 2 36766 5.43981E-5 18383 0 3.36361E-5
16-2570519-C-T p.Ile20Ile synonymous AMDHD2 2 36766 5.43981E-5 18383 0 6.31313E-4
16-2570526-G-A p.Gly23Arg missense AMDHD2 2 37008 5.40424E-5 18504 0 4.04531E-4
16-2570531-G-A p.Gly24Gly synonymous AMDHD2 3 37332 8.036E-5 18666 0 NA
16-2570538-C-G p.Leu27Val missense AMDHD2 1 37376 2.67551E-5 18688 0 NA
16-2570540-C-T p.Leu27Leu splice_region+synonymous AMDHD2 1 37372 2.6758E-5 18686 0 3.40368E-4
16-2570545-G-T c.83+3G>T splice_region AMDHD2 1 37456 2.6698E-5 18728 0 NA
16-2570545-G-A c.83+3G>A splice_region AMDHD2 1 37458 2.66966E-5 18729 0 NA
16-2570550-C-A c.83+8C>A splice_region AMDHD2 1 36514 2.73868E-5 18257 0 NA
16-2570785-G-T p.Val33Val synonymous AMDHD2 1 81020 1.23426E-5 40510 0 1.45243E-5
16-2570792-G-T p.Gly36Cys missense AMDHD2 1 81320 1.22971E-5 40660 0 NA
16-2570806-C-G p.Asp40Glu missense AMDHD2 1 81800 1.22249E-5 40900 0 4.09883E-6
16-2570814-AGCTGTTCTTTGAGGAGCGGCGCGTG-A p.Leu44fs frameshift AMDHD2 1 82004 1.21945E-5 41002 0 NA
16-2570821-C-G p.Phe45Leu missense AMDHD2 1 82156 1.2172E-5 41078 0 4.05183E-6
16-2570821-C-T p.Phe45Phe synonymous AMDHD2 1 82158 1.21717E-5 41079 0 0.00125786
16-2570833-G-A p.Arg49Arg synonymous AMDHD2 2 82228 2.43226E-5 41114 0 NA
16-2570837-G-A p.Val51Met missense AMDHD2 1 82224 1.21619E-5 41112 0 NA
16-2570860-C-T p.Cys58Cys synonymous AMDHD2 2 81610 2.45068E-5 40805 0 8.65411E-6
16-2570861-G-A p.Gly59Arg missense AMDHD2 1 81636 1.22495E-5 40818 0 NA
16-2570867-C-A p.Arg61Ser missense AMDHD2 1 81632 1.22501E-5 40816 0 NA
16-2570880-C-T p.Pro65Leu missense AMDHD2 1 81952 1.22023E-5 40976 0 NA
16-2570881-C-T p.Pro65Pro synonymous AMDHD2 1 81970 1.21996E-5 40985 0 1.36071E-4
16-2570887-C-T p.Phe67Phe synonymous AMDHD2 1 81926 1.22061E-5 40963 0 8.46611E-6
16-2570893-C-T p.Asp69Asp synonymous AMDHD2 1 81998 1.21954E-5 40999 0 1.21418E-5
16-2570894-G-A p.Val70Met missense AMDHD2 1 81978 1.21984E-5 40989 0 NA
16-2570905-CGGTGCGGCCCGGGGCCGGCAGGGGAACCCAGGGGAGGAGCTCTGAGCTCCATGCGACACTTCCTTTTCTGTGGCTGCA-C p.Gly75del splice_acceptor AMDHD2 8 82230 9.72881E-5 41115 0 NA
16-2570911-G-A c.220+5G>A splice_region AMDHD2 1 82234 1.21604E-5 41117 0 NA
16-2570977-G-T c.221-8G>T splice_region AMDHD2 2 83004 2.40952E-5 41502 0 3.19E-5
16-2570979-C-T c.221-6C>T splice_region AMDHD2 2 83000 2.40964E-5 41500 0 NA
16-2570981-G-A c.221-4G>A splice_region AMDHD2 1 82990 1.20496E-5 41495 0 2.03854E-5
16-2570982-C-T c.221-3C>T splice_region AMDHD2 4 82950 4.82218E-5 41475 0 2.50204E-4
16-2570988-G-A p.Gly75Glu missense AMDHD2 1 82978 1.20514E-5 41489 0 4.0536E-6
16-2571001-C-T p.Asp79Asp synonymous AMDHD2 1 83028 1.20441E-5 41514 0 NA
16-2571017-G-A p.Glu85Lys missense AMDHD2 14 83042 1.68589E-4 41521 0 6.37999E-5
16-2571020-G-A p.Asp86Asn missense AMDHD2 1 83034 1.20433E-5 41517 0 8.29476E-6
16-2571023-G-A p.Val87Met missense AMDHD2 3 83038 3.6128E-5 41519 0 NA
16-2571025-G-C p.Val87Val synonymous AMDHD2 1 83026 1.20444E-5 41513 0 NA
16-2571031-G-A p.Ser89Ser synonymous AMDHD2 3 82986 3.61507E-5 41493 0 6.02211E-5
16-2571038-G-A p.Ala92Thr missense AMDHD2 1 82964 1.20534E-5 41482 0 NA
16-2571041-C-G p.Leu93Val missense AMDHD2 1 82992 1.20494E-5 41496 0 3.18918E-5
16-2571050-C-T p.Arg96Trp missense AMDHD2 3 82956 3.61638E-5 41478 0 3.19061E-5
16-2571052-G-C p.Arg96Arg synonymous AMDHD2 1 82962 1.20537E-5 41481 0 NA
16-2571059-C-T c.-414C>T 5_prime_UTR_premature_start_codon_gain AMDHD2 1 82942 1.20566E-5 41471 0 8.28404E-6
