Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
3-46712479-A-C p.Trp953Gly missense ALS2CL 3 82850 3.621E-5 41425 0 3.99418E-6
3-46712484-T-A p.Glu951Val missense ALS2CL 6 82870 7.24026E-5 41435 0 3.18431E-5
3-46712490-G-A p.Ser949Phe missense ALS2CL 1788 82868 0.0215765 41434 20 0.0236657
3-46712494-G-A p.His948Tyr missense ALS2CL 19 82930 2.29109E-4 41465 1 0.001875
3-46712506-G-A p.Pro944Ser missense ALS2CL 2 82960 2.4108E-5 41480 0 2.40265E-5
3-46712511-C-T p.Arg942His missense ALS2CL 4 82954 4.82195E-5 41477 0 3.18552E-5
3-46712512-G-A p.Arg942Cys missense ALS2CL 1 82958 1.20543E-5 41479 0 7.41375E-5
3-46712514-T-C p.His941Arg missense ALS2CL 31 82950 3.73719E-4 41475 1 3.50586E-4
3-46712525-G-A p.Asp937Asp synonymous ALS2CL 1 82972 1.20523E-5 41486 0 6.36943E-5
3-46712526-T-C p.Asp937Gly missense ALS2CL 1 82956 1.20546E-5 41478 0 3.18634E-5
3-46712541-T-C p.His932Arg missense ALS2CL 7 82864 8.44758E-5 41432 0 NA
3-46712546-G-A p.Tyr930Tyr synonymous ALS2CL 6 82834 7.2434E-5 41417 0 6.25E-4
3-46712548-A-G p.Tyr930His missense ALS2CL 18 82842 2.17281E-4 41421 0 1.59266E-4
3-46712978-C-T p.Glu927Glu splice_region+synonymous ALS2CL 1 82504 1.21206E-5 41252 0 NA
3-46712992-G-A p.Leu923Phe missense ALS2CL 1 82780 1.20802E-5 41390 0 8.25409E-6
3-46713001-C-CA p.Asp920fs frameshift ALS2CL 3 82946 3.61681E-5 41473 0 3.18796E-5
3-46713003-T-C p.Tyr919Cys missense ALS2CL 6 82948 7.23345E-5 41474 0 2.38736E-5
3-46713005-C-T p.Leu918Leu synonymous ALS2CL 1 82988 1.20499E-5 41494 0 NA
3-46713025-G-A p.Pro912Ser missense ALS2CL 1 83110 1.20322E-5 41555 0 1.64913E-5
3-46713026-G-A p.Asp911Asp synonymous ALS2CL 1 83110 1.20322E-5 41555 0 NA
3-46713032-C-G p.Met909Ile missense ALS2CL 8 83134 9.62302E-5 41567 0 9.89381E-5
3-46713032-C-T p.Met909Ile missense ALS2CL 1 83134 1.20288E-5 41567 0 6.37918E-5
3-46713039-C-T p.Arg907His missense ALS2CL 2 83144 2.40547E-5 41572 0 1.31253E-4
3-46713040-G-A p.Arg907Cys missense ALS2CL 3 83140 3.60837E-5 41570 0 1.27624E-4
3-46713055-C-T p.Glu902Lys missense ALS2CL 5 83130 6.01468E-5 41565 0 6.25E-4
3-46713073-T-A p.Ile896Phe missense+splice_region ALS2CL 1 83106 1.20328E-5 41553 0 NA
3-46713264-C-G n.284-6G>C splice_region ALS2CL 4 80146 4.99089E-5 40073 0 NA
3-46713371-C-T c.2684+3G>A splice_region ALS2CL 1 82586 1.21086E-5 41293 0 8.3842E-6
3-46713375-G-A p.Arg895* stop_gained ALS2CL 1 82564 1.21118E-5 41282 0 8.37367E-6
3-46713378-C-T p.Ala894Thr missense ALS2CL 6 82538 7.26938E-5 41269 0 1.59459E-4
3-46713379-G-A p.Arg893Arg synonymous ALS2CL 4 82574 4.84414E-5 41287 0 1.25334E-4
3-46713380-C-T p.Arg893His missense ALS2CL 5 82586 6.05429E-5 41293 0 3.1902E-5
3-46713381-G-A p.Arg893Cys missense ALS2CL 8 82580 9.68758E-5 41290 0 0.00125
3-46713382-C-T p.Ser892Ser synonymous ALS2CL 4 82602 4.8425E-5 41301 0 2.33723E-4
3-46713383-G-A p.Ser892Leu missense ALS2CL 90 82582 0.00108983 41291 1 6.29979E-4
3-46713390-C-T p.Val890Met missense ALS2CL 1 82658 1.2098E-5 41329 0 NA
3-46713391-G-A p.Tyr889Tyr synonymous ALS2CL 2 82650 2.41984E-5 41325 0 7.96629E-6
3-46713394-G-C p.Ile888Met missense ALS2CL 1 82660 1.20978E-5 41330 0 NA
3-46713408-G-A p.Leu884Leu synonymous ALS2CL 5 82596 6.05356E-5 41298 0 2.38985E-5
3-46713415-G-A p.Asp881Asp synonymous ALS2CL 942 82416 0.0114298 41208 32 0.0249234
3-46713415-G-C p.Asp881Glu missense ALS2CL 5 82470 6.06281E-5 41235 0 6.38244E-5
3-46713421-G-A p.Pro879Pro synonymous ALS2CL 5 82484 6.06178E-5 41242 0 5.04032E-4
3-46713428-T-G p.Lys877Thr missense ALS2CL 1 82492 1.21224E-5 41246 0 8.26925E-6
3-46713432-A-G p.Tyr876His missense ALS2CL 1 82448 1.21289E-5 41224 0 8.26747E-6
3-46713444-A-G p.Leu872Leu synonymous ALS2CL 2 82434 2.42618E-5 41217 0 6.37918E-5
3-46713457-C-G p.Thr867Thr synonymous ALS2CL 19082 81844 0.233151 40922 2353 0.300604
3-46713457-C-T p.Thr867Thr synonymous ALS2CL 7 82476 8.48732E-5 41238 0 2.55754E-4
3-46713458-G-A p.Thr867Met missense ALS2CL 5 82430 6.06575E-5 41215 0 1.649E-5
3-46713463-C-T p.Glu865Glu synonymous ALS2CL 1 82546 1.21145E-5 41273 0 NA
3-46713474-C-T p.Gly862Arg missense ALS2CL 3 82582 3.63275E-5 41291 0 3.18817E-5
3-46713475-G-A p.Tyr861Tyr synonymous ALS2CL 6 82552 7.26815E-5 41276 0 1.11444E-4
3-46713480-T-C p.Thr860Ala missense ALS2CL 1 82590 1.2108E-5 41295 0 1.64821E-5
3-46713499-C-T p.Lys853Lys synonymous ALS2CL 1 82664 1.20972E-5 41332 0 8.24035E-6
3-46713506-C-T p.Arg851Gln missense ALS2CL 4 82712 4.83606E-5 41356 0 6.37511E-5
3-46713507-G-A p.Arg851Trp missense ALS2CL 2 82698 2.41844E-5 41349 0 9.56938E-5
3-46713507-G-C p.Arg851Gly missense ALS2CL 1 82698 1.20922E-5 41349 0 NA
3-46713513-C-T p.Asp849Asn missense ALS2CL 1 82706 1.2091E-5 41353 0 3.97905E-6
3-46713517-C-T p.Thr847Thr synonymous ALS2CL 4 82682 4.83781E-5 41341 0 3.1904E-5
3-46713518-G-A p.Thr847Met missense ALS2CL 2 82642 2.42008E-5 41321 0 3.58126E-5
3-46713522-TCCTGCAGCAGGGTAGCTGGCTCCAGGTCAAGGCCCTTGGTTCAGTCCCAACCAGGAGCACCCCACACTCTGCCTCCGGACCCCCAACCCACTACGGCTCACACTCA-T p.Met845fs frameshift ALS2CL 7 82650 8.46945E-5 41325 1 NA
3-46713633-A-T p.Ile844Asn missense ALS2CL 24 82992 2.89185E-4 41496 0 1.71053E-4
3-46713639-T-C p.Gln842Arg missense ALS2CL 1 82996 1.20488E-5 41498 0 NA
3-46713644-G-C p.Cys840Trp missense ALS2CL 1 82926 1.20589E-5 41463 0 NA
3-46713650-G-A p.Thr838Thr synonymous ALS2CL 12 82850 1.4484E-4 41425 0 9.54806E-5
3-46713654-G-A p.Ala837Val missense ALS2CL 1 82794 1.20782E-5 41397 0 3.97842E-6
3-46713662-G-A p.Phe834Phe synonymous ALS2CL 1 82702 1.20916E-5 41351 0 NA
3-46713664-A-G p.Phe834Leu missense ALS2CL 1 82668 1.20966E-5 41334 0 NA
3-46713667-A-C p.Cys833Gly missense ALS2CL 9 82586 1.08977E-4 41293 1 3.19489E-5
3-46713680-C-A p.Leu828Leu synonymous ALS2CL 136 82170 0.00165511 41085 0 0.00375
3-46713687-T-C p.Tyr826Cys missense ALS2CL 1 81846 1.22181E-5 40923 0 1.66486E-5
3-46713692-C-T c.2473-1G>A splice_acceptor ALS2CL 1 81592 1.22561E-5 40796 0 NA
3-46713693-T-C c.2473-2A>G splice_acceptor ALS2CL 1 81530 1.22654E-5 40765 0 NA
3-46713694-G-C c.2473-3C>G splice_region ALS2CL 7 81384 8.6012E-5 40692 0 1.00276E-4
3-46713699-G-A c.2473-8C>T splice_region ALS2CL 1 81012 1.23439E-5 40506 0 1.19583E-5
3-46714821-C-G c.2472+8G>C splice_region ALS2CL 24048 79804 0.301338 39902 3798 0.354819
3-46714838-C-T p.Thr821Thr synonymous ALS2CL 4 81198 4.92623E-5 40599 0 7.81983E-5
3-46714839-G-A p.Thr821Met missense ALS2CL 2 81202 2.46299E-5 40601 0 3.3775E-5
3-46714844-C-T p.Thr819Thr synonymous ALS2CL 12 81220 1.47747E-4 40610 0 6.25E-4
3-46714850-G-C p.Asp817Glu missense ALS2CL 1 81238 1.23095E-5 40619 0 NA
3-46714859-G-A p.Pro814Pro synonymous ALS2CL 2 81208 2.46281E-5 40604 0 3.18492E-5
3-46714861-G-A p.Pro814Ser missense ALS2CL 3 81178 3.69558E-5 40589 0 4.02156E-5
3-46714878-T-C c.2430-7A>G splice_region ALS2CL 30 80990 3.70416E-4 40495 0 7.00222E-4
3-46716049-G-A c.2429+7C>T splice_region ALS2CL 2 82500 2.42424E-5 41250 0 3.18654E-5
3-46716060-G-C p.Gln809Glu missense ALS2CL 1 82696 1.20925E-5 41348 0 NA
3-46716066-C-T p.Asp807Asn missense ALS2CL 4 82764 4.83302E-5 41382 0 6.37308E-5
3-46716081-G-T p.Leu802Met missense ALS2CL 1 82948 1.20557E-5 41474 0 NA
3-46716088-A-G p.Asp799Asp synonymous ALS2CL 1 82988 1.20499E-5 41494 0 3.18613E-5
3-46716117-C-T p.Gly790Ser missense ALS2CL 2 83044 2.40836E-5 41522 0 6.25E-4
3-46716120-G-C p.Gln789Glu missense ALS2CL 2 83050 2.40819E-5 41525 0 5.03525E-4
3-46716140-C-T p.Arg782Gln missense ALS2CL 3 83036 3.61289E-5 41518 0 2.47476E-5
3-46716141-G-A p.Arg782Trp missense ALS2CL 1 83046 1.20415E-5 41523 0 6.37227E-5
3-46716142-C-T p.Glu781Glu synonymous ALS2CL 3 83054 3.61211E-5 41527 0 6.36902E-5
3-46716146-T-C p.His780Arg missense ALS2CL 1 83050 1.20409E-5 41525 0 8.2496E-6
3-46716153-G-A p.Leu778Leu synonymous ALS2CL 1 83054 1.20404E-5 41527 0 6.36983E-5
3-46716154-C-T p.Leu777Leu synonymous ALS2CL 2 83050 2.40819E-5 41525 0 3.18512E-5
3-46716163-C-T p.Thr774Thr synonymous ALS2CL 13 83010 1.56608E-4 41505 0 1.27405E-4
3-46716164-G-A p.Thr774Met missense ALS2CL 14 83014 1.68646E-4 41507 0 6.25E-4
3-46716174-C-T p.Glu771Lys missense ALS2CL 1 82972 1.20523E-5 41486 0 2.48381E-5
3-46716178-G-T p.Tyr769* stop_gained ALS2CL 2 82926 2.41179E-5 41463 0 NA
3-46716189-G-A p.Pro766Ser missense ALS2CL 8 82808 9.6609E-5 41404 0 1.99416E-5
3-46716196-G-A p.Leu763Leu synonymous ALS2CL 2 82722 2.41774E-5 41361 0 8.47386E-6
3-46716201-G-A p.Pro762Ser missense ALS2CL 1 82668 1.20966E-5 41334 0 1.71031E-5
3-46716230-C-G c.2256-1G>C splice_acceptor ALS2CL 1 81990 1.21966E-5 40995 0 3.87777E-5
3-46716230-C-T c.2256-1G>A splice_acceptor ALS2CL 2 81990 2.43932E-5 40995 0 NA
3-46716234-TG-T c.2256-6delC splice_region ALS2CL 1 81852 1.22172E-5 40926 0 NA
3-46716237-G-A c.2256-8C>T splice_region ALS2CL 1 81760 1.22309E-5 40880 0 4.22955E-6
3-46717102-A-C c.2255+6T>G splice_region ALS2CL 1 82808 1.20761E-5 41404 0 1.59316E-5
3-46717111-G-T p.Thr751Lys missense ALS2CL 3 82842 3.62135E-5 41421 0 3.18512E-5
3-46717117-G-C p.Thr749Arg missense ALS2CL 28 82844 3.37985E-4 41422 0 0.00100705
3-46717128-C-T p.Glu745Glu synonymous ALS2CL 2 82836 2.41441E-5 41418 0 6.37227E-5
3-46717130-C-T p.Glu745Lys missense ALS2CL 1 82858 1.20688E-5 41429 0 3.98051E-6
3-46717150-C-T p.Arg738His missense ALS2CL 8 82754 9.66721E-5 41377 0 9.56145E-5
3-46717151-G-A p.Arg738Cys missense ALS2CL 4 82762 4.83314E-5 41381 0 6.25E-4
3-46717156-A-C p.Leu736* stop_gained ALS2CL 3 82772 3.62441E-5 41386 0 8.25437E-6
3-46717158-G-A p.Ala735Ala synonymous ALS2CL 1 82766 1.20823E-5 41383 0 NA
3-46717165-C-T p.Arg733Gln missense ALS2CL 13 82706 1.57183E-4 41353 0 1.27437E-4
3-46717174-C-A p.Gly730Val missense+splice_region ALS2CL 2 82656 2.41967E-5 41328 0 3.30355E-5
3-46717175-C-T p.Gly730Ser missense+splice_region ALS2CL 635 82620 0.00768579 41310 2 0.00802802
3-46717181-G-A c.2187-5C>T splice_region ALS2CL 1 82614 1.21045E-5 41307 0 NA
3-46717181-GA-G c.2187-6delT splice_region ALS2CL 1 82614 1.21045E-5 41307 0 3.18674E-5
3-46717727-G-A c.2186+8C>T splice_region ALS2CL 2 81274 2.46081E-5 40637 0 3.3071E-5
3-46717749-G-T p.Leu724Leu synonymous ALS2CL 1 81828 1.22208E-5 40914 0 NA
3-46717755-C-T p.Gln722Gln synonymous ALS2CL 1 81946 1.22032E-5 40973 0 NA
3-46717757-G-A p.Gln722* stop_gained ALS2CL 1 81998 1.21954E-5 40999 0 8.25587E-6
3-46717764-C-T p.Gln719Gln synonymous ALS2CL 4 82074 4.87365E-5 41037 0 3.18776E-5
3-46717783-G-A p.Ala713Val missense ALS2CL 1 82352 1.2143E-5 41176 0 NA
3-46717790-C-T p.Glu711Lys missense ALS2CL 2 82546 2.42289E-5 41273 0 0.0010101
3-46717791-C-T p.Gln710Gln synonymous ALS2CL 3 82548 3.63425E-5 41274 0 3.18735E-5
3-46717797-G-A p.His708His synonymous ALS2CL 1 82656 1.20983E-5 41328 0 NA
3-46717803-G-T p.Asn706Lys missense ALS2CL 1 82716 1.20896E-5 41358 0 0.00100806
3-46717808-C-T p.Ala705Thr missense ALS2CL 3 82780 3.62406E-5 41390 0 NA
3-46717808-C-A p.Ala705Ser missense ALS2CL 1 82780 1.20802E-5 41390 0 NA
3-46717811-C-T p.Gly704Arg missense ALS2CL 5 82802 6.0385E-5 41401 0 6.25E-4
3-46717812-G-A p.Val703Val synonymous ALS2CL 3 82846 3.62118E-5 41423 0 8.24484E-6
3-46717820-C-T p.Ala701Thr missense ALS2CL 5 82916 6.0302E-5 41458 0 0.003125
3-46717821-G-A p.Tyr700Tyr synonymous ALS2CL 4 82924 4.82369E-5 41462 0 3.18837E-5
3-46717849-G-A p.Thr691Ile missense ALS2CL 1 83056 1.20401E-5 41528 0 8.24226E-6
3-46717852-C-T p.Arg690Gln missense ALS2CL 3 83030 3.61315E-5 41515 0 6.37511E-5
3-46717853-G-A p.Arg690Trp missense ALS2CL 1 83038 1.20427E-5 41519 0 6.25E-4
3-46717865-C-T p.Gly686Arg missense ALS2CL 3 83014 3.61385E-5 41507 0 3.18878E-5
3-46717868-G-A p.Leu685Leu synonymous ALS2CL 2 82998 2.4097E-5 41499 0 5.03525E-4
3-46717869-G-A p.Pro684Pro synonymous ALS2CL 3 82990 3.61489E-5 41495 0 3.18898E-5
3-46717869-G-T p.Pro684Pro synonymous ALS2CL 3 82990 3.61489E-5 41495 0 3.18898E-5
3-46717870-G-A p.Pro684Leu missense ALS2CL 2 82976 2.41034E-5 41488 0 3.97864E-6
3-46717872-G-C p.His683Gln missense ALS2CL 4 82978 4.82055E-5 41489 0 NA
3-46717883-T-G p.Asn680His missense ALS2CL 3 82914 3.61821E-5 41457 0 8.24538E-5
3-46717884-G-A p.Ser679Ser synonymous ALS2CL 4 82914 4.82428E-5 41457 0 3.19E-5
3-46717897-G-A c.2029-5C>T splice_region ALS2CL 24 82752 2.90023E-4 41376 0 3.18959E-4
3-46718125-C-A c.2028+7G>T splice_region ALS2CL 2 82374 2.42795E-5 41187 0 NA
3-46718126-T-C c.2028+6A>G splice_region ALS2CL 1 82392 1.21371E-5 41196 0 1.42831E-4
3-46718154-G-A p.Ala669Val missense ALS2CL 1 82666 1.20969E-5 41333 0 9.58589E-5
3-46718155-C-T p.Ala669Thr missense ALS2CL 1 82670 1.20963E-5 41335 0 NA
3-46718157-T-C p.Lys668Arg missense ALS2CL 2 82688 2.41873E-5 41344 0 3.19591E-5
3-46718158-T-G p.Lys668Gln missense ALS2CL 1 82700 1.20919E-5 41350 0 NA
3-46718158-T-C p.Lys668Glu missense ALS2CL 1 82700 1.20919E-5 41350 0 8.28967E-6
3-46718160-GGCTCCCGGT-G p.His664_Glu666del disruptive_inframe_deletion ALS2CL 4 82694 4.83711E-5 41347 0 1.19516E-5
3-46718169-T-C p.His664Arg missense ALS2CL 1 82748 1.20849E-5 41374 0 3.98241E-6
3-46718172-T-A p.Gln663Leu missense ALS2CL 1 82780 1.20802E-5 41390 0 3.98226E-6
3-46718177-C-T p.Leu661Leu synonymous ALS2CL 2 82806 2.41528E-5 41403 0 9.58405E-5
3-46718192-G-A p.Asp656Asp synonymous ALS2CL 1 82782 1.20799E-5 41391 0 8.26979E-6
3-46718197-C-T p.Glu655Lys missense ALS2CL 2 82800 2.41546E-5 41400 0 3.98286E-6
3-46718204-G-A p.Gly652Gly synonymous ALS2CL 1 82736 1.20866E-5 41368 0 NA
3-46718205-C-T p.Gly652Asp missense ALS2CL 1 82760 1.20831E-5 41380 0 3.98508E-6
3-46718209-C-T p.Val651Met missense ALS2CL 1 82744 1.20855E-5 41372 0 3.98568E-6
3-46718210-A-G p.Ser650Ser synonymous ALS2CL 1 82724 1.20884E-5 41362 0 1.99292E-5
3-46718217-T-TGAGGA p.Glu648fs frameshift ALS2CL 1 82634 1.21016E-5 41317 0 NA
3-46718225-G-T p.Thr645Thr synonymous ALS2CL 3 82648 3.62985E-5 41324 0 3.30759E-5
3-46718227-TCCTGGGCACCACACACAGCATCCCTCACCCACACCTCGGCCCAGCCCCCTCCCCCCAGGAAGCCCTCCCCAGCCCACCCTAACCTGTGCATGCTCACACAGCCGGCCTCA-T p.Thr645fs frameshift ALS2CL 7 82622 8.47232E-5 41311 0 NA
3-46718236-C-T c.1932-8G>A splice_region ALS2CL 1 82600 1.21065E-5 41300 0 8.27404E-6
3-46718331-G-A c.1931+8C>T splice_region ALS2CL 30 82348 3.64308E-4 41174 0 0.00157071
3-46718333-C-A c.1931+6G>T splice_region ALS2CL 11 82396 1.33502E-4 41198 0 0.00125
3-46718336-C-T c.1931+3G>A splice_region ALS2CL 3 82496 3.63654E-5 41248 0 2.39462E-5
3-46718343-C-T p.Glu643Lys missense ALS2CL 8 82604 9.68476E-5 41302 0 3.1957E-5
3-46718344-G-A p.Cys642Cys synonymous ALS2CL 150 82584 0.00181633 41292 0 0.00805639
3-46718357-T-C p.Asp638Gly missense ALS2CL 1 82854 1.20694E-5 41427 0 NA
3-46718369-C-T p.Arg634His missense ALS2CL 3 82930 3.61751E-5 41465 0 6.38244E-5
3-46718370-G-A p.Arg634Cys missense ALS2CL 54 82922 6.51214E-4 41461 0 0.00151057
3-46718370-G-C p.Arg634Gly missense ALS2CL 1 82922 1.20595E-5 41461 0 NA
3-46718376-C-T p.Glu632Lys missense ALS2CL 2 82958 2.41086E-5 41479 0 8.26638E-6
3-46718379-T-C p.Arg631Gly missense ALS2CL 1 82964 1.20534E-5 41482 0 8.26679E-6
3-46718380-G-A p.Ser630Ser synonymous ALS2CL 7 82958 8.438E-5 41479 0 4.13353E-5
3-46718385-T-C p.Ser629Gly missense ALS2CL 1 82974 1.2052E-5 41487 0 3.9834E-6
3-46718391-C-A p.Val627Leu missense ALS2CL 7 82986 8.43516E-5 41493 0 6.61879E-5
3-46718392-G-A c.-82C>T 5_prime_UTR_premature_start_codon_gain ALS2CL 3 82984 3.61515E-5 41492 0 9.56633E-5
3-46718392-G-T p.Asp626Glu missense ALS2CL 1 82984 1.20505E-5 41492 0 NA
3-46718394-C-T p.Asp626Asn missense ALS2CL 4 83002 4.81916E-5 41501 0 4.78141E-5
3-46718395-G-A c.-85C>T 5_prime_UTR_premature_start_codon_gain ALS2CL 1 82996 1.20488E-5 41498 0 6.38121E-5
3-46718402-A-AGCAGGGCCTCCT p.Gln619_Leu622dup conservative_inframe_insertion ALS2CL 1 82996 1.20488E-5 41498 0 NA
3-46718404-C-A p.Leu622Leu synonymous ALS2CL 1 83004 1.20476E-5 41502 0 1.65623E-5
3-46718423-C-T p.Arg616Lys missense ALS2CL 3 82954 3.61646E-5 41477 0 NA
3-46718425-G-A p.Pro615Pro synonymous ALS2CL 47 82966 5.66497E-4 41483 0 0.00140172
3-46718433-C-T p.Gly613Ser missense ALS2CL 1 82978 1.20514E-5 41489 0 8.29958E-6
3-46718438-C-T p.Cys611Tyr missense ALS2CL 1 82978 1.20514E-5 41489 0 NA
3-46718440-C-T c.-130G>A 5_prime_UTR_premature_start_codon_gain ALS2CL 8 82976 9.64134E-5 41488 0 6.37024E-5
3-46718450-C-T p.Arg607Gln missense ALS2CL 6 82880 7.23938E-5 41440 0 3.33639E-5
3-46718451-G-A p.Arg607Trp missense ALS2CL 21 82890 2.53348E-4 41445 0 6.37227E-4
3-46718457-G-T p.Pro605Thr missense ALS2CL 1 82920 1.20598E-5 41460 0 8.00384E-6
3-46718458-G-A p.Ser604Ser synonymous ALS2CL 1 82918 1.20601E-5 41459 0 8.37198E-6
3-46718467-T-G p.Gly601Gly synonymous ALS2CL 1 82864 1.2068E-5 41432 0 NA
3-46718477-C-T p.Arg598His missense ALS2CL 1 82836 1.2072E-5 41418 0 3.18776E-5
3-46718478-G-A p.Arg598Cys missense ALS2CL 4 82828 4.82928E-5 41414 0 1.36544E-4
3-46718488-G-A c.-178C>T 5_prime_UTR_premature_start_codon_gain ALS2CL 3 82768 3.62459E-5 41384 0 0.00125156
3-46718489-G-T p.Pro594His missense ALS2CL 1 82766 1.20823E-5 41383 0 NA
3-46718498-C-T p.Gly591Asp missense ALS2CL 3 82582 3.63275E-5 41291 0 NA
3-46718498-C-A p.Gly591Val missense ALS2CL 1 82586 1.21086E-5 41293 0 NA
3-46718502-C-T p.Val590Met missense ALS2CL 1 82478 1.21244E-5 41239 0 4.37997E-5
3-46718503-G-A p.Gly589Gly synonymous ALS2CL 16 82426 1.94114E-4 41213 0 0.00375469
3-46718513-C-T c.1758-1G>A splice_acceptor ALS2CL 1 82176 1.2169E-5 41088 0 NA
3-46718514-T-TCTTGCAGGTACTGCTCGGGTCTGGTGGGAGGGCAGCCGTGTCCA c.1758-3_1758-2insTGGACACGGCTGCCCTCCCACCAGACCCGAGCAGTACCTGCAAG splice_region ALS2CL 2 82140 2.43487E-5 41070 0 NA
3-46718515-G-T c.1758-3C>A splice_region ALS2CL 1 82108 1.21791E-5 41054 0 NA
3-46718516-C-T c.1758-4G>A splice_region ALS2CL 426 81954 0.00519804 40977 0 0.00938673
3-46718517-G-A c.1758-5C>T splice_region ALS2CL 11 82012 1.34127E-4 41006 0 2.23058E-4
3-46718519-T-A c.1758-7A>T splice_region ALS2CL 1 81908 1.22088E-5 40954 0 NA
3-46718662-G-C c.-203+8C>G splice_region ALS2CL 12 46976 2.5545E-4 23488 0 6.37471E-5
3-46718669-C-T c.-203+1G>A splice_donor ALS2CL 9 45522 1.97707E-4 22761 0 1.9118E-4
3-46718676-G-A c.-209C>T 5_prime_UTR_premature_start_codon_gain ALS2CL 1 43894 2.27822E-5 21947 0 NA
3-46718728-G-A c.-261C>T 5_prime_UTR_premature_start_codon_gain ALS2CL 2 35824 5.58285E-5 17912 0 6.3743E-5
3-46718766-G-A c.-299C>T 5_prime_UTR_premature_start_codon_gain ALS2CL 2 33872 5.90458E-5 16936 0 NA
3-46718825-G-C c.-358C>G 5_prime_UTR_premature_start_codon_gain ALS2CL 1 32678 3.06016E-5 16339 0 3.18837E-5
3-46718879-C-A n.61+6G>T splice_region ALS2CL 1 28916 3.45829E-5 14458 0 3.18593E-5
3-46719745-TCA-T c.1757+2_1757+3delTG splice_donor ALS2CL 1 81898 1.22103E-5 40949 0 5.02841E-5
3-46719758-G-A p.Thr583Ile missense ALS2CL 2 82364 2.42825E-5 41182 0 6.37389E-5
3-46719764-C-A p.Ser581Ile missense ALS2CL 1 82446 1.21292E-5 41223 0 NA
3-46719764-C-T p.Ser581Asn missense ALS2CL 1 82446 1.21292E-5 41223 0 4.05453E-6
3-46719766-C-T p.Pro580Pro synonymous ALS2CL 1033 82380 0.0125395 41190 40 0.0281924
3-46719767-G-A p.Pro580Leu missense ALS2CL 2 82476 2.42495E-5 41238 0 3.18756E-5
3-46719774-G-C p.Pro578Ala missense ALS2CL 2 82578 2.42195E-5 41289 0 6.37511E-5
3-46719786-C-A p.Ala574Ser missense ALS2CL 2 82612 2.42096E-5 41306 0 NA
3-46719788-G-A p.Thr573Met missense ALS2CL 3 82650 3.62976E-5 41325 0 5.13417E-5
3-46719799-AC-A p.Gly569fs frameshift ALS2CL 5 82752 6.04215E-5 41376 0 3.18939E-5
3-46719801-C-T p.Gly569Ser missense ALS2CL 4 82784 4.83185E-5 41392 0 1.18291E-4
3-46719805-T-G p.Thr567Thr synonymous ALS2CL 12 82784 1.44956E-4 41392 0 0.00100908
3-46719806-G-A p.Thr567Ile missense ALS2CL 2 82790 2.41575E-5 41395 0 1.68461E-5
3-46719808-G-A p.His566His synonymous ALS2CL 3 82790 3.62363E-5 41395 0 6.37105E-5
3-46719820-C-T p.Gly562Gly synonymous ALS2CL 1 82850 1.207E-5 41425 0 NA
3-46719824-G-C p.Ala561Gly missense ALS2CL 1 82874 1.20665E-5 41437 0 NA
3-46719824-G-A p.Ala561Val missense ALS2CL 2 82874 2.4133E-5 41437 0 8.36792E-6
3-46719834-C-T p.Gly558Ser missense ALS2CL 1 82906 1.20619E-5 41453 0 1.1956E-5
3-46719835-G-A p.Phe557Phe synonymous ALS2CL 3 82898 3.61891E-5 41449 0 1.66839E-5
3-46719838-C-T p.Ser556Ser synonymous ALS2CL 2 82892 2.41278E-5 41446 0 NA
3-46719839-G-A p.Ser556Leu missense ALS2CL 7 82900 8.44391E-5 41450 0 2.74982E-4
3-46719858-C-T p.Gly550Ser missense ALS2CL 4 82900 4.82509E-5 41450 0 NA
3-46719860-T-C p.Asn549Ser missense ALS2CL 98 82896 0.0011822 41448 1 0.00100705
3-46719861-T-C p.Asn549Asp missense ALS2CL 1 82912 1.2061E-5 41456 0 3.18857E-5
3-46720692-G-A c.1626+8C>T splice_region ALS2CL 1 80818 1.23735E-5 40409 0 6.37796E-5
3-46720698-A-C c.1626+2T>G splice_donor ALS2CL 2 80894 2.47237E-5 40447 0 5.89011E-6
3-46720699-C-T c.1626+1G>A splice_donor ALS2CL 1 80964 1.23512E-5 40482 0 NA
3-46720709-G-A p.Leu539Leu synonymous ALS2CL 1 81028 1.23414E-5 40514 0 4.11353E-5
3-46720718-G-T p.Asp536Glu missense ALS2CL 4 81058 4.93474E-5 40529 0 3.18796E-5
3-46720718-G-A p.Thr535Ile missense ALS2CL 5 81058 6.16842E-5 40529 0 1.91278E-4
3-46720725-G-A p.Thr534Ile missense ALS2CL 1 81066 1.23356E-5 40533 0 NA
3-46720733-G-A p.Ala530Val missense ALS2CL 4 81046 4.93547E-5 40523 0 6.71051E-5
3-46720736-C-T p.Arg529Lys missense ALS2CL 44 81042 5.42928E-4 40521 0 0.00146712
3-46720737-T-A p.Glu530Val missense ALS2CL 1 81002 1.23454E-5 40501 0 NA
3-46720746-G-A p.Ser527Phe missense ALS2CL 1 80998 1.2346E-5 40499 0 NA
3-46720750-C-G p.Asp526His missense ALS2CL 3 80946 3.70617E-5 40473 0 1.43557E-5
3-46720772-C-T p.Arg517Gln missense ALS2CL 2 80616 2.4809E-5 40308 0 0.0010142
3-46720773-G-T p.Pro518Gln missense ALS2CL 1 80626 1.24029E-5 40313 0 NA
3-46720774-G-A p.Pro518Ser missense ALS2CL 1 80610 1.24054E-5 40305 0 NA
3-46720777-C-T p.Trp515* stop_gained ALS2CL 2 80530 2.48355E-5 40265 0 5.8572E-5
3-46720778-C-T c.1549-1G>A splice_acceptor ALS2CL 1 80534 1.24171E-5 40267 0 NA
3-46721913-C-T c.1548+7G>A splice_region ALS2CL 1 82470 1.21256E-5 41235 0 3.18512E-5
3-46721919-C-T c.1548+1G>A splice_donor ALS2CL 1 82692 1.20931E-5 41346 0 4.00035E-6
3-46721921-A-G p.Val516Ala missense+splice_region ALS2CL 1 82754 1.2084E-5 41377 0 NA
3-46721924-G-A p.Thr515Met missense ALS2CL 3 82882 3.6196E-5 41441 0 3.99584E-5
3-46721931-C-G p.Asp513His missense ALS2CL 1 82970 1.20525E-5 41485 0 NA
3-46721932-C-T p.Arg511Gln missense ALS2CL 2 82982 2.41016E-5 41491 0 0.00101317
3-46721933-G-A p.Ala512Val missense ALS2CL 2 83008 2.40941E-5 41504 0 6.36943E-5
3-46721942-G-A p.Thr509Ile missense ALS2CL 1 83124 1.20302E-5 41562 0 8.27116E-6
3-46721943-T-C p.Thr509Ala missense ALS2CL 1 83110 1.20322E-5 41555 0 7.9811E-6
3-46721944-G-A p.Ala507Val missense ALS2CL 5 83142 6.01381E-5 41571 0 3.18552E-5
3-46721960-C-A p.Gly503Val missense ALS2CL 5 83182 6.01092E-5 41591 0 3.98889E-6
3-46721980-C-A p.Gly495Val missense ALS2CL 1 83160 1.2025E-5 41580 0 3.99147E-6
3-46721988-C-T p.Gly494Ser missense ALS2CL 20 83098 2.4068E-4 41549 0 1.9118E-4
3-46721988-C-A p.Gly494Cys missense ALS2CL 1 83098 1.2034E-5 41549 0 7.99341E-6
3-46721989-G-A p.Thr492Met missense ALS2CL 20 83106 2.40657E-4 41553 0 5.73541E-4
3-46721993-C-T p.Arg492His missense ALS2CL 1 83038 1.20427E-5 41519 0 NA
3-46721994-G-A p.Arg492Cys missense ALS2CL 2 83024 2.40894E-5 41512 0 4.00026E-5
3-46721996-T-C p.Gln491Arg missense ALS2CL 1 83038 1.20427E-5 41519 0 NA
3-46722011-A-G p.Met486Thr missense ALS2CL 1 83082 1.20363E-5 41541 0 NA
3-46722012-T-C p.Met486Val missense ALS2CL 1 83074 1.20375E-5 41537 0 NA
3-46722023-C-T p.Arg482His missense ALS2CL 28 82958 3.3752E-4 41479 0 6.25E-4
3-46722024-G-A p.Arg482Cys missense ALS2CL 1 82916 1.20604E-5 41458 0 2.8107E-5
3-46722027-C-T p.Glu481Lys missense ALS2CL 1 82898 1.2063E-5 41449 0 NA
3-46722034-G-GTCACCATCCTCCTCAATGCCATAGCCGCTCCTCT c.1437-4_1437-3insAGAGGAGCGGCTATGGCATTGAGGAGGATGGTGA splice_region ALS2CL 1 82790 1.20788E-5 41395 0 NA
3-46722577-A-T p.Ter524Argext*? stop_lost ALS2CL 2 74936 2.66894E-5 37468 0 NA
3-46722582-G-C p.Ser522* stop_gained ALS2CL 1 75526 1.32405E-5 37763 0 NA
3-46722584-G-T p.Gly521Gly synonymous ALS2CL 1 75622 1.32237E-5 37811 0 NA
3-46722589-C-T p.Gly520Arg missense ALS2CL 1 75950 1.31666E-5 37975 0 2.19081E-5
3-46722590-G-A p.Cys519Cys synonymous ALS2CL 2 76000 2.63158E-5 38000 0 4.01357E-5
3-46722591-C-T p.Cys519Tyr missense ALS2CL 1 76192 1.31247E-5 38096 0 NA
3-46722598-C-T p.Gly517Ser missense ALS2CL 12 76836 1.56177E-4 38418 0 1.27632E-4
3-46722599-G-A p.Leu516Leu synonymous ALS2CL 3 77024 3.89489E-5 38512 0 3.1904E-5
3-46722599-G-C p.Leu516Leu synonymous ALS2CL 1 77024 1.2983E-5 38512 0 NA
3-46722605-C-T p.Gln514Gln synonymous ALS2CL 1 77518 1.29002E-5 38759 0 3.18959E-5
3-46722607-G-A p.Gln514* stop_gained ALS2CL 1 77746 1.28624E-5 38873 0 NA
3-46722609-A-G p.Leu513Pro missense ALS2CL 1 77842 1.28465E-5 38921 0 NA
3-46722610-G-A p.Leu513Phe missense ALS2CL 1 77948 1.28291E-5 38974 0 4.22629E-6
3-46722611-G-A p.Pro512Pro synonymous ALS2CL 4 77996 5.12847E-5 38998 0 6.37918E-5
3-46722611-G-C p.Pro512Pro synonymous ALS2CL 1 77996 1.28212E-5 38998 0 NA
3-46722622-G-A p.Pro509Ser missense ALS2CL 1 78766 1.26958E-5 39383 0 NA
3-46722623-G-T p.Ser508Arg missense ALS2CL 1 78926 1.26701E-5 39463 0 NA
3-46722633-G-A p.Ser505Phe missense ALS2CL 1 79768 1.25364E-5 39884 0 6.25E-4
3-46722634-A-G p.Ser505Pro missense ALS2CL 1 79782 1.25342E-5 39891 0 1.23521E-5
3-46722637-C-T p.Val504Met missense ALS2CL 2 79932 2.50213E-5 39966 0 NA
3-46722647-C-A p.Leu500Phe missense ALS2CL 1 80254 1.24604E-5 40127 0 NA
3-46722657-C-T p.Gly497Asp missense ALS2CL 1 80654 1.23986E-5 40327 0 2.4079E-4
3-46722659-T-A p.Thr496Thr synonymous ALS2CL 4 80788 4.95123E-5 40394 0 1.21726E-5
3-46722661-T-C p.Thr496Ala missense ALS2CL 1 80848 1.23689E-5 40424 0 8.58001E-6
3-46722678-G-T p.Thr490Asn missense ALS2CL 1 81398 1.22853E-5 40699 0 NA
3-46722689-C-A p.Gly486Gly synonymous ALS2CL 1 81588 1.22567E-5 40794 0 2.82867E-5
3-46722692-G-T p.Thr485Thr synonymous ALS2CL 49264 76078 0.647546 38039 15885 0.673987
3-46722692-G-A p.Thr485Thr synonymous ALS2CL 1 81876 1.22136E-5 40938 0 3.20369E-5
3-46722694-T-C p.Thr485Ala missense ALS2CL 2 81924 2.44129E-5 40962 0 NA
3-46722695-CCA-TCC p.Trp484Gly missense ALS2CL 1 81962 1.22008E-5 40981 0 NA
3-46722698-C-A p.Gly483Gly synonymous ALS2CL 1 82100 1.21803E-5 41050 0 NA
3-46722704-C-T p.Thr481Thr synonymous ALS2CL 5 82220 6.08125E-5 41110 0 6.25E-4
3-46722705-G-A p.Thr481Met missense ALS2CL 8 82292 9.72148E-5 41146 1 6.38855E-5
3-46722711-G-T p.Pro479His missense ALS2CL 1 82470 1.21256E-5 41235 0 1.20354E-5
3-46722712-G-C p.Pro479Ala missense ALS2CL 3 82480 3.63725E-5 41240 0 4.01113E-6
3-46722721-C-T p.Ala476Thr missense ALS2CL 1933 82440 0.0234474 41220 115 0.0502333
3-46722729-C-T p.Arg473His missense ALS2CL 2 82598 2.42137E-5 41299 0 6.25E-4
3-46722730-G-A p.Arg473Cys missense ALS2CL 1 82668 1.20966E-5 41334 0 5.19925E-5
3-46722752-C-T p.Glu474Lys missense ALS2CL 2 83000 2.40964E-5 41500 0 7.96692E-6
3-46722763-C-A p.Gly470Val missense ALS2CL 1 83106 1.20328E-5 41553 0 NA
3-46722764-C-T p.Gly470Ser missense ALS2CL 2 83114 2.40633E-5 41557 0 8.31352E-6
3-46722765-G-A p.Ala461Val missense ALS2CL 11 83108 1.32358E-4 41554 0 0.00151057
3-46722770-TC-GT p.Arg459Asn missense ALS2CL 1 83134 1.20288E-5 41567 0 NA
3-46722777-C-G p.Arg465Ser missense ALS2CL 3 83160 3.6075E-5 41580 0 8.30482E-6
3-46722785-A-G p.Trp463Arg missense ALS2CL 2 83178 2.40448E-5 41589 0 NA
3-46722792-C-T p.Arg452Gln missense ALS2CL 1 83172 1.20233E-5 41586 0 8.29917E-6
3-46722793-G-A p.Thr460Met missense ALS2CL 24 83162 2.88593E-4 41581 0 5.03525E-4
3-46722795-G-A p.Thr451Ile missense ALS2CL 1 83190 1.20207E-5 41595 0 NA
3-46722798-C-A p.Arg458Ser missense ALS2CL 1 83202 1.20189E-5 41601 0 NA
3-46722808-T-TG p.Gln455fs frameshift ALS2CL 3 83210 3.60534E-5 41605 0 8.28775E-6
3-46722810-G-A p.Pro446Leu missense ALS2CL 1 83202 1.20189E-5 41601 0 NA
3-46722811-G-A p.Pro454Leu missense ALS2CL 1 83206 1.20184E-5 41603 0 3.31362E-5
3-46722813-G-A p.Pro445Leu missense ALS2CL 1 83216 1.20169E-5 41608 0 3.19122E-5
3-46722817-T-G p.Gln452Pro missense ALS2CL 4 83232 4.80584E-5 41616 0 6.25E-4
3-46722818-G-A p.Gln452* stop_gained ALS2CL 1 83236 1.2014E-5 41618 0 3.1904E-5
3-46722819-C-T p.Arg443His missense ALS2CL 3 83230 3.60447E-5 41615 0 4.38038E-5
3-46722824-C-T p.Gly450Ser missense ALS2CL 2 83250 2.4024E-5 41625 0 1.31414E-4
3-46722842-A-G p.Phe444Leu missense ALS2CL 1 83274 1.20085E-5 41637 0 NA
3-46722845-C-T p.Gly443Arg missense ALS2CL 1 83280 1.20077E-5 41640 0 NA
3-46722850-C-T p.Arg441Gln missense ALS2CL 5 83286 6.00341E-5 41643 0 6.62712E-5
3-46722851-G-A p.Arg441Trp missense ALS2CL 14 83280 1.68108E-4 41640 0 7.59071E-5
3-46722855-G-C p.Ala431Gly missense ALS2CL 1 83282 1.20074E-5 41641 0 NA
3-46722858-C-A p.Glu438Asp missense ALS2CL 2 83290 2.40125E-5 41645 0 NA
3-46722872-C-T p.Gly434Ser missense ALS2CL 2 83294 2.40113E-5 41647 0 NA
3-46722885-G-A p.Thr421Met missense ALS2CL 3 83286 3.60205E-5 41643 0 5.03525E-4
3-46722887-C-T p.Asp429Asn missense ALS2CL 1 83288 1.20065E-5 41644 0 9.57182E-5
3-46722888-G-A p.Pro420Leu missense ALS2CL 2 83296 2.40108E-5 41648 0 0.00100705
3-46722894-GTACCTGGGGAGGGCCATCAACAACGAGCTCTGCCTCATGGAGCTCAGCCCAGAGGATGGGCCCAGCCCATGAACCCCCCAGCCAGGGTCACT-G p.Glu425_Tyr426delinsAsp splice_acceptor ALS2CL 7 83314 8.40195E-5 41657 0 NA
3-46722903-G-A c.1275-6C>T splice_region ALS2CL 1 83300 1.20048E-5 41650 0 1.66459E-5
3-46722983-C-A c.1274+7G>T splice_region ALS2CL 1 83260 1.20106E-5 41630 0 3.9782E-6
3-46722995-G-A p.Ser415Phe missense ALS2CL 1 83244 1.20129E-5 41622 0 2.47313E-5
3-46723001-G-A p.Thr413Met missense ALS2CL 98 83184 0.00117811 41592 0 6.25E-4
3-46723025-C-G p.Trp413Cys missense ALS2CL 7 82968 8.43699E-5 41484 0 4.77361E-5
3-46723034-C-T p.Ser402Asn missense ALS2CL 1 82832 1.20726E-5 41416 0 8.24226E-6
3-46723045-C-T p.Asp407Asn missense ALS2CL 3 82546 3.63434E-5 41273 0 3.29745E-5
3-46723049-C-T p.Ser397Asn missense ALS2CL 2 82394 2.42736E-5 41197 0 NA
3-46723065-T-C c.1176-2A>G splice_acceptor ALS2CL 1 81716 1.22375E-5 40858 0 NA
3-46723077-C-T p.Arg396His missense ALS2CL 3 80908 3.70792E-5 40454 0 1.19426E-5
3-46723077-C-A p.Arg396Leu missense ALS2CL 1 80908 1.23597E-5 40454 0 3.30218E-5
3-46723078-G-A p.Arg396Cys missense ALS2CL 3 80838 3.71113E-5 40419 0 3.98134E-5
3-46723080-AT-A p.Ile395fs frameshift ALS2CL 6 80748 7.43052E-5 40374 0 5.29412E-4
3-46723081-T-C p.Ile395Val missense ALS2CL 1 80712 1.23897E-5 40356 0 NA
3-46723084-C-T p.Gly394Ser missense ALS2CL 6 80254 7.47626E-5 40127 0 5.03525E-4
3-46723085-G-A p.Phe393Phe synonymous ALS2CL 7 80176 8.73079E-5 40088 0 1.65221E-5
3-46723091-G-A c.1176-3C>T splice_region ALS2CL 3 79578 3.76989E-5 39789 0 3.58466E-5
3-46723094-A-T c.1176-6T>A splice_region ALS2CL 1 79326 1.26062E-5 39663 0 NA
3-46723537-C-A p.Cys386Phe missense ALS2CL 10 82968 1.20528E-4 41484 0 1.59327E-4
3-46723543-T-C p.Asn384Ser missense ALS2CL 5 82952 6.02758E-5 41476 0 1.27518E-4
3-46723545-C-A p.Gly383Gly synonymous ALS2CL 2 82974 2.41039E-5 41487 0 2.53957E-5
3-46723550-CGT-C p.His381fs frameshift ALS2CL 5 82946 6.02802E-5 41473 0 1.35414E-4
3-46723550-C-T p.Val382Met missense ALS2CL 1 82946 1.2056E-5 41473 0 3.18649E-5
3-46723551-G-A p.His381His synonymous ALS2CL 31141 82394 0.377952 41197 6268 0.403422
3-46723555-T-C p.Asn380Ser missense ALS2CL 4 82922 4.82381E-5 41461 0 NA
3-46723559-G-A p.Arg379Trp missense ALS2CL 7 82894 8.44452E-5 41447 0 0.00100705
3-46723560-C-T p.Gly378Gly synonymous ALS2CL 1 82920 1.20598E-5 41460 0 6.37349E-5
3-46723567-G-A p.Pro376Leu missense ALS2CL 8 82884 9.65204E-5 41442 0 9.56328E-5
3-46723581-T-TCCCTTGCCGTGGGGCCGG p.Gly371_Thr372insArgProHisGlyLysGly disruptive_inframe_insertion ALS2CL 1 82794 1.20782E-5 41397 0 NA
3-46723592-A-G c.1110-8T>C splice_region ALS2CL 36 82660 4.35519E-4 41330 0 0.00114694
3-46724617-C-A c.1109+3G>T splice_region ALS2CL 220 79306 0.00277407 39653 0 0.00748598
3-46724624-C-T p.Gly299Arg missense+splice_region ALS2CL 2 79472 2.51661E-5 39736 0 2.91135E-5
3-46724625-G-A p.His298His splice_region+synonymous ALS2CL 9 79522 1.13176E-4 39761 0 5.29661E-4
3-46724632-C-T p.Arg366Gln missense ALS2CL 4 79622 5.02374E-5 39811 0 1.83209E-5
3-46724633-G-A p.Arg366Trp missense ALS2CL 10 79674 1.25511E-4 39837 0 5.53567E-5
3-46724636-C-A p.Gly365Cys missense ALS2CL 1 79836 1.25257E-5 39918 0 NA
3-46724639-T-A p.Arg364Trp missense ALS2CL 1 79856 1.25225E-5 39928 0 NA
3-46724648-C-T p.Glu361Lys missense ALS2CL 1 80034 1.24947E-5 40017 0 3.8114E-5
3-46724649-GC-G p.Gly360fs frameshift ALS2CL 3 80022 3.74897E-5 40011 0 9.56511E-5
3-46724649-G-A p.Gly360Gly synonymous ALS2CL 1 80022 1.24966E-5 40011 0 1.8132E-5
3-46724654-C-T p.Glu359Lys missense ALS2CL 15 80250 1.86916E-4 40125 0 6.7648E-4
3-46724655-G-A p.Tyr358Tyr synonymous ALS2CL 2 80348 2.48917E-5 40174 0 1.67813E-5
3-46724658-G-A p.Thr357Thr synonymous ALS2CL 2 80512 2.4841E-5 40256 0 4.48648E-5
3-46724667-G-A p.Cys354Cys synonymous ALS2CL 1 80738 1.23857E-5 40369 0 NA
3-46724670-GA-TT p.Leu353Gln missense ALS2CL 1 80876 1.23646E-5 40438 0 NA
3-46724674-C-T p.Arg352Gln missense ALS2CL 9 80988 1.11128E-4 40494 0 9.78247E-5
3-46724674-C-A p.Arg352Leu missense ALS2CL 2 80988 2.4695E-5 40494 0 1.77863E-5
3-46724675-G-A p.Arg352Trp missense ALS2CL 7 81070 8.63451E-5 40535 0 0.0018797
3-46724682-T-G p.Ala349Ala synonymous ALS2CL 3 81370 3.68686E-5 40685 0 NA
3-46724685-C-T p.Gln348Gln synonymous ALS2CL 1 81474 1.22739E-5 40737 0 3.18695E-5
3-46724687-G-A p.Gln348* stop_gained ALS2CL 1 81618 1.22522E-5 40809 0 NA
3-46724700-T-C p.Ala343Ala synonymous ALS2CL 1 81736 1.22345E-5 40868 0 NA
3-46724702-C-T p.Ala343Thr missense ALS2CL 2 81698 2.44804E-5 40849 0 4.51419E-5
3-46724703-G-A p.Cys342Cys synonymous ALS2CL 3 81692 3.67233E-5 40846 0 3.79788E-4
3-46724707-C-T p.Arg341His missense ALS2CL 2 81748 2.44654E-5 40874 0 2.88472E-5
3-46724708-G-A p.Arg341Cys missense ALS2CL 5 81794 6.11292E-5 40897 0 6.37471E-5
3-46724714-C-T p.Asp339Asn missense ALS2CL 532 81728 0.0065094 40864 10 0.0138446
3-46724715-G-A p.Pro338Pro synonymous ALS2CL 8 81770 9.78354E-5 40885 0 3.18735E-5
3-46724718-AGGCTGGG-A p.Ser335fs frameshift ALS2CL 1 81702 1.22396E-5 40851 0 NA
3-46724723-G-A p.Gln336* stop_gained ALS2CL 1 81738 1.22342E-5 40869 0 8.24756E-6
3-46724726-A-T p.Ser335Thr missense ALS2CL 3 81702 3.67188E-5 40851 0 0.00154959
3-46724727-GGGC-G p.Glu333_Pro334delinsAsp disruptive_inframe_deletion ALS2CL 1 81698 1.22402E-5 40849 0 NA
3-46724731-T-A p.Glu333Val missense ALS2CL 1 81662 1.22456E-5 40831 0 NA
3-46724736-G-A p.Gly331Gly synonymous ALS2CL 1 81584 1.22573E-5 40792 0 1.07039E-5
3-46724741-C-G p.Ala330Pro missense ALS2CL 1 81542 1.22636E-5 40771 0 NA
3-46724750-C-T p.Val327Met missense ALS2CL 12 81494 1.4725E-4 40747 0 0.00102669
3-46724750-C-G p.Val327Leu missense ALS2CL 2 81494 2.45417E-5 40747 0 3.74822E-5
3-46724759-C-A p.Asp324Tyr missense ALS2CL 1 81392 1.22862E-5 40696 0 NA
3-46724772-C-T p.Leu319Leu synonymous ALS2CL 128 80934 0.00158154 40467 0 0.00350582
3-46724775-G-C p.Ala318Ala synonymous ALS2CL 2 80884 2.47268E-5 40442 0 3.18918E-5
3-46724783-G-A p.His316Tyr missense ALS2CL 1 80662 1.23974E-5 40331 0 NA
3-46724786-C-T p.Val315Ile missense ALS2CL 1 80626 1.24029E-5 40313 0 6.37755E-5
3-46724790-C-A p.Trp313Cys missense ALS2CL 1 80472 1.24267E-5 40236 0 NA
3-46724795-T-C p.Thr312Ala missense ALS2CL 2 80348 2.48917E-5 40174 0 3.9454E-5
3-46724804-A-T p.Trp309Arg missense ALS2CL 2 80306 2.49047E-5 40153 0 4.57997E-5
3-46724815-G-T p.Ala305Glu missense+splice_region ALS2CL 1 79856 1.25225E-5 39928 0 0.0430769
3-46724822-G-A c.913-6C>T splice_region ALS2CL 2 79938 2.50194E-5 39969 0 2.74228E-5
3-46724824-G-C c.913-8C>G splice_region ALS2CL 3 79888 3.75526E-5 39944 0 2.79361E-5
3-46725264-A-G c.912+8T>C splice_region ALS2CL 1 82644 1.21001E-5 41322 0 3.19061E-5
3-46725265-C-T c.912+7G>A splice_region ALS2CL 4 82676 4.83816E-5 41338 0 7.9552E-6
3-46725271-C-T c.912+1G>A splice_donor ALS2CL 2 82794 2.41563E-5 41397 0 7.95482E-6
3-46725291-G-A p.Ala298Val missense ALS2CL 96 82988 0.00115679 41494 0 0.00100908
3-46725294-C-G p.Cys297Ser missense ALS2CL 7 83016 8.43211E-5 41508 0 1.90891E-4
3-46725294-C-T p.Cys297Tyr missense ALS2CL 1 83016 1.20459E-5 41508 0 1.64734E-5
3-46725299-G-A p.Ser295Ser synonymous ALS2CL 1 83058 1.20398E-5 41529 0 1.59072E-5
3-46725306-T-C p.Glu293Gly missense ALS2CL 5 83062 6.0196E-5 41531 0 7.95361E-6
3-46725313-C-A p.Glu291* stop_gained ALS2CL 10 83078 1.20369E-4 41539 1 5.76587E-5
3-46725314-G-A p.Pro290Pro synonymous ALS2CL 5 83080 6.0183E-5 41540 0 1.2747E-4
3-46725315-G-T p.Pro290His missense ALS2CL 2 83094 2.40691E-5 41547 0 3.97687E-6
3-46725318-G-A p.Thr289Met missense ALS2CL 1 83086 1.20357E-5 41543 0 NA
3-46725322-G-A p.Leu288Phe missense ALS2CL 2 83090 2.40703E-5 41545 0 3.18512E-5
3-46725327-T-C p.His286Arg missense ALS2CL 1 83068 1.20383E-5 41534 0 3.97693E-6
3-46725332-C-T p.Thr284Thr synonymous ALS2CL 8 83072 9.6302E-5 41536 0 1.59286E-4
3-46725333-G-A p.Thr284Met missense ALS2CL 1 83090 1.20351E-5 41545 0 2.47121E-5
3-46725334-T-G p.Thr284Pro missense ALS2CL 1 83094 1.20346E-5 41547 0 3.18735E-5
3-46725335-GCACCTAGACAGACGGAGGTGATGAGTAGGCCCCAGCTTTGTCCAGGAGGGTGGAGGGGCCCAAGCCAGAGTCCCAGGGTGTGGGCAGGTGTCATGGGGGTAAAGGGAAGAAGGCCTGGGGTGTCAGCCGAGGGGGTTGCT-G p.Cys283del splice_acceptor ALS2CL 4 83088 4.81417E-5 41544 1 NA
3-46725340-T-A c.846-2A>T splice_acceptor ALS2CL 1 83048 1.20412E-5 41524 0 NA
3-46725474-C-G c.845+5G>C splice_region ALS2CL 1 82296 1.21513E-5 41148 0 NA
3-46725480-C-T p.Gly282Arg missense+splice_region ALS2CL 2 82288 2.43049E-5 41144 0 3.18979E-5
3-46725482-T-A p.Asp281Val missense ALS2CL 1 82266 1.21557E-5 41133 0 NA
3-46725504-C-A p.Val274Leu missense ALS2CL 1 82092 1.21815E-5 41046 0 NA
3-46725507-G-A p.Leu273Leu synonymous ALS2CL 1 82054 1.21871E-5 41027 0 NA
3-46725521-G-T p.Thr268Asn missense ALS2CL 1 81820 1.2222E-5 40910 0 5.87883E-6
3-46725537-C-T p.Gly263Ser missense+splice_region ALS2CL 2 81394 2.45718E-5 40697 0 NA
3-46727027-G-C p.Leu258Leu synonymous ALS2CL 2 82854 2.41388E-5 41427 0 NA
3-46727027-G-A p.Leu258Leu synonymous ALS2CL 2 82854 2.41388E-5 41427 0 3.18512E-5
3-46727031-G-T p.Ala257Asp missense ALS2CL 1 82860 1.20685E-5 41430 0 3.32535E-5
3-46727041-A-G p.Phe254Leu missense ALS2CL 1 82906 1.20619E-5 41453 0 8.32404E-6
3-46727048-C-T p.Val251Val synonymous ALS2CL 13 82898 1.56819E-4 41449 0 6.66756E-5
3-46727050-C-T p.Val251Met missense ALS2CL 1 82894 1.20636E-5 41447 0 3.18573E-5
3-46727052-C-T p.Arg250His missense ALS2CL 3 82882 3.6196E-5 41441 0 6.37105E-5
3-46727053-G-A p.Arg250Cys missense ALS2CL 1 82874 1.20665E-5 41437 0 1.67009E-5
3-46727062-G-A p.Arg247Trp missense ALS2CL 5 82872 6.0334E-5 41436 0 5.86402E-5
3-46727066-C-T p.Pro245Pro synonymous ALS2CL 11 82870 1.32738E-4 41435 0 1.23644E-4
3-46727067-G-A p.Pro245Leu missense ALS2CL 4 82868 4.82695E-5 41434 0 0.0015121
3-46727075-C-T p.Thr242Thr synonymous ALS2CL 1 82868 1.20674E-5 41434 0 1.59541E-5
3-46727076-G-A p.Thr242Met missense ALS2CL 3 82870 3.62013E-5 41435 0 5.58347E-5
3-46727080-C-G p.Val241Leu missense ALS2CL 1 82858 1.20688E-5 41429 0 3.18654E-5
3-46727080-C-T p.Val241Met missense ALS2CL 1 82858 1.20688E-5 41429 0 8.42332E-6
3-46727081-G-T p.Pro240Pro synonymous ALS2CL 2 82878 2.41319E-5 41439 0 0.00302725
3-46727087-G-A p.Asp238Asp synonymous ALS2CL 9 82844 1.08638E-4 41422 0 5.91946E-5
3-46727097-T-C p.Asp235Gly missense ALS2CL 2 82816 2.41499E-5 41408 0 3.99077E-6
3-46727101-G-A p.Gln234* stop_gained ALS2CL 1 82818 1.20747E-5 41409 0 NA
3-46727109-C-G p.Arg231Thr missense ALS2CL 2 82766 2.41645E-5 41383 0 NA
3-46727126-G-C p.Leu225Leu synonymous ALS2CL 1 82622 1.21033E-5 41311 0 NA
3-46727133-T-TC p.Asp223fs frameshift ALS2CL 2 82546 2.42289E-5 41273 0 NA
3-46727792-A-G c.666+6T>C splice_region ALS2CL 2 82598 2.42137E-5 41299 0 1.64779E-5
3-46727798-C-G p.Arg222Ser missense+splice_region ALS2CL 1 82688 1.20937E-5 41344 0 4.08687E-6
3-46727800-T-A p.Arg222Trp missense+splice_region ALS2CL 4 82694 4.83711E-5 41347 0 3.26691E-5
3-46727805-C-T p.Arg220Gln missense ALS2CL 2 82736 2.41733E-5 41368 0 5.20075E-5
3-46727805-C-A p.Arg220Leu missense ALS2CL 1 82736 1.20866E-5 41368 0 NA
3-46727806-G-A p.Arg220Trp missense ALS2CL 4 82714 4.83594E-5 41357 0 1.72819E-5
3-46727808-C-T p.Gly219Asp missense ALS2CL 1 82762 1.20828E-5 41381 0 NA
3-46727819-G-A p.His215His synonymous ALS2CL 647 82814 0.00781269 41407 5 0.010014
3-46727820-T-C p.His215Arg missense ALS2CL 1 82826 1.20735E-5 41413 0 4.00481E-6
3-46727830-C-T p.Ala212Thr missense ALS2CL 1 82888 1.20645E-5 41444 0 3.59666E-5
3-46727842-C-G p.Val208Leu missense ALS2CL 30 82940 3.61707E-4 41470 0 6.25E-4
3-46727854-A-G p.Leu204Leu synonymous ALS2CL 2 82964 2.41068E-5 41482 0 1.59476E-5
3-46727864-C-T p.Met200Ile missense ALS2CL 1 82980 1.20511E-5 41490 0 NA
3-46727865-A-T p.Met200Lys missense ALS2CL 3 82986 3.61507E-5 41493 0 8.32542E-5
3-46727866-T-G p.Met200Leu missense ALS2CL 1 82992 1.20494E-5 41496 0 NA
3-46727878-G-A p.Leu196Leu synonymous ALS2CL 2 83016 2.40917E-5 41508 0 1.66445E-5
3-46727899-C-T p.Ala189Thr missense ALS2CL 1 82996 1.20488E-5 41498 0 8.3407E-6
3-46727900-G-A p.Asn188Asn synonymous ALS2CL 4 82990 4.81986E-5 41495 0 5.83781E-5
3-46727908-C-T p.Val186Met missense ALS2CL 1 82986 1.20502E-5 41493 0 8.36428E-6
3-46727909-C-A p.Leu185Leu synonymous ALS2CL 4318 82890 0.0520931 41445 144 0.124375
3-46727909-C-T p.Leu185Leu synonymous ALS2CL 4 82990 4.81986E-5 41495 0 1.67269E-5
3-46727911-G-A p.Leu185Leu synonymous ALS2CL 2 82986 2.41005E-5 41493 0 NA
3-46727916-C-T p.Arg183Gln missense ALS2CL 4 82966 4.82125E-5 41483 0 6.37552E-5
3-46727917-G-A p.Arg183Trp missense ALS2CL 3 82984 3.61515E-5 41492 0 5.03525E-4
3-46727920-T-C p.Thr182Ala missense ALS2CL 42 82948 5.06341E-4 41474 0 0.00130907
3-46727921-T-C p.Pro181Pro synonymous ALS2CL 1 82948 1.20557E-5 41474 0 NA
3-46727921-TG-T p.Pro181fs frameