Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
4-71457995-C-T c.-81C>T 5_prime_UTR_premature_start_codon_gain AMBN 1 81532 1.22651E-5 40766 0 NA
4-71458023-T-G c.-53T>G 5_prime_UTR_premature_start_codon_gain AMBN 1 82968 1.20528E-5 41484 0 NA
4-71458085-T-A p.Ser4Thr missense AMBN 2 83032 2.40871E-5 41516 0 NA
4-71458097-T-C c.15+7T>C splice_region AMBN 1 82970 1.20525E-5 41485 0 8.26323E-6
4-71458098-G-A c.15+8G>A splice_region AMBN 6 82952 7.2331E-5 41476 0 1.91278E-4
4-71459032-ATTATGTT-A c.16-11_16-5delTTATGTT splice_region AMBN 1 81960 1.22011E-5 40980 0 2.07816E-5
4-71459036-T-C c.16-8T>C splice_region AMBN 1 82048 1.2188E-5 41024 0 NA
4-71459038-T-C c.16-6T>C splice_region AMBN 2 82088 2.43641E-5 41044 0 8.31753E-6
4-71459044-AT-A p.Pro7fs frameshift AMBN 2 82212 2.43273E-5 41106 0 5.66636E-5
4-71459049-A-G p.Pro7Pro synonymous AMBN 1 82240 1.21595E-5 41120 0 8.08617E-6
4-71459068-C-T p.Leu14Leu synonymous AMBN 1 82338 1.21451E-5 41169 0 NA
4-71459071-A-T p.Ile15Leu missense AMBN 5 82326 6.07342E-5 41163 0 6.25E-4
4-71459091-G-T p.Leu21Leu synonymous AMBN 1 82230 1.2161E-5 41115 0 NA
4-71459092-G-A p.Glu22Lys missense AMBN 3 82208 3.64928E-5 41104 0 4.39919E-5
4-71459097-G-A p.Met23Ile missense AMBN 1 82164 1.21708E-5 41082 0 NA
4-71459102-T-C p.Phe25Ser missense AMBN 1 82136 1.21749E-5 41068 0 NA
4-71459106-A-G p.Ala26Ala synonymous AMBN 4 82074 4.87365E-5 41037 0 8.31269E-6
4-71459109-G-T p.Val27Val synonymous AMBN 1 82012 1.21933E-5 41006 0 NA
4-71459112-G-A p.Pro28Pro splice_region+synonymous AMBN 4 81964 4.88019E-5 40982 0 3.18512E-5
4-71459115-A-C c.84+3A>C splice_region AMBN 1 81914 1.22079E-5 40957 0 4.00525E-6
4-71459116-A-G c.84+4A>G splice_region AMBN 1 81914 1.22079E-5 40957 0 3.18451E-5
4-71462709-C-T c.85-7C>T splice_region AMBN 1 82650 1.20992E-5 41325 0 1.66279E-5
4-71462710-A-C c.85-6A>C splice_region AMBN 2 82636 2.42025E-5 41318 0 3.32364E-5
4-71462721-T-A p.Phe30Leu missense AMBN 1 82796 1.20779E-5 41398 0 NA
4-71462741-C-G p.Pro37Arg missense AMBN 1 82858 1.20688E-5 41429 0 1.65429E-5
4-71462742-G-A p.Pro37Pro synonymous AMBN 3 82878 3.61978E-5 41439 0 6.36902E-5
4-71462753-G-A p.Ser41Asn missense AMBN 2 82838 2.41435E-5 41419 1 0.0100705
4-71462754-T-A p.Ser41Arg missense AMBN 1 82814 1.20753E-5 41407 0 3.39944E-4
4-71462756-T-C p.Leu42Ser missense AMBN 2 82822 2.41482E-5 41411 0 1.59402E-5
4-71464068-G-T c.136-5G>T splice_region AMBN 2 81466 2.45501E-5 40733 0 3.30464E-5
4-71464074-C-A p.Thr46Lys missense+splice_region AMBN 1 82038 1.21895E-5 41019 0 1.65166E-5
4-71464078-G-A p.Met47Ile missense AMBN 1 82166 1.21705E-5 41083 0 NA
4-71464083-A-C p.Gln49Pro missense AMBN 3 82204 3.64946E-5 41102 0 1.27723E-4
4-71464101-G-A p.Arg55Lys missense AMBN 1 82318 1.2148E-5 41159 0 8.25164E-6
4-71464107-A-G p.Asn57Ser missense AMBN 1 82350 1.21433E-5 41175 0 NA
4-71464108-C-T p.Asn57Asn synonymous AMBN 1 82336 1.21454E-5 41168 0 NA
4-71464127-A-G c.183+7A>G splice_region AMBN 3 82190 3.65008E-5 41095 0 4.26454E-6
4-71465250-T-C c.184-3T>C splice_region AMBN 1 83028 1.20441E-5 41514 0 5.16565E-5
4-71465264-C-T p.Tyr65Tyr synonymous AMBN 3 83084 3.6108E-5 41542 0 2.40406E-5
4-71465265-G-A p.Gly66Ser missense AMBN 1 83080 1.20366E-5 41540 0 3.19918E-5
4-71465266-G-A p.Gly66Asp missense AMBN 1 83096 1.20343E-5 41548 0 3.19122E-5
4-71465271-G-A p.Gly68Arg missense AMBN 25 83124 3.00755E-4 41562 0 2.35759E-4
4-71465275-A-G p.Lys69Arg missense AMBN 1 83118 1.20311E-5 41559 0 NA
4-71465278-C-G p.Ser70* stop_gained AMBN 15 83120 1.80462E-4 41560 0 9.98021E-5
4-71465296-T-G p.Met76Arg missense AMBN 1 83102 1.20334E-5 41551 0 NA
4-71465297-G-T p.Met76Ile missense AMBN 126 83092 0.00151639 41546 0 0.00299726
4-71465300-C-T p.His77His synonymous AMBN 4 83088 4.81417E-5 41544 0 3.98518E-6
4-71465301-G-T p.Gly78Cys missense AMBN 2 83084 2.4072E-5 41542 0 NA
4-71465301-G-A p.Gly78Ser missense AMBN 4 83084 4.8144E-5 41542 0 9.57732E-5
4-71465302-G-T p.Gly78Val missense AMBN 135 83082 0.0016249 41541 0 0.00411431
4-71465315-A-G p.Pro82Pro synonymous AMBN 4 83088 4.81417E-5 41544 0 4.14312E-5
4-71465317-A-C p.His83Pro missense AMBN 1 83088 1.20354E-5 41544 0 NA
4-71465321-C-T p.Ser84Ser synonymous AMBN 1 83074 1.20375E-5 41537 0 NA
4-71465325-C-A p.Leu86Ile missense AMBN 1 83060 1.20395E-5 41530 0 1.65884E-5
4-71465326-T-C p.Leu86Pro missense AMBN 1 83058 1.20398E-5 41529 0 NA
4-71465339-G-T p.Arg90Ser missense AMBN 1 83022 1.2045E-5 41511 0 NA
4-71465340-C-G p.Pro91Ala missense AMBN 2 83006 2.40946E-5 41503 0 NA
4-71465341-C-G p.Pro91Arg missense AMBN 1 83012 1.20465E-5 41506 0 NA
4-71465347-A-AAC p.Glu95fs frameshift AMBN 2 82974 2.41039E-5 41487 0 NA
4-71465350-A-G p.His94Arg missense AMBN 1 82962 1.20537E-5 41481 0 4.00856E-6
4-71465352-G-A p.Glu95Lys missense AMBN 1 82946 1.2056E-5 41473 0 3.19183E-5
4-71465358-C-G p.Gln97Glu missense AMBN 2 82924 2.41185E-5 41462 0 NA
4-71465366-G-A c.294+3G>A splice_region AMBN 2 82868 2.41348E-5 41434 0 1.70579E-4
4-71467134-G-T c.295-1G>T splice_acceptor AMBN 2 82902 2.41249E-5 41451 0 NA
4-71467135-T-C p.Tyr99His missense+splice_region AMBN 3 82906 3.61856E-5 41453 0 8.79859E-5
4-71467145-C-A p.Ser102Tyr missense AMBN 151 82996 0.00181936 41498 0 0.00458657
4-71467147-T-C p.Leu103Leu synonymous AMBN 8 83004 9.63809E-5 41502 0 6.25E-4
4-71467157-A-C p.His106Pro missense AMBN 2 83056 2.40801E-5 41528 0 1.59547E-5
4-71467163-C-T p.Pro108Leu missense AMBN 1 83084 1.2036E-5 41542 0 NA
4-71467168-C-G p.Leu110Val missense AMBN 1 83128 1.20296E-5 41564 0 8.23778E-6
4-71467169-T-C p.Leu110Pro missense AMBN 1 83128 1.20296E-5 41564 0 NA
4-71467172-C-A p.Pro111Gln missense AMBN 1 83148 1.20267E-5 41574 0 3.29478E-5
4-71467173-A-G c.295-7A>G splice_region AMBN 1 83134 1.20288E-5 41567 0 NA
4-71467213-C-G p.Pro125Ala missense AMBN 1 83196 1.20198E-5 41598 0 3.18492E-5
4-71467214-C-A p.Pro125His missense AMBN 1 83192 1.20204E-5 41596 0 1.1544E-4
4-71467225-T-C p.Ser129Pro missense AMBN 2 83194 2.40402E-5 41597 0 3.98007E-6
4-71467242-C-T p.Thr134Thr synonymous AMBN 17 83168 2.04406E-4 41584 0 1.59185E-4
4-71467256-C-A p.Ala139Glu missense AMBN 4 83092 4.81394E-5 41546 0 3.18451E-5
4-71467276-C-T p.Pro146Ser missense AMBN 2 83020 2.40906E-5 41510 0 3.98206E-6
4-71467281-A-G p.Pro147Pro synonymous AMBN 1 83004 1.20476E-5 41502 0 NA
4-71467310-AAGG-A p.Gly158del disruptive_inframe_deletion AMBN 2 82780 2.41604E-5 41390 0 4.12052E-5
4-71467322-C-T p.Pro161Leu missense AMBN 2 82710 2.41809E-5 41355 0 NA
4-71467335-G-A p.Gln165Gln synonymous AMBN 2 82570 2.42219E-5 41285 0 5.77148E-5
4-71467341-G-A p.Val167Val synonymous AMBN 1 82496 1.21218E-5 41248 0 1.19701E-5
4-71467346-C-T p.Pro169Leu missense AMBN 2 82472 2.42507E-5 41236 0 3.18492E-5
4-71467369-G-A p.Glu177Lys missense+splice_region AMBN 1 82082 1.21829E-5 41041 0 6.63207E-5
4-71467376-T-C c.531+5T>C splice_region AMBN 1 81840 1.2219E-5 40920 0 NA
4-71467378-C-G c.531+7C>G splice_region AMBN 1 81780 1.22279E-5 40890 0 NA
4-71468340-G-C c.532-1G>C splice_acceptor AMBN 1 81800 1.22249E-5 40900 0 8.40859E-6
4-71468343-C-A p.Leu178Leu splice_region+synonymous AMBN 2 81898 2.44206E-5 40949 0 NA
4-71468345-CAGG-C p.Gly180del disruptive_inframe_deletion AMBN 7097 81798 0.0867625 40899 389 0.138609
4-71468350-G-A p.Val181Ile missense AMBN 6 81944 7.32207E-5 40972 0 1.69906E-5
4-71468351-T-C p.Val181Ala missense AMBN 20 81974 2.4398E-4 40987 0 8.4788E-4
4-71468353-G-T p.Asp182Tyr missense AMBN 2 82006 2.43885E-5 41003 0 6.33714E-4
4-71468357-T-C p.Phe183Ser missense AMBN 1 82036 1.21898E-5 41018 0 NA
4-71468359-GCTGATCCACAAGGTCCATCAGTAAGTACAGATCTCAATGAGACACTTTCTGTATTTTATTTTTTAATTTTTATTTGTTCACTTTTTTATTTTTATTTGTATTTAACTACTTTGTTCATTTTTTACTGATAATTTTAATATTTATCTACAATATAGCTCCCAGGAATGGATTTTC-G p.Met194_Gly206del conservative_inframe_deletion AMBN 1 82014 1.2193E-5 41007 0 NA
4-71468359-G-C p.Ala184Pro missense AMBN 1 82022 1.21919E-5 41011 0 3.80962E-5
4-71468384-G-C c.570+5G>C splice_region AMBN 1 82408 1.21347E-5 41204 0 NA
4-71468506-AC-A c.571-8delC splice_region AMBN 1 82404 1.21353E-5 41202 0 NA