16-2571064-G-T p.Ser100Ser synonymous AMDHD2 9 82860 1.08617E-4 41430 0 1.0458E-4
16-2571064-GCA-G p.His101fs frameshift AMDHD2 1 82860 1.20685E-5 41430 0 NA
16-2571067-C-T c.-406C>T 5_prime_UTR_premature_start_codon_gain AMDHD2 1 82888 1.20645E-5 41444 0 8.28871E-6
16-2571070-C-T p.Gly102Gly synonymous AMDHD2 1 82870 1.20671E-5 41435 0 3.18898E-5
16-2571073-C-T p.Val103Val synonymous AMDHD2 49 82884 5.91188E-4 41442 0 7.96324E-4
16-2571074-ACCT-A p.Ser105del disruptive_inframe_deletion AMDHD2 1 82864 1.2068E-5 41432 0 NA
16-2571075-C-T p.Thr104Ile missense AMDHD2 2 82900 2.41255E-5 41450 0 NA
16-2571076-C-T p.Thr104Thr synonymous AMDHD2 1 82910 1.20613E-5 41455 0 8.30096E-6
16-2571079-C-T p.Ser105Ser synonymous AMDHD2 1 82924 1.20592E-5 41462 0 8.30579E-6
16-2571082-C-T c.-391C>T 5_prime_UTR_premature_start_codon_gain AMDHD2 1 82924 1.20592E-5 41462 0 NA
16-2571085-C-T p.Cys107Cys synonymous AMDHD2 11 82862 1.32751E-4 41431 0 3.18634E-5
16-2571088-C-A p.Pro108Pro synonymous AMDHD2 3 82878 3.61978E-5 41439 0 3.34035E-5
16-2571092-C-T c.-381C>T 5_prime_UTR_premature_start_codon_gain AMDHD2 10 82882 1.20653E-4 41441 0 7.31654E-5
16-2571097-C-T p.Val111Val synonymous AMDHD2 2 82840 2.41429E-5 41420 0 1.35481E-4
16-2571101-TC-T p.Pro114fs frameshift AMDHD2 2 82756 2.41674E-5 41378 0 NA
16-2571122-A-G p.Lys120Glu missense+splice_region AMDHD2 3 82614 3.63135E-5 41307 0 6.38937E-5
16-2571122-AAGGTG-A p.Lys120fs frameshift AMDHD2 1 82614 1.21045E-5 41307 0 NA
16-2577553-T-TC c.361-9_361-8insC splice_region AMDHD2 1 80670 1.23962E-5 40335 0 NA
16-2577564-T-G p.Val121Val splice_region+synonymous AMDHD2 1 81004 1.23451E-5 40502 0 3.19163E-5
16-2577573-G-A c.361-1G>A splice_acceptor AMDHD2 35 81136 4.31374E-4 40568 0 5.10562E-4
16-2577595-C-T p.Pro132Ser missense AMDHD2 2 81370 2.45791E-5 40685 0 1.13409E-4
16-2577604-G-T p.Ala135Ser missense AMDHD2 4 81418 4.91292E-5 40709 0 8.09389E-6
16-2577615-C-T c.-295C>T 5_prime_UTR_premature_start_codon_gain AMDHD2 1 81380 1.2288E-5 40690 0 1.22725E-5
16-2577618-T-G c.415+2T>G splice_donor AMDHD2 2 81378 2.45767E-5 40689 0 9.98762E-6
16-2577779-C-T p.His141Tyr missense AMDHD2 2 78260 2.55558E-5 39130 0 2.7947E-5
16-2577793-C-G p.Pro127Arg missense AMDHD2 7 77534 9.0283E-5 38767 0 3.19448E-5
16-2577799-C-T p.Ser129Leu missense AMDHD2 1 77108 1.29688E-5 38554 0 4.48938E-6
16-2577804-G-A p.Arg149Gln missense AMDHD2 14 76360 1.83342E-4 38180 0 1.91559E-4
16-2577813-G-A p.Arg152Gln missense AMDHD2 1 74926 1.33465E-5 37463 0 1.08911E-5
16-2577817-C-T p.Ala135Val missense AMDHD2 2 73886 2.70687E-5 36943 0 1.94217E-4
16-2577818-G-A p.Ala154Thr missense AMDHD2 1 73510 1.36036E-5 36755 0 1.76721E-5
16-2577819-C-T p.Ala154Val missense AMDHD2 1 73386 1.36266E-5 36693 0 3.2067E-5
16-2577820-G-A p.Arg136His missense AMDHD2 2 73040 2.73823E-5 36520 0 0.00151668
16-2577823-C-T p.Thr137Ile missense AMDHD2 1 73242 1.36534E-5 36621 0 NA
16-2577826-C-T p.Pro138Leu missense AMDHD2 4 72718 5.5007E-5 36359 0 9.57182E-5
16-2577827-G-A p.Glu157Lys missense AMDHD2 12 72562 1.65376E-4 36281 0 1.5952E-4
16-2577840-G-T p.Arg161Leu missense AMDHD2 1 71360 1.40135E-5 35680 0 NA
16-2577844-C-T p.Pro144Leu missense AMDHD2 1 71494 1.39872E-5 35747 0 NA
16-2577853-C-T p.Pro147Leu missense AMDHD2 103 70272 0.00146573 35136 0 0.001569
16-2577854-G-A p.Asp166Asn missense AMDHD2 16 70148 2.28089E-4 35074 0 0.00510302
16-2577882-A-G p.Tyr175Cys missense AMDHD2 1 69142 1.4463E-5 34571 0 NA
16-2577887-C-T p.Pro177Ser missense AMDHD2 1 68836 1.45273E-5 34418 0 NA
16-2577898-T-C p.Met162Thr missense AMDHD2 1 69266 1.44371E-5 34633 0 1.05869E-5
16-2577907-C-T p.Ser165Leu missense AMDHD2 14 69168 2.02406E-4 34584 0 1.28626E-4
16-2577913-G-C p.Thr185Thr synonymous AMDHD2 10 69036 1.44852E-4 34518 0 9.56755E-5
16-2577913-G-A p.Thr185Thr synonymous AMDHD2 2 69036 2.89704E-5 34518 0 3.18918E-5
16-2577913-G-T p.Thr185Thr synonymous AMDHD2 1 69036 1.44852E-5 34518 0 NA
16-2577914-C-T c.-153C>T 5_prime_UTR_premature_start_codon_gain AMDHD2 65 69302 9.37924E-4 34651 0 5.07966E-4
16-2577922-A-T c.-145A>T 5_prime_UTR_premature_start_codon_gain AMDHD2 2 69642 2.87183E-5 34821 0 0.00101215
16-2577932-C-T p.Arg192Cys missense AMDHD2 1 69696 1.4348E-5 34848 0 1.05419E-5
16-2577933-G-A p.Arg192His missense AMDHD2 1 69898 1.43066E-5 34949 0 2.23752E-5
16-2577937-C-T p.Ser193Ser synonymous AMDHD2 1 70464 1.41916E-5 35232 0 NA
16-2577940-C-T c.-127C>T 5_prime_UTR_premature_start_codon_gain AMDHD2 2 70562 2.83439E-5 35281 0 4.37411E-6
16-2577941-G-A p.Glu195Lys missense AMDHD2 2 70872 2.82199E-5 35436 0 3.04124E-5
16-2577943-A-C p.Glu195Asp missense AMDHD2 129 70894 0.00181962 35447 0 0.00157774
16-2577950-C-T p.Arg198Trp missense AMDHD2 1 71064 1.40718E-5 35532 0 1.00008E-4
16-2577953-G-A p.Ala199Thr missense AMDHD2 1 71152 1.40544E-5 35576 0 NA
16-2577955-G-A p.Ala199Ala synonymous AMDHD2 1 71354 1.40146E-5 35677 0 3.9248E-5
16-2577965-C-T p.Arg203Cys missense AMDHD2 2 72552 2.75664E-5 36276 0 2.85453E-5
16-2577978-T-G p.Val207Gly missense AMDHD2 1 73600 1.3587E-5 36800 0 NA
16-2577984-TAGGTGAGGGGCCGGCTCGGGGTGGGCCTGCTTGGGGGACCTGGGCCAGGTGCAAAGTCTGAATCCAGGTCCCGC-T p.His211fs frameshift AMDHD2 8 74300 1.07672E-4 37150 0 NA
16-2577985-A-G c.-82A>G 5_prime_UTR_premature_start_codon_gain AMDHD2 1 74334 1.34528E-5 37167 0 NA
16-2578056-C-T c.629-5C>T splice_region AMDHD2 16 77966 2.05218E-4 38983 0 1.27771E-4
16-2578067-C-T p.Ser212Leu missense AMDHD2 1 77954 1.28281E-5 38977 0 NA
16-2578081-C-T p.Arg217Trp missense AMDHD2 1 77158 1.29604E-5 38579 0 6.38937E-5
16-2578085-C-T p.Ala218Val missense AMDHD2 1 76814 1.30185E-5 38407 0 3.19632E-5
16-2578086-G-A p.Ala218Ala synonymous AMDHD2 3 76984 3.89691E-5 38492 0 3.20564E-5
16-2578092-G-A p.Glu220Glu synonymous AMDHD2 1 77128 1.29655E-5 38564 0 NA
16-2578094-A-G p.Asp221Gly missense AMDHD2 29 76944 3.76897E-4 38472 0 4.34957E-4
16-2578105-A-C p.Ser225Arg missense AMDHD2 1 76558 1.3062E-5 38279 0 NA
16-2578107-C-T p.Ser225Ser synonymous AMDHD2 2 76238 2.62336E-5 38119 0 6.39713E-5
16-2578110-A-C p.Gly226Gly synonymous AMDHD2 1 76438 1.30825E-5 38219 0 NA
16-2578113-C-T p.Ala227Ala synonymous AMDHD2 1 76444 1.30815E-5 38222 0 NA
16-2578114-A-C p.Thr228Pro missense AMDHD2 1 76476 1.3076E-5 38238 0 NA
16-2578116-C-T p.Thr228Thr synonymous AMDHD2 3 76666 3.91308E-5 38333 0 1.20278E-5
16-2578120-A-C p.Ile230Leu missense AMDHD2 1 76554 1.30627E-5 38277 0 NA
16-2578122-C-A p.Ile230Ile synonymous AMDHD2 2 76552 2.6126E-5 38276 0 4.00985E-6
16-2578123-A-C p.Thr231Pro missense AMDHD2 1 76198 1.31237E-5 38099 0 NA
16-2578125-C-T p.Thr231Thr synonymous AMDHD2 3 76534 3.91983E-5 38267 0 4.1783E-5
16-2578127-A-C p.His232Pro missense AMDHD2 1 76314 1.31038E-5 38157 0 NA
16-2578128-C-T p.His232His synonymous AMDHD2 1 76436 1.30828E-5 38218 0 3.19754E-5
16-2578131-C-G c.-10C>G 5_prime_UTR_premature_start_codon_gain AMDHD2 669 76446 0.00875128 38223 21 0.0192824
16-2578131-C-T p.Leu233Leu synonymous AMDHD2 81 76490 0.00105896 38245 1 0.00323427
