Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
17-79846011-C-G p.Ser257Thr missense ALYREF 1 81662 1.22456E-5 40831 0 NA
17-79846013-G-C p.Thr256Thr synonymous ALYREF 3 81656 3.67395E-5 40828 0 7.22306E-5
17-79846015-T-C p.Thr256Ala missense ALYREF 1 81632 1.22501E-5 40816 0 3.18776E-5
17-79846021-TCTGAAACACAGAGGAGAAAGAGGCTTGCATTCACAGGCGGCCTGCTCCCCACTGCGGCTTTGACCAGGCCCCCAGCTGGCTCCCCCGGGACTCAC-T c.759+1_760-1delGTGAGTCCCGGGGGAGCCAGCTGGGGGCCTGGTCAAAGCCGCAGTGGGGAGCAGGCCGCCTGTGAATGCAAGCCTCTTTCTCCTCTGTGTTTCAG splice_acceptor ALYREF 13 81670 1.59177E-4 40835 5 NA
17-79846110-G-T c.759+7C>A splice_region ALYREF 29 82686 3.50724E-4 41343 0 0.00108377
17-79846120-C-T p.Ala252Ala synonymous ALYREF 4 82822 4.82963E-5 41411 0 7.52093E-5
17-79846123-A-G p.Asn251Asn synonymous ALYREF 2 82850 2.414E-5 41425 0 8.35855E-6
17-79846132-G-A p.Asp248Asp synonymous ALYREF 2 82890 2.41284E-5 41445 0 6.37674E-5
17-79846135-C-A p.Leu247Leu synonymous ALYREF 1 82914 1.20607E-5 41457 0 NA
17-79846141-G-C p.Ala245Ala synonymous ALYREF 1 82926 1.20589E-5 41463 0 4.02826E-6
17-79846144-A-G p.Asp244Asp synonymous ALYREF 3 82960 3.6162E-5 41480 0 3.18817E-5
17-79846159-C-G p.Ser239Ser synonymous ALYREF 1 82966 1.20531E-5 41483 0 4.04018E-6
17-79846167-G-C p.Gln237Glu missense ALYREF 2 82998 2.4097E-5 41499 0 NA
17-79846168-C-T p.Gln236Gln synonymous ALYREF 1 83006 1.20473E-5 41503 0 1.61787E-5
17-79846186-G-A p.Ala230Ala synonymous ALYREF 4 82994 4.81963E-5 41497 0 6.76121E-5
17-79846198-T-C p.Arg226Arg synonymous ALYREF 9 83038 1.08384E-4 41519 0 9.55475E-5
17-79846205-C-T p.Arg224His missense ALYREF 1 83030 1.20438E-5 41515 0 8.20163E-6
17-79846209-CGCCTCCGCGGGT-C p.Thr219_Gly222del conservative_inframe_deletion ALYREF 7 83004 8.43333E-5 41502 0 4.10401E-5
17-79846210-G-A p.Gly222Gly synonymous ALYREF 9 83002 1.08431E-4 41501 0 3.82336E-4
17-79846212-C-T p.Gly222Ser missense ALYREF 1 83008 1.2047E-5 41504 0 NA
17-79846216-G-A p.Arg220Arg synonymous ALYREF 1892 82996 0.0227963 41498 125 0.0477723
17-79846216-GCGGGTGCCTCTC-G p.Arg217_Arg220del disruptive_inframe_deletion ALYREF 10 83022 1.2045E-4 41511 0 1.15025E-4
17-79846218-G-A p.Arg220Cys missense ALYREF 3 83032 3.61306E-5 41516 0 8.52922E-6
17-79846236-C-T p.Gly214Ser missense ALYREF 1 83054 1.20404E-5 41527 0 NA
17-79846237-T-G p.Gly213Gly synonymous ALYREF 1 83038 1.20427E-5 41519 0 8.54321E-6
17-79846248-C-CAAA p.Phe209dup conservative_inframe_insertion ALYREF 1 83084 1.2036E-5 41542 0 1.65347E-5
17-79846263-C-T p.Gly205Ser missense ALYREF 2 83084 2.4072E-5 41542 0 3.1835E-5