4-71468514-G-C c.571-1G>C splice_acceptor AMBN 3 82560 3.63372E-5 41280 0 7.54901E-5
4-71468522-G-A p.Gly193Glu missense AMBN 9 82570 1.08998E-4 41285 0 0.00201816
4-71468527-G-T p.Asp195Tyr missense AMBN 1 82628 1.21024E-5 41314 0 NA
4-71468533-C-T p.Pro197Ser missense AMBN 1 82572 1.21106E-5 41286 0 3.21151E-5
4-71468537-A-C p.Asp198Ala missense AMBN 1 82556 1.2113E-5 41278 0 1.82799E-5
4-71468545-G-A p.Gly201Ser missense AMBN 6 82570 7.26656E-5 41285 0 3.45939E-4
4-71468546-G-T p.Gly201Val missense AMBN 1 82614 1.21045E-5 41307 0 NA
4-71468549-C-G p.Pro202Arg missense AMBN 1 82620 1.21036E-5 41310 0 0.00100908
4-71468706-T-G p.Phe209Leu missense AMBN 1 82794 1.20782E-5 41397 0 3.18776E-5
4-71468707-G-A p.Ala210Thr missense AMBN 1 82770 1.20817E-5 41385 0 NA
4-71468710-G-A p.Asp211Asn missense AMBN 1 82746 1.20852E-5 41373 0 NA
4-71468711-A-G p.Asp211Gly missense AMBN 2 82758 2.41668E-5 41379 0 NA
4-71468718-A-G p.Gln213Gln synonymous AMBN 5 82762 6.04142E-5 41381 0 1.66306E-4
4-71468720-G-A p.Gly214Asp missense AMBN 1 82768 1.2082E-5 41384 0 NA
4-71468724-A-G p.Ser215Ser synonymous AMBN 2 82758 2.41668E-5 41379 0 NA
4-71468727-A-G p.Thr216Thr splice_region+synonymous AMBN 1 82780 1.20802E-5 41390 0 3.18593E-5
4-71468981-T-C p.Phe218Ser missense AMBN 1 83086 1.20357E-5 41543 0 6.3678E-5
4-71468985-A-G p.Gln219Gln synonymous AMBN 12995 82718 0.1571 41359 1194 0.169472
4-71468986-A-G p.Ile220Val missense AMBN 1 83100 1.20337E-5 41550 0 1.19651E-5
4-71468993-G-A p.Arg222His missense AMBN 30 83110 3.60967E-4 41555 0 3.2301E-4
4-71469002-C-T p.Ser225Phe missense AMBN 1 83124 1.20302E-5 41562 0 NA
4-71469006-C-T p.His226His synonymous AMBN 1310 83082 0.0157676 41541 11 0.0159319
4-71469007-G-A p.Gly227Arg missense AMBN 4 83118 4.81244E-5 41559 0 NA
4-71469007-G-C p.Gly227Arg missense AMBN 3 83118 3.60933E-5 41559 0 NA
4-71469008-G-T p.Gly227Val missense AMBN 1 83122 1.20305E-5 41561 0 NA
4-71469008-G-A p.Gly227Glu missense AMBN 2 83122 2.4061E-5 41561 0 NA
4-71469014-T-A p.Met229Lys missense AMBN 1 83126 1.20299E-5 41563 0 8.29738E-6
4-71469016-C-T p.Pro230Ser missense AMBN 4 83128 4.81186E-5 41564 0 0.0025
4-71469017-C-A p.Pro230Gln missense AMBN 2 83122 2.4061E-5 41561 0 NA
4-71469018-A-G p.Pro230Pro synonymous AMBN 1 83122 1.20305E-5 41561 0 NA
4-71469029-A-G p.Gln234Arg missense AMBN 1 83094 1.20346E-5 41547 0 8.29518E-6
4-71469034-C-G p.Pro236Ala missense+splice_region AMBN 1 83094 1.20346E-5 41547 0 1.99454E-5
4-71469036-A-T p.Pro236Pro splice_region+synonymous AMBN 1 83096 1.20343E-5 41548 0 3.9895E-6
4-71469037-G-T c.708+1G>T splice_donor AMBN 1 83092 1.20349E-5 41546 0 3.99023E-6
4-71469038-T-C c.708+2T>C splice_donor AMBN 1 83088 1.20354E-5 41544 0 NA
4-71469040-A-G c.708+4A>G splice_region AMBN 1 83092 1.20349E-5 41546 0 3.99058E-6
4-71469040-A-C c.708+4A>C splice_region AMBN 1 83092 1.20349E-5 41546 0 3.99058E-6
4-71469041-G-GT c.708+5_708+6insT splice_region AMBN 6 83092 7.22091E-5 41546 0 6.38937E-5
4-71469128-T-C c.709-5T>C splice_region AMBN 1 82650 1.20992E-5 41325 0 6.36943E-5
4-71469129-T-C c.709-4T>C splice_region AMBN 1 82624 1.2103E-5 41312 0 NA
4-71469137-A-G p.Tyr238Cys missense AMBN 1 82424 1.21324E-5 41212 0 NA
4-71469149-T-C p.Leu242Ser missense AMBN 3 82234 3.64813E-5 41117 0 3.1841E-5
4-71469153-C-T p.Tyr243Tyr synonymous AMBN 4 82084 4.87306E-5 41042 0 0.00101112
4-71469154-G-A p.Val244Met missense AMBN 73 82038 8.89832E-4 41019 2 0.00505561
4-71469157-C-T p.Pro245Ser missense AMBN 1 81884 1.22124E-5 40942 0 3.99265E-5
4-71469166-G-C p.Ala248Pro missense AMBN 1 81716 1.22375E-5 40858 0 NA
4-71469167-C-T p.Ala248Val missense AMBN 89 81728 0.00108898 40864 0 7.78953E-4
4-71469167-C-A p.Ala248Glu missense AMBN 1 81730 1.22354E-5 40865 0 3.18552E-5
4-71469175-T-C p.Leu251Leu splice_region+synonymous AMBN 3 81622 3.67548E-5 40811 0 5.05561E-4
4-71469180-A-G c.753+3A>G splice_region AMBN 22 81490 2.69972E-4 40745 0 1.91046E-4
4-71469185-C-T c.753+8C>T splice_region AMBN 1 81406 1.22841E-5 40703 0 NA
4-71469603-G-A p.Ala255Thr missense AMBN 1 82772 1.20814E-5 41386 0 NA
4-71469604-C-T p.Ala255Val missense AMBN 7234 82550 0.0876317 41275 403 0.139113
4-71469609-C-A p.Leu257Ile missense AMBN 1 82780 1.20802E-5 41390 0 NA
4-71469613-G-A p.Gly258Asp missense AMBN 1 82752 1.20843E-5 41376 0 2.47684E-5
4-71469616-T-A p.Ile259Asn missense AMBN 1 82754 1.2084E-5 41377 0 6.37105E-5
4-71469622-G-C p.Ser261Thr missense AMBN 1 82706 1.2091E-5 41353 0 3.98495E-6
4-71469636-G-T p.Ala266Ser missense+splice_region AMBN 3 82570 3.63328E-5 41285 0 NA
4-71471895-T-C c.799-7T>C splice_region AMBN 1 81808 1.22237E-5 40904 0 8.27609E-6
4-71471900-A-G c.799-2A>G splice_acceptor AMBN 3 81806 3.66721E-5 40903 0 4.0654E-6
4-71471903-G-A p.Gly267Asp missense+splice_region AMBN 1 81852 1.22172E-5 40926 0 NA
4-71471904-C-T p.Gly267Gly splice_region+synonymous AMBN 10 81852 1.22172E-4 40926 0 6.42932E-5
4-71471905-G-A p.Gly268Arg missense AMBN 183 81974 0.00223242 40987 0 0.00263284
4-71471920-A-G p.Met273Val missense AMBN 8 82310 9.71935E-5 41155 0 2.14398E-4
4-71471922-G-T p.Met273Ile missense AMBN 1 82336 1.21454E-5 41168 0 NA
4-71471924-C-T p.Ala274Val missense AMBN 4 82334 4.85826E-5 41167 0 2.39923E-5
4-71471941-C-T p.Pro280Ser missense AMBN 1 82638 1.2101E-5 41319 0 9.56145E-5
4-71471945-G-A p.Gly281Glu missense AMBN 1 82652 1.20989E-5 41326 0 7.98244E-6
4-71471946-A-G p.Gly281Gly synonymous AMBN 1 82664 1.20972E-5 41332 0 NA
4-71471958-G-A p.Met285Ile missense AMBN 1213 82722 0.0146636 41361 50 0.0296199
4-71471961-G-A p.Arg286Arg synonymous AMBN 1 82710 1.20904E-5 41355 0 NA
4-71471962-C-A p.Pro287Thr missense AMBN 3 82698 3.62766E-5 41349 0 8.24416E-6
4-71471964-C-T p.Pro287Pro synonymous AMBN 3 82704 3.62739E-5 41352 0 5.03525E-4
4-71471964-C-A p.Pro287Pro synonymous AMBN 2 82704 2.41826E-5 41352 0 3.18573E-5
4-71471965-G-A p.Gly288Ser missense AMBN 12 82706 1.45092E-4 41353 0 8.16252E-4
4-71471968-T-C p.Phe289Leu missense AMBN 1 82714 1.20899E-5 41357 0 NA
4-71471970-T-C p.Phe289Phe synonymous AMBN 2 82712 2.41803E-5 41356 0 NA
4-71471980-C-T p.Pro293Ser missense AMBN 1 82712 1.20901E-5 41356 0 1.23722E-4
4-71471985-C-A p.His294Gln missense AMBN 629 82720 0.00760397 41360 9 0.016313
4-71471985-C-T p.His294His synonymous AMBN 1 82726 1.20881E-5 41363 0 NA
4-71471987-A-G p.Asn295Ser missense AMBN 1 82720 1.2089E-5 41360 0 1.64946E-5
4-71471995-A-G p.Met298Val missense AMBN 1 82774 1.20811E-5 41387 0 3.18695E-5
4-71472000-C-T p.Gly299Gly synonymous AMBN 68 82714 8.2211E-4 41357 0 0.00130715
4-71472001-G-A p.Gly300Ser missense AMBN 71 82712 8.584E-4 41356 1 0.00108384
4-71472021-T-A p.Phe306Leu missense AMBN 1 82720 1.2089E-5 41360 0 NA
4-71472031-G-T p.Val310Leu missense AMBN 1 82696 1.20925E-5 41348 0 NA
4-71472051-T-C p.Pro316Pro synonymous AMBN 3 82702 3.62748E-5 41351 0 6.25E-4
4-71472053-A-C p.Glu317Ala missense AMBN 50 82694 6.04639E-4 41347 0 0.00130673
4-71472055-A-G p.Asn318Asp missense AMBN 3 82694 3.62783E-5 41347 0 3.18817E-5
4-71472056-A-G p.Asn318Ser missense AMBN 1 82698 1.20922E-5 41349 0 1.19627E-5
4-71472057-C-T p.Asn318Asn synonymous AMBN 4 82696 4.83699E-5 41348 0 0.00125
4-71472057-CGAA-C p.Glu320del disruptive_inframe_deletion AMBN 2 82696 2.4185E-5 41348 0 NA
4-71472058-G-A p.Glu319Lys missense AMBN 1 82696 1.20925E-5 41348 0 2.79229E-5
4-71472059-A-G p.Glu319Gly missense AMBN 1 82702 1.20916E-5 41351 0 3.98807E-6
4-71472068-G-T p.Gly322Val missense AMBN 1 82676 1.20954E-5 41338 0 8.26064E-6
4-71472077-G-T p.Gly325Val missense AMBN 1 82632 1.21018E-5 41316 0 NA
4-71472082-C-G p.Pro327Ala missense AMBN 1 82618 1.21039E-5 41309 0 NA
4-71472086-T-C p.Met328Thr missense AMBN 6 82626 7.26164E-5 41313 0 9.56023E-5
4-71472087-G-C p.Met328Ile missense AMBN 1 82616 1.21042E-5 41308 0 8.27308E-6
4-71472089-C-T p.Pro329Leu missense AMBN 64 82592 7.74893E-4 41296 0 0.00216839
4-71472089-C-A p.Pro329Gln missense AMBN 2 82592 2.42154E-5 41296 0 3.18776E-5