16-2578137-C-T c.-4C>T 5_prime_UTR_premature_start_codon_gain AMDHD2 3 76334 3.9301E-5 38167 0 2.42515E-4
16-2578149-TGTGAGTGCTATGGGGCCCCAGGGGCGGGGCTGGGGTCCCAGCAGCCCCTGCTGTCGCTCAGCCATCCCTTCCCTCGCCCCTGCCCAG-T c.717+1_718-1delGTGAGTGCTATGGGGCCCCAGGGGCGGGGCTGGGGTCCCAGCAGCCCCTGCTGTCGCTCAGCCATCCCTTCCCTCGCCCCTGCCCAG splice_acceptor AMDHD2 7 76728 9.12314E-5 38364 0 NA
16-2578247-G-A p.Arg243His missense AMDHD2 1 80192 1.24701E-5 40096 0 NA
16-2578248-C-T p.Arg243Arg synonymous AMDHD2 1 80322 1.24499E-5 40161 0 2.5394E-5
16-2578253-C-T p.Pro245Leu missense AMDHD2 2 80768 2.47623E-5 40384 0 3.1904E-5
16-2578260-C-T p.Ile247Ile synonymous AMDHD2 4 80940 4.94193E-5 40470 0 8.05075E-5
16-2578261-G-A p.Val248Met missense AMDHD2 2 80914 2.47176E-5 40457 0 8.04984E-6
16-2578266-G-C p.Gly249Gly synonymous AMDHD2 1 81128 1.23262E-5 40564 0 4.02389E-6
16-2578279-G-A p.Asp254Asn missense AMDHD2 1 81366 1.22901E-5 40683 0 NA
16-2578283-G-A p.Arg255Gln missense AMDHD2 1 81410 1.22835E-5 40705 0 3.19366E-5
16-2578287-G-C p.Leu256Leu synonymous AMDHD2 71 81484 8.71337E-4 40742 0 0.00252016
16-2578290-C-T p.Pro257Pro synonymous AMDHD2 11 81558 1.34873E-4 40779 0 9.57732E-5
16-2578291-G-T p.Ala258Ser missense AMDHD2 7 81432 8.59613E-5 40716 0 4.04223E-6
16-2578296-C-T p.Gly259Gly synonymous AMDHD2 1 81632 1.22501E-5 40816 0 8.51847E-6
16-2578297-C-T p.Arg260Cys missense AMDHD2 261 81654 0.00319641 40827 0 0.0025894
16-2578315-A-G p.Met266Val missense AMDHD2 1 82044 1.21886E-5 41022 0 NA
16-2578330-A-G p.Thr271Ala missense AMDHD2 2 82076 2.43677E-5 41038 0 8.49185E-6
16-2578331-C-T p.Thr271Met missense AMDHD2 2 82068 2.437E-5 41034 0 1.91375E-4
16-2578332-G-A p.Thr271Thr synonymous AMDHD2 6 82032 7.31422E-5 41016 0 3.21585E-5
16-2578332-G-C p.Thr271Thr synonymous AMDHD2 3 82032 3.65711E-5 41016 0 NA
16-2578334-A-C p.His272Pro missense AMDHD2 1 82062 1.21859E-5 41031 0 NA
16-2578335-C-T p.His272His synonymous AMDHD2 2 82068 2.437E-5 41034 0 8.49661E-6
16-2578343-C-T p.Pro275Leu missense AMDHD2 1 82150 1.21729E-5 41075 0 4.01974E-6
16-2578344-C-T p.Pro275Pro synonymous AMDHD2 2 82170 2.43398E-5 41085 0 6.37796E-5
16-2578348-G-A p.Ala277Thr missense AMDHD2 2 82122 2.4354E-5 41061 0 1.70019E-5
16-2578351-C-T p.Leu278Leu synonymous AMDHD2 1 82192 1.21666E-5 41096 0 2.01165E-5
16-2578359-C-T p.Ile280Ile synonymous AMDHD2 34 82094 4.14159E-4 41047 0 2.33656E-4
16-2578367-G-A p.Arg283His missense AMDHD2 2 82064 2.43712E-5 41032 0 6.25E-4
16-2578380-GGGTAAGCTGCGGCAGGTGGCCAGGACAGGTAGGATGACTGGGCTAGCAGGTTCTGAGCCTCTTCTCCCCCA-G p.Leu289fs frameshift AMDHD2 8 82004 9.75562E-5 41002 0 NA
16-2578383-T-C c.862+2T>C splice_donor AMDHD2 2 81958 2.44027E-5 40979 0 NA
16-2578384-A-G c.862+3A>G splice_region AMDHD2 2 81976 2.43974E-5 40988 0 NA
16-2578445-T-TC c.863-3dupC splice_acceptor AMDHD2 1 81604 1.22543E-5 40802 0 5.13066E-5
16-2578446-C-T c.863-7C>T splice_region AMDHD2 4 81674 4.89752E-5 40837 0 9.56877E-5
16-2578446-C-A c.863-7C>A splice_region AMDHD2 1 81674 1.22438E-5 40837 0 4.03141E-5
16-2578447-C-G c.863-6C>G splice_region AMDHD2 1 81694 1.22408E-5 40847 0 NA
16-2578449-C-T c.863-4C>T splice_region AMDHD2 1 81740 1.22339E-5 40870 0 1.20933E-5
16-2578469-C-T p.Thr293Thr synonymous AMDHD2 5 81902 6.10486E-5 40951 0 6.37592E-5
16-2578470-G-A p.Asp294Asn missense AMDHD2 1 81888 1.22118E-5 40944 0 4.02706E-6
16-2578471-A-G p.Asp294Gly missense AMDHD2 2 81904 2.44188E-5 40952 0 3.18898E-5
16-2578472-T-C p.Asp294Asp synonymous AMDHD2 1 81942 1.22038E-5 40971 0 3.18878E-5
16-2578480-C-T p.Pro297Leu missense AMDHD2 1 82044 1.21886E-5 41022 0 3.18776E-5
16-2578487-G-A p.Leu299Leu synonymous AMDHD2 1 82082 1.21829E-5 41041 0 4.02E-6
16-2578496-C-T n.694C>T splice_region AMDHD2 1 82140 1.21743E-5 41070 0 4.01871E-6
16-2578498-A-G p.Asn303Ser missense AMDHD2 1 82160 1.21714E-5 41080 0 4.01732E-5
16-2578514-G-A p.Leu308Leu synonymous AMDHD2 1 82320 1.21477E-5 41160 0 NA
16-2578532-A-AGTGGAC p.Val315_Asp316dup disruptive_inframe_insertion AMDHD2 1 82358 1.21421E-5 41179 0 3.18939E-5
16-2578538-C-T p.Asp316Asp synonymous AMDHD2 7 82286 8.50692E-5 41143 0 0.00100705
16-2578539-G-A p.Gly317Ser missense AMDHD2 1 82270 1.21551E-5 41135 0 1.69331E-5
16-2578542-C-T p.Leu318Leu synonymous AMDHD2 1 82276 1.21542E-5 41138 0 NA
16-2578544-G-C p.Leu318Leu synonymous AMDHD2 2 82292 2.43037E-5 41146 0 NA
16-2578547-G-A p.Thr319Thr synonymous AMDHD2 3 82216 3.64892E-5 41108 0 8.45838E-6
16-2578549-C-T p.Ala320Val missense AMDHD2 1 82200 1.21655E-5 41100 0 8.45566E-6
16-2578553-C-T p.Tyr321Tyr synonymous AMDHD2 40 82190 4.86677E-4 41095 0 0.00125
16-2578555-TG-T p.Ala323fs frameshift AMDHD2 1 82168 1.21702E-5 41084 0 NA
16-2578558-C-T p.Ala323Val missense+splice_region AMDHD2 21 82104 2.55773E-4 41052 0 1.0432E-4
16-2578558-CAGGTGAGCGCCCTGACCCACTGGGTCCCAGGTCCCAGCCCGCATGCCAGGTGGCCCACGACCCCCCCAGAGCCTGCCCTCTCTGCTCTCA-C p.Gly324fs frameshift AMDHD2 7 82104 8.52577E-5 41052 0 NA
16-2578567-G-A p.Arg326His missense AMDHD2 6 81788 7.33604E-5 40894 0 4.01684E-6
16-2578571-T-C p.Pro327Pro synonymous AMDHD2 1 81858 1.22163E-5 40929 0 NA
16-2578584-C-G p.Pro332Ala missense AMDHD2 1 81554 1.22618E-5 40777 0 NA
16-2578587-A-T p.Arg333Trp missense AMDHD2 1 81564 1.22603E-5 40782 0 NA
16-2578593-C-A p.Gln335Lys missense AMDHD2 1 81328 1.22959E-5 40664 0 4.01442E-6
16-2578597-C-T p.Pro336Leu missense AMDHD2 1 81106 1.23295E-5 40553 0 NA
16-2578598-C-T p.Pro336Pro synonymous AMDHD2 2 81042 2.46786E-5 40521 0 9.5645E-5
16-2578599-G-A p.Ala337Thr missense AMDHD2 1 80924 1.23573E-5 40462 0 2.53207E-5
16-2578607-G-C p.Gln339His missense AMDHD2 270 80584 0.00335054 40292 1 0.00819202
16-2578612-C-T p.Ala341Val missense AMDHD2 2 80192 2.49401E-5 40096 0 7.24486E-5
16-2578616-C-T p.His342His synonymous AMDHD2 1 79684 1.25496E-5 39842 0 0.00125156
16-2578617-G-A p.Asp343Asn missense AMDHD2 1 79436 1.25888E-5 39718 0 2.8196E-5
16-2578618-A-AC p.Arg346fs frameshift AMDHD2 6 79050 7.59013E-5 39525 0 8.48156E-5
16-2578620-C-A p.Pro344Thr missense AMDHD2 2 79394 2.51908E-5 39697 0 6.74673E-5
16-2578621-C-G p.Pro344Arg missense AMDHD2 1 79374 1.25986E-5 39687 0 2.41536E-5
16-2578623-C-T p.Pro345Ser missense AMDHD2 3 79318 3.78224E-5 39659 0 NA
16-2578624-C-G p.Pro345Arg missense AMDHD2 2 79250 2.52366E-5 39625 0 2.52904E-5
16-2578625-C-A p.Pro345Pro synonymous AMDHD2 2 79210 2.52493E-5 39605 0 9.66324E-5
16-2578634-C-T p.Cys348Cys synonymous AMDHD2 1 78246 1.27802E-5 39123 0 NA
16-2578635-C-T p.Pro349Ser missense AMDHD2 1 78212 1.27858E-5 39106 0 3.18613E-5
16-2578636-C-T p.Pro349Leu missense AMDHD2 1 78228 1.27831E-5 39114 0 2.52981E-5
16-2578646-T-G c.971-5T>G splice_region AMDHD2 1 77166 1.29591E-5 38583 0 NA
16-2578647-C-T p.Gln353* stop_gained AMDHD2 1 77130 1.29651E-5 38565 0 5.05919E-5
16-2578660-C-T p.Thr327Met missense AMDHD2 2 75338 2.6547E-5 37669 0 6.37064E-5
16-2578661-G-A p.Thr327Thr synonymous AMDHD2 2 75052 2.66482E-5 37526 0 3.18634E-5
16-2578664-G-C p.Leu328Leu synonymous AMDHD2 5 74798 6.68467E-5 37399 0 NA