17-79846272-T-C p.Arg202Gly missense ALYREF 3 83094 3.61037E-5 41547 0 1.27389E-4
17-79846273-A-G p.Thr201Thr synonymous ALYREF 1 83086 1.20357E-5 41543 0 NA
17-79846293-C-T p.Val195Ile missense+splice_region ALYREF 6 83038 7.22561E-5 41519 0 3.29104E-5
17-79846294-G-A p.Ser194Ser splice_region+synonymous ALYREF 8 83034 9.63461E-5 41517 0 1.1501E-4
17-79846294-GCTAGCAAGGAAGACGAAACCGTTCACACACCCGGAAGGACCCTAAGAGCGACGCAGCCTCACCCTCGGCCAATCCCCTTCCCCAGAGGCCCCGGAAGTCAC-G c.581+1_582-1del splice_acceptor ALYREF 12 83034 1.44519E-4 41517 4 NA
17-79846299-CA-C c.582-6delT splice_region ALYREF 3 83004 3.61428E-5 41502 0 2.87281E-5
17-79846388-G-T c.581+8C>A splice_region ALYREF 4 82690 4.83734E-5 41345 0 NA
17-79846391-G-A c.581+5C>T splice_region ALYREF 1 82680 1.20948E-5 41340 0 NA
17-79846401-T-A p.Ala192Ala synonymous ALYREF 1 82702 1.20916E-5 41351 0 1.67892E-5
17-79846407-C-T p.Arg190Arg synonymous ALYREF 4 82676 4.83816E-5 41338 0 5.17188E-5
17-79846410-C-T p.Arg189Arg synonymous ALYREF 1 82662 1.20975E-5 41331 0 3.49016E-5
17-79846418-C-T p.Ala187Thr missense ALYREF 10 82664 1.20972E-4 41332 0 5.04032E-4
17-79846418-C-A p.Ala187Ser missense ALYREF 7 82664 8.46801E-5 41332 0 1.27397E-4
17-79846419-G-A p.Asp186Asp synonymous ALYREF 1 82688 1.20937E-5 41344 0 3.18552E-5
17-79846420-T-C p.Asp186Gly missense ALYREF 1 82674 1.20957E-5 41337 0 NA
17-79846424-T-C p.Ile185Val missense ALYREF 2 82668 2.41932E-5 41334 0 NA
17-79846431-C-T p.Thr182Thr synonymous ALYREF 18 82656 2.1777E-4 41328 0 0.00375
17-79846432-G-A p.Thr182Met missense ALYREF 1 82642 1.21004E-5 41321 0 4.55863E-6
17-79846453-G-A p.Pro175Leu missense ALYREF 1 82554 1.21133E-5 41277 0 NA
17-79846460-C-CATCCAGAGGGACGCCGT c.518-2_518-1insACGGCGTCCCTCTGGAT splice_acceptor ALYREF 2 82502 2.42418E-5 41251 1 NA
17-79846460-C-CATCCAGAGGGACGCCGTTGTACTGCTTCATGGCCTTCAGGGCATCTGCCT c.518-2_518-1insAGGCAGATGCCCTGAAGGCCATGAAGCAGTACAACGGCGTCCCTCTGGAT splice_acceptor ALYREF 1 82508 1.212E-5 41254 0 NA
17-79846465-G-A c.518-6C>T splice_region ALYREF 1 82452 1.21283E-5 41226 0 1.45993E-5
17-79846467-A-G c.518-8T>C splice_region ALYREF 1 82440 1.213E-5 41220 0 NA
17-79846746-C-T n.112+6G>A splice_region ALYREF 1 43218 2.31385E-5 21609 0 9.55901E-5
17-79846747-G-A n.112+5C>T splice_region ALYREF 1 42972 2.3271E-5 21486 0 NA
17-79846866-C-CATCCAGAGGGACGCCGT n.353-2_353-1insACGGCGTCCCTCTGGAT splice_acceptor ALYREF 1 56560 1.76803E-5 28280 0 NA
17-79846869-G-T n.353-4C>A splice_region ALYREF 1 57860 1.72831E-5 28930 0 NA
17-79847048-CCA-C c.517+8_517+9delTG splice_region ALYREF 1 82992 1.20494E-5 41496 0 NA