4-71472090-G-A p.Pro329Pro synonymous AMBN 43 82588 5.20657E-4 41294 0 0.00100705
4-71472093-G-A p.Glu330Glu synonymous AMBN 1 82584 1.21089E-5 41292 0 8.27513E-6
4-71472098-A-T p.Asn332Ile missense AMBN 2 82556 2.4226E-5 41278 0 3.99256E-6
4-71472121-G-A p.Ala340Thr missense AMBN 1 82340 1.21448E-5 41170 0 8.28391E-6
4-71472146-C-T p.Ala348Val missense AMBN 8 82186 9.73402E-5 41093 0 NA
4-71472153-C-T p.His350His synonymous AMBN 4 82160 4.86855E-5 41080 0 3.3973E-4
4-71472154-G-A p.Ala351Thr missense AMBN 6 82148 7.30389E-5 41074 0 0.00100705
4-71472156-AG-A p.Leu353fs frameshift AMBN 2 82154 2.43445E-5 41077 0 NA
4-71472157-G-C p.Gly352Arg missense AMBN 2 82154 2.43445E-5 41077 0 NA
4-71472158-G-A p.Gly352Glu missense AMBN 1 82154 1.21723E-5 41077 0 NA
4-71472160-C-A p.Leu353Ile missense AMBN 1 82148 1.21732E-5 41074 0 3.9961E-6
4-71472164-T-C p.Leu354Pro missense AMBN 3523 82066 0.0429289 41033 83 0.0422434
4-71472174-T-C p.Pro357Pro synonymous AMBN 16 82150 1.94766E-4 41075 0 4.1148E-4
4-71472177-G-A p.Lys358Lys synonymous AMBN 126 82162 0.00153356 41081 0 0.00286789
4-71472179-A-T p.Asp359Val missense AMBN 3 82156 3.65159E-5 41078 0 3.99374E-6
4-71472189-C-T p.Pro362Pro synonymous AMBN 2 82150 2.43457E-5 41075 0 6.37267E-5
4-71472190-G-A p.Gly363Ser missense AMBN 3 82140 3.6523E-5 41070 0 0.00100705
4-71472192-C-T p.Gly363Gly synonymous AMBN 2 82112 2.4357E-5 41056 0 8.27404E-6
4-71472193-C-G p.Leu364Val missense AMBN 1 82132 1.21755E-5 41066 0 NA
4-71472198-A-G p.Pro365Pro synonymous AMBN 1 82150 1.21729E-5 41075 0 1.27445E-4
4-71472201-G-C p.Arg366Ser missense AMBN 3 82154 3.65168E-5 41077 0 3.18593E-5
4-71472213-G-A p.Gly370Gly synonymous AMBN 2 82182 2.43362E-5 41091 0 NA
4-71472219-G-A p.Met372Ile missense AMBN 1 82212 1.21637E-5 41106 0 NA
4-71472230-C-T p.Pro376Leu missense AMBN 1 82232 1.21607E-5 41116 0 1.5959E-5
4-71472231-C-A p.Pro376Pro synonymous AMBN 2 82230 2.4322E-5 41115 0 6.37146E-5
4-71472234-C-T p.Ser377Ser synonymous AMBN 31 82208 3.77092E-4 41104 1 4.14171E-4
4-71472235-G-A p.Val378Ile missense AMBN 826 82228 0.0100452 41114 22 0.0207204
4-71472242-C-T p.Pro380Leu missense AMBN 1 82278 1.21539E-5 41139 0 NA
4-71472258-A-G p.Pro385Pro synonymous AMBN 1 82400 1.21359E-5 41200 0 NA
4-71472259-C-T p.Leu386Leu synonymous AMBN 1 82404 1.21353E-5 41202 0 NA
4-71472262-A-G p.Met387Val missense AMBN 21 82412 2.54817E-4 41206 1 9.96476E-5
4-71472263-T-G p.Met387Arg missense AMBN 1 82428 1.21318E-5 41214 0 NA
4-71472275-T-C p.Leu391Ser missense AMBN 53 82480 6.4258E-4 41240 0 6.17614E-4
4-71472284-T-G p.Val394Gly missense AMBN 1 82548 1.21142E-5 41274 0 NA
4-71472292-A-G p.Thr397Ala missense AMBN 1 82522 1.2118E-5 41261 0 NA
4-71472297-C-T p.Tyr398Tyr synonymous AMBN 1 82508 1.212E-5 41254 0 2.473E-5
4-71472298-G-A p.Asp399Asn missense AMBN 8 82506 9.69626E-5 41253 0 3.58511E-5
4-71472298-G-T p.Asp399Tyr missense AMBN 1 82506 1.21203E-5 41253 0 NA
4-71472306-C-T p.Asp401Asp synonymous AMBN 1 82480 1.21242E-5 41240 0 NA
4-71472308-T-C p.Met402Thr missense AMBN 3 82464 3.63795E-5 41232 0 3.18621E-5
4-71472318-C-T p.Ser405Ser synonymous AMBN 1 82420 1.2133E-5 41210 0 4.12303E-5
4-71472319-G-A p.Val406Met missense AMBN 2 82386 2.4276E-5 41193 0 6.37308E-5
4-71472343-A-G p.Met414Val missense AMBN 4 82298 4.86039E-5 41149 0 3.98257E-6
4-71472348-T-C p.Asp415Asp synonymous AMBN 1 82268 1.21554E-5 41134 0 NA
4-71472353-C-T p.Thr417Met missense AMBN 1 82266 1.21557E-5 41133 0 9.09016E-5
4-71472359-C-A p.Ala419Asp missense AMBN 1 82254 1.21575E-5 41127 0 NA
4-71472362-C-T p.Pro420Leu missense AMBN 1 82316 1.21483E-5 41158 0 NA
4-71472364-A-G p.Asn421Asp missense AMBN 2 82328 2.42931E-5 41164 0 8.27349E-6
4-71472365-ACT-A p.Leu423fs frameshift AMBN 2 82330 2.42925E-5 41165 0 8.2739E-6
4-71472382-A-G p.Met427Val missense AMBN 6 82480 7.27449E-5 41240 0 5.03525E-4
4-71472384-G-A p.Met427Ile missense AMBN 2 82456 2.42554E-5 41228 0 3.99674E-6
4-71472384-GCCAGGAAACAAAGC-G p.Asn430fs frameshift AMBN 1 82456 1.21277E-5 41228 0 NA
4-71472387-A-G p.Pro428Pro synonymous AMBN 6 82506 7.2722E-5 41253 0 2.79884E-5
4-71472405-G-T p.Glu434Asp missense AMBN 1 82552 1.21136E-5 41276 0 1.6702E-5
4-71472405-G-A p.Glu434Glu synonymous AMBN 1 82552 1.21136E-5 41276 0 6.37064E-5
4-71472409-G-A p.Glu436Lys missense AMBN 19 82590 2.30052E-4 41295 0 5.73376E-4
4-71472416-TGCATGAC-T p.Asp440fs frameshift AMBN 1 82644 1.21001E-5 41322 0 NA
4-71472419-A-G p.His439Arg missense AMBN 4 82626 4.84109E-5 41313 0 1.68503E-5
4-71472420-T-C p.His439His synonymous AMBN 1 82624 1.2103E-5 41312 0 8.43085E-6
4-71472424-G-A p.Ala441Thr missense AMBN 45 82590 5.4486E-4 41295 0 0.00100705
4-71472424-GCA-ACG p.Ala441Thr missense AMBN 1 82594 1.21074E-5 41297 0 NA
4-71472426-A-G p.Ala441Ala synonymous AMBN 12264 82128 0.149328 41064 1722 0.229881
4-71472427-T-C p.Trp442Arg missense AMBN 2 82596 2.42142E-5 41298 0 8.52588E-6
4-71472442-C-T p.Pro447Ser missense AMBN 1 82534 1.21162E-5 41267 0 8.66386E-6
4-71472445-T-G p.Ter448Glyext*? stop_lost AMBN 1 82558 1.21127E-5 41279 0 NA
4-71472446-G-A p.Ter448Ter stop_retained AMBN 6 82530 7.27008E-5 41265 0 9.55231E-5
4-71472447-A-G p.Ter448Trpext*? stop_lost AMBN 1 82502 1.21209E-5 41251 0 8.71384E-6
4-71473003-A-G c.*556A>G splice_region AMBN 778 43298 0.0179685 21649 22 0.0237352
4-71473005-A-G c.*558A>G splice_region AMBN 16 43302 3.69498E-4 21651 0 2.54842E-4