16-2578677-G-T p.Ala333Ser missense AMDHD2 2 72680 2.75179E-5 36340 0 NA
16-2578679-C-G p.Ala333Ala synonymous AMDHD2 1 72472 1.37984E-5 36236 0 NA
16-2578685-G-C p.Met335Ile missense AMDHD2 1 71686 1.39497E-5 35843 0 NA
16-2578711-A-G p.Gln344Arg missense AMDHD2 9 68278 1.31814E-4 34139 0 7.82183E-5
16-2578722-C-A c.1039+3C>A splice_region AMDHD2 9 67278 1.33773E-4 33639 0 5.09879E-4
16-2578987-C-T c.1040-8C>T splice_region AMDHD2 6 81554 7.35709E-5 40777 0 3.18674E-5
16-2579000-A-C p.Ser349Arg missense AMDHD2 2 81686 2.4484E-5 40843 0 6.18735E-5
16-2579014-C-G p.Ala353Ala synonymous AMDHD2 1 81682 1.22426E-5 40841 0 NA
16-2579034-A-T p.His360Leu missense AMDHD2 1 81532 1.22651E-5 40766 0 NA
16-2579038-C-T p.Pro361Pro synonymous AMDHD2 2 81528 2.45314E-5 40764 0 8.50087E-5
16-2579043-A-G p.Gln363Arg missense AMDHD2 1 81506 1.2269E-5 40753 0 1.41764E-4
16-2579050-G-A p.Leu365Leu synonymous AMDHD2 431 81488 0.00528912 40744 1 0.0101527
16-2579064-G-C p.Ser370Thr missense AMDHD2 1 81450 1.22775E-5 40725 0 3.18817E-5
16-2579073-C-T p.Thr373Ile missense AMDHD2 1 81372 1.22892E-5 40686 0 9.1416E-6
16-2579081-T-G p.Phe376Val missense AMDHD2 1 81270 1.23047E-5 40635 0 NA
16-2579084-G-A p.Gly377Ser missense AMDHD2 2 81234 2.46202E-5 40617 0 3.18857E-5
16-2579092-C-T p.Asp379Asp synonymous AMDHD2 28 80986 3.45739E-4 40493 0 3.13419E-4
16-2579104-C-A c.1141+8C>A splice_region AMDHD2 23 80540 2.85572E-4 40270 0 8.61959E-4
16-2579489-C-T p.Leu385Leu synonymous AMDHD2 4 81438 4.91171E-5 40719 0 2.42489E-5
16-2579492-C-T p.Asp386Asp synonymous AMDHD2 71 81474 8.71444E-4 40737 0 0.00156131
16-2579493-G-A p.Asp387Asn missense AMDHD2 5 81516 6.13377E-5 40758 0 5.04541E-4
16-2579497-C-G p.Ser388Cys missense AMDHD2 1 81642 1.22486E-5 40821 0 NA
16-2579498-C-T p.Ser388Ser synonymous AMDHD2 2 81734 2.44696E-5 40867 0 3.18593E-5
16-2579504-C-T p.His390His synonymous AMDHD2 6 81754 7.33909E-5 40877 0 6.62614E-5
16-2579505-G-A p.Val391Ile missense AMDHD2 3 81754 3.66955E-5 40877 0 1.20694E-5
16-2579524-C-T p.Ser427Leu missense+splice_region AMDHD2 16 82154 1.94756E-4 41077 0 1.65706E-5
16-2579528-T-C c.1282+2T>C splice_donor AMDHD2 1 82166 1.21705E-5 41083 0 4.01742E-6
16-2579533-T-C p.Leu400Pro missense AMDHD2 1 82212 1.21637E-5 41106 0 NA
16-2579546-G-A p.Ala404Ala synonymous AMDHD2 1 81046 1.23387E-5 40523 0 0.00125
16-2579548-A-G p.Asp405Gly missense AMDHD2 4 80752 4.95344E-5 40376 0 0.111842
16-2579549-C-G p.Asp405Glu missense AMDHD2 7 80834 8.65972E-5 40417 0 0.0177126
16-2579550-G-A p.Ala406Thr missense AMDHD2 1 80878 1.23643E-5 40439 0 4.11482E-6
16-2579552-A-G p.Ala406Ala synonymous AMDHD2 1 81080 1.23335E-5 40540 0 NA
16-2579556-A-G p.Arg408Gly missense AMDHD2 1 81284 1.23025E-5 40642 0 NA
16-2579623-T-C n.527T>C splice_region AMDHD2 6 80852 7.42097E-5 40426 0 NA
16-2580250-A-G c.1283-8A>G splice_region AMDHD2 2 76868 2.60186E-5 38434 0 5.817E-5
16-2580266-C-G p.Leu431Val missense AMDHD2 1 78710 1.27049E-5 39355 0 3.16469E-5
16-2580276-G-T p.Cys434Phe missense AMDHD2 1 79638 1.25568E-5 39819 0 NA
16-2580279-G-A p.Gly435Asp missense AMDHD2 26 79740 3.2606E-4 39870 0 0.008125
16-2580279-G-GT p.Asp436fs frameshift AMDHD2 1 79744 1.25401E-5 39872 0 NA
16-2580282-A-G p.Asp436Gly missense AMDHD2 38 79790 4.7625E-4 39895 0 0.00118022
16-2580286-T-C p.Pro437Pro synonymous AMDHD2 2 79988 2.50038E-5 39994 0 NA
16-2580303-C-T p.Ala443Val missense AMDHD2 1 80748 1.23842E-5 40374 0 8.60778E-6
16-2580305-G-C p.Val444Leu missense AMDHD2 1 80912 1.23591E-5 40456 0 NA