17-79847051-G-A c.517+7C>T splice_region ALYREF 1 83002 1.20479E-5 41501 0 NA
17-79847064-G-A p.Leu171Leu synonymous ALYREF 1 83112 1.2032E-5 41556 0 3.18512E-5
17-79847070-C-T p.Val169Ile missense ALYREF 1 83130 1.20294E-5 41565 0 7.95893E-6
17-79847071-G-A p.Gly168Gly synonymous ALYREF 3 83142 3.60828E-5 41571 0 0.001875
17-79847074-G-A p.Asn167Asn synonymous ALYREF 10 83170 1.20236E-4 41585 0 5.03525E-4
17-79847076-T-G p.Asn167His missense ALYREF 1 83186 1.20213E-5 41593 0 NA
17-79847089-G-A p.Ala162Ala synonymous ALYREF 2 83222 2.40321E-5 41611 0 1.65194E-5
17-79847092-C-T p.Lys161Lys synonymous ALYREF 2 83230 2.40298E-5 41615 0 NA
17-79847111-C-T p.Arg155Gln missense ALYREF 2 83266 2.40194E-5 41633 0 8.2462E-6
17-79847112-G-A p.Arg155Trp missense ALYREF 1 83264 1.201E-5 41632 0 6.3678E-5
17-79847125-G-A p.Asp150Asp synonymous ALYREF 9 83294 1.08051E-4 41647 0 5.03525E-4
17-79847134-T-C p.Gly147Gly synonymous ALYREF 1 83292 1.2006E-5 41646 0 3.18573E-5
17-79847144-C-T p.Arg144His missense ALYREF 1 83300 1.20048E-5 41650 0 NA
17-79847152-G-A p.Arg141Arg synonymous ALYREF 259 83300 0.00310924 41650 2 0.005
17-79847161-G-A p.His138His synonymous ALYREF 5 83308 6.00182E-5 41654 0 0.00375
17-79847167-A-G p.Ala136Ala synonymous ALYREF 4 83308 4.80146E-5 41654 0 2.47207E-5
17-79847170-C-T p.Ala135Ala synonymous ALYREF 3 83302 3.60135E-5 41651 0 9.8881E-5
17-79847171-G-A p.Ala135Val missense ALYREF 1 83298 1.20051E-5 41649 0 1.19298E-5
17-79847182-C-T p.Thr131Thr synonymous ALYREF 1 83278 1.2008E-5 41639 0 3.1841E-5
17-79847208-G-A c.370-3C>T splice_region ALYREF 21 83210 2.52374E-4 41605 0 3.18431E-5
17-79847210-G-C c.370-5C>G splice_region ALYREF 2 83188 2.40419E-5 41594 0 NA
17-79848565-C-T p.Gln123Gln splice_region+synonymous ALYREF 2 82834 2.41447E-5 41417 1 2.38869E-5
17-79848567-G-C p.Gln123Glu missense+splice_region ALYREF 1 82864 1.2068E-5 41432 0 NA
17-79848575-G-A p.Ala120Val missense ALYREF 1 82944 1.20563E-5 41472 0 8.26419E-6
17-79848577-G-C p.Asp119Glu missense ALYREF 1 82952 1.20552E-5 41476 0 3.97937E-6
17-79848583-G-A p.Val117Val synonymous ALYREF 1 83032 1.20435E-5 41516 0 1.65213E-5
17-79848597-G-A p.Leu113Leu synonymous ALYREF 1 83142 1.20276E-5 41571 0 1.65125E-5
17-79848631-G-A p.Gly101Gly synonymous ALYREF 1 83114 1.20317E-5 41557 0 2.47668E-5
17-79848634-G-A p.Ala100Ala synonymous ALYREF 1 83108 1.20325E-5 41554 0 1.19386E-5
17-79848646-G-A p.Phe96Phe synonymous ALYREF 1 83152 1.20262E-5 41576 0 5.03525E-4
17-79848649-G-A p.Gly95Gly synonymous ALYREF 1 83212 1.20175E-5 41606 0 3.30011E-5