16-2580322-G-A p.Val449Val synonymous AMDHD2 6 81284 7.38153E-5 40642 0 0.00100705
16-2580326-C-T p.Pro451Ser missense AMDHD2 1 81352 1.22923E-5 40676 0 2.02799E-5
16-2580327-C-T p.Pro451Leu missense AMDHD2 1 81386 1.22871E-5 40693 0 1.69173E-5
16-2580336-C-T p.Pro454Leu missense AMDHD2 1 81460 1.2276E-5 40730 0 8.42744E-6
16-2580338-A-G p.Ile455Val missense AMDHD2 1 81508 1.22687E-5 40754 0 NA
16-2580350-C-T p.Leu459Leu synonymous AMDHD2 2 81486 2.45441E-5 40743 0 8.411E-6
16-2580360-C-T p.Ser462Phe missense AMDHD2 1 81448 1.22778E-5 40724 0 NA
16-2580360-C-G p.Ser462Cys missense AMDHD2 4 81448 4.91111E-5 40724 0 NA
16-2580361-T-G p.Ser462Ser synonymous AMDHD2 65 81424 7.9829E-4 40712 0 0.00133766
16-2580361-T-C p.Ser462Ser synonymous AMDHD2 1 81428 1.22808E-5 40714 0 NA
16-2580361-TG-T p.Val463fs frameshift AMDHD2 2 81428 2.45616E-5 40714 0 3.18492E-5
16-2580362-G-T p.Val463Leu missense AMDHD2 139 81388 0.00170787 40694 0 0.00114197
16-2580366-C-T p.Ser464Phe missense AMDHD2 1 81380 1.2288E-5 40690 0 8.39433E-6
16-2580367-C-T p.Ser464Ser synonymous AMDHD2 2 81370 2.45791E-5 40685 0 NA
16-2580374-C-G p.Pro467Ala missense AMDHD2 4 81236 4.92393E-5 40618 0 3.64952E-5
16-2580375-C-T p.Pro467Leu missense AMDHD2 10 81242 1.23089E-4 40621 0 2.4327E-5
16-2580379-GCA-G p.Pro471fs frameshift AMDHD2 11 81164 1.35528E-4 40582 0 1.25743E-4
16-2580380-C-A p.His469Asn missense AMDHD2 8 81186 9.85392E-5 40593 0 9.55718E-5
16-2580386-C-T p.Pro471Ser missense AMDHD2 2 81206 2.46287E-5 40603 0 8.37773E-6
16-2580397-A-G p.Gln474Gln synonymous AMDHD2 1 81112 1.23286E-5 40556 0 6.3743E-5
16-2580399-C-G p.Thr475Arg missense AMDHD2 1 81102 1.23302E-5 40551 0 NA
16-2580406-C-T p.Ala477Ala synonymous AMDHD2 4 80956 4.94096E-5 40478 0 2.51235E-5
16-2580407-G-A p.Val478Met missense AMDHD2 1 80940 1.23548E-5 40470 0 NA
16-2580425-C-T p.Leu484Phe missense AMDHD2 1 80862 1.23667E-5 40431 0 NA
16-2580428-C-T p.Arg485* stop_gained AMDHD2 8 80742 9.9081E-5 40371 0 0.00103627
16-2580429-G-A p.Arg485Gln missense AMDHD2 1 80688 1.23934E-5 40344 0 3.18573E-5
16-2580433-C-T p.Gly486Gly synonymous AMDHD2 1 80520 1.24193E-5 40260 0 8.40958E-5
16-2580434-G-C p.Gly487Arg missense AMDHD2 1 80540 1.24162E-5 40270 0 1.62733E-5
16-2580434-G-A p.Gly487Arg missense AMDHD2 4 80540 4.96648E-5 40270 0 2.52156E-5
16-2580435-G-A p.Gly487Glu missense AMDHD2 4 80528 4.96722E-5 40264 0 4.06607E-6
16-2580444-C-G p.Ser490Cys missense AMDHD2 2 79922 2.50244E-5 39961 0 NA
16-2580455-T-C p.Leu494Leu synonymous AMDHD2 4 80140 4.99127E-5 40070 0 NA
16-2580463-G-A p.Leu496Leu synonymous AMDHD2 3 80118 3.74448E-5 40059 0 6.9049E-5
16-2580474-C-T p.Thr500Ile missense AMDHD2 2 80238 2.49258E-5 40119 0 5.85451E-5
16-2580481-G-A p.Gly502Gly synonymous AMDHD2 2 80318 2.4901E-5 40159 0 8.35254E-6
16-2580484-AGACGTC-A p.Asp504_Val505del conservative_inframe_deletion AMDHD2 1 80348 1.24459E-5 40174 0 NA
16-2580487-C-T p.Asp504Asp synonymous AMDHD2 1 80350 1.24456E-5 40175 0 6.37186E-5
16-2580488-G-T p.Val505Phe missense AMDHD2 1 80362 1.24437E-5 40181 0 3.18613E-5
16-2580488-G-A p.Val505Ile missense AMDHD2 2 80362 2.48874E-5 40181 0 8.10701E-6
16-2580493-GGATTGGTGCAGCCCCACGTCAGGGGTGATTGTCT-G p.Asp507fs frameshift AMDHD2 1 80434 1.24326E-5 40217 0 NA
16-2580496-T-C p.Asp507Asp synonymous AMDHD2 1 80436 1.24322E-5 40218 0 9.56267E-5
16-2580507-C-G p.Pro511Arg missense AMDHD2 1 80400 1.24378E-5 40200 0 4.05052E-6
16-2580510-C-A p.Thr512Lys missense AMDHD2 2 80372 2.48843E-5 40186 0 3.18674E-5
16-2580510-C-T p.Thr512Met missense AMDHD2 5 80372 6.22107E-5 40186 0 2.83522E-5
16-2580525-TCTTGA-T p.Leu518fs frameshift AMDHD2 1 80276 1.2457E-5 40138 0 1.21457E-5
16-2580528-T-A p.Leu518* stop_gained AMDHD2 37 80250 4.61059E-4 40125 0 0.00127478
16-2580531-C-G p.Thr519Ser missense AMDHD2 63 80220 7.8534E-4 40110 2 0.003125
16-2580531-C-T p.Thr519Ile missense AMDHD2 1 80226 1.24648E-5 40113 0 8.30234E-6
16-2580534-T-A p.Phe520Tyr missense AMDHD2 7 80212 8.72687E-5 40106 0 1.66033E-5
16-2580537-C-G p.Ser521Cys missense AMDHD2 1 80194 1.24698E-5 40097 0 NA
16-2580546-A-C p.Glu524Ala missense AMDHD2 4 80152 4.99052E-5 40076 0 4.14924E-5
16-2580550-C-G p.Phe525Leu missense AMDHD2 2 80138 2.49569E-5 40069 0 8.29752E-6
16-2580553-G-T p.Trp526Cys missense AMDHD2 2 80118 2.49632E-5 40059 0 2.42876E-5
16-2580563-C-T p.Leu530Phe missense AMDHD2 1 80100 1.24844E-5 40050 0 NA
16-2580572-C-G p.Pro533Ala missense AMDHD2 1 80114 1.24822E-5 40057 0 NA
16-2580574-C-T p.Pro533Pro synonymous AMDHD2 1 80104 1.24838E-5 40052 0 NA
16-2580590-G-T p.Val539Phe missense AMDHD2 1 80112 1.24825E-5 40056 0 NA
16-2580593-C-T p.Leu540Leu synonymous AMDHD2 2 80106 2.49669E-5 40053 0 8.2927E-6
16-2580599-A-G p.Thr542Ala missense AMDHD2 1 80112 1.24825E-5 40056 0 NA
16-2580609-C-T p.Thr545Met missense AMDHD2 1 80140 1.24782E-5 40070 0 2.48806E-5
16-2580611-C-T p.Arg546Cys missense AMDHD2 16 80122 1.99695E-4 40061 0 1.59347E-4
16-2580612-G-A p.Arg546His missense AMDHD2 4 80134 4.99164E-5 40067 0 3.23889E-5
16-2580617-G-A p.Ala548Thr missense AMDHD2 2 80158 2.49507E-5 40079 0 3.18674E-5
16-2580619-T-C p.Ala548Ala synonymous AMDHD2 1 80166 1.24741E-5 40083 0 NA
16-2580633-C-T p.Ser553Phe missense AMDHD2 1 80182 1.24716E-5 40091 0 NA
16-2580643-C-G p.Cys556Trp missense AMDHD2 1 80212 1.2467E-5 40106 0 3.18613E-5
16-2580655-G-A p.Gln560Gln synonymous AMDHD2 1 80224 1.24651E-5 40112 0 NA
16-2580664-A-C p.Lys563Asn missense AMDHD2 2 80228 2.4929E-5 40114 0 1.66163E-5
16-2580675-T-A p.Val567Asp missense AMDHD2 1 80206 1.24679E-5 40103 0 NA
16-2580677-CAA-C p.Asp570fs frameshift AMDHD2 2 80200 2.49377E-5 40100 0 NA
16-2580682-A-G p.Arg569Arg synonymous AMDHD2 1 80218 1.2466E-5 40109 0 4.05091E-6
16-2580683-GAT-G p.Asp570fs frameshift AMDHD2 1 80224 1.24651E-5 40112 0 2.02549E-5
16-2580685-T-G p.Asp570Glu missense AMDHD2 33 80226 4.11338E-4 40113 1 0.001875
16-2580687-G-A p.Arg571Lys missense AMDHD2 2 80230 2.49283E-5 40115 0 8.32584E-6
16-2580694-C-A p.Val573Val synonymous AMDHD2 1 80192 1.24701E-5 40096 0 1.21599E-5
16-2580708-T-C p.Val578Ala missense AMDHD2 1 80144 1.24775E-5 40072 0 8.33875E-6
16-2580717-A-G p.Glu581Gly missense AMDHD2 1 80114 1.24822E-5 40057 0 3.19E-5
16-2580722-C-T p.Pro583Ser missense AMDHD2 1 80092 1.24856E-5 40046 0 NA
16-2580735-AC-A p.Leu588fs frameshift AMDHD2 3 80040 3.74813E-5 40020 0 1.92475E-4
16-2580737-C-T p.Leu588Leu synonymous AMDHD2 10 80052 1.24919E-4 40026 0 3.65702E-5
16-2580739-G-C p.Leu588Leu synonymous AMDHD2 1 80028 1.24956E-5 40014 0 NA
16-2580742-T-C p.Pro589Pro synonymous AMDHD2 1 80026 1.24959E-5 40013 0 4.87591E-5
16-2580746-C-G p.Gln591Glu missense AMDHD2 1 80028 1.24956E-5 40014 0 NA
16-2580754-C-T p.Leu593Leu synonymous AMDHD2 6 79980 7.50188E-5 39990 0 2.19714E-4
16-2580755-G-C p.Ala594Pro missense AMDHD2 874 79944 0.0109327 39972 2 0.0115339
16-2580755-G-A p.Ala594Thr missense AMDHD2 2 79972 2.50088E-5 39986 0 6.37918E-5
16-2580756-C-T p.Ala594Val missense AMDHD2 1 79962 1.25059E-5 39981 0 8.39391E-6