17-79848676-C-T p.Lys86Lys synonymous ALYREF 1 83144 1.20273E-5 41572 0 4.95066E-5
17-79848692-T-C p.Lys81Arg missense ALYREF 2 82868 2.41348E-5 41434 1 NA
17-79848698-T-TG c.238-3dupC splice_region ALYREF 1 82730 1.20875E-5 41365 0 1.94868E-4
17-79848699-GA-G c.238-4delT splice_region ALYREF 1 82752 1.20843E-5 41376 0 3.48663E-4
17-79848699-G-GA c.238-4dupT splice_region ALYREF 22 82478 2.66738E-4 41239 0 0.00195592
17-79848699-GAAAA-G c.238-7_238-4delTTTT splice_region ALYREF 10 82752 1.20843E-4 41376 0 3.61161E-5
17-79848700-A-G c.238-4T>C splice_region ALYREF 17 82718 2.05518E-4 41359 0 0.001875
17-79849247-G-C p.Arg63Arg synonymous ALYREF 2 29174 6.85542E-5 14587 0 2.09556E-4
17-79849253-G-T p.Ile61Ile synonymous ALYREF 1 29126 3.43336E-5 14563 0 NA
17-79849273-T-C p.Ile55Val missense ALYREF 14 27618 5.06916E-4 13809 0 0.00202156
17-79849274-G-A p.Pro54Pro synonymous ALYREF 3 27484 1.09154E-4 13742 0 NA
17-79849299-G-C p.Ala46Gly missense ALYREF 1 22564 4.43184E-5 11282 0 4.0833E-5
17-79849317-C-G p.Gly40Ala missense ALYREF 3 23622 1.27E-4 11811 0 NA
17-79849329-C-T p.Gly36Asp missense ALYREF 2 24658 8.11096E-5 12329 0 8.04959E-5
17-79849337-G-A p.Gly33Gly synonymous ALYREF 1 26026 3.84231E-5 13013 0 NA
17-79849339-C-T p.Gly33Ser missense ALYREF 2 26042 7.6799E-5 13021 0 1.60979E-4
17-79849341-G-A p.Ala32Val missense ALYREF 1 26342 3.79622E-5 13171 0 1.20695E-4
17-79849349-GCGGCCC-G p.Gly28_Arg29del disruptive_inframe_deletion ALYREF 1 26518 3.77102E-5 13259 0 NA
17-79849362-C-T p.Gly25Glu missense ALYREF 1 30468 3.28213E-5 15234 0 NA
17-79849367-C-T p.Arg23Arg synonymous ALYREF 1 31304 3.19448E-5 15652 0 NA
17-79849373-G-A p.Gly21Gly synonymous ALYREF 1 32158 3.10965E-5 16079 0 2.84083E-5
17-79849383-C-T p.Ser18Asn missense ALYREF 1 35152 2.84479E-5 17576 0 NA
17-79849396-T-C p.Lys14Glu missense ALYREF 1 38068 2.62688E-5 19034 0 9.44465E-5
17-79849430-G-C p.Ala2Ala synonymous ALYREF 1 39352 2.54117E-5 19676 0 1.26978E-5
17-79849430-G-T p.Ala2Ala synonymous ALYREF 1 39352 2.54117E-5 19676 0 NA
17-79849445-G-C p.Ser4Ser synonymous ALYREF 3 39288 7.63592E-5 19644 0 NA
17-79849448-A-C p.Asp3Glu missense ALYREF 5 39292 1.27252E-4 19646 0 6.25E-4
17-79849451-G-C p.Pro2Pro synonymous ALYREF 1 39310 2.54388E-5 19655 0 NA
17-79849452-G-T p.Pro2His missense ALYREF 7 39338 1.77945E-4 19669 0 6.25E-4
17-79849454-C-T p.Met1? start_lost ALYREF 1 39290 2.54518E-5 19645 0 9.92654E-5
17-79849455-A-G p.Met1? start_lost ALYREF 1 39236 2.54868E-5 19618 0 NA
17-79849458-G-A c.-23C>T 5_prime_UTR_premature_start_codon_gain ALYREF 1 39240 2.54842E-5 19620 0 1.34075E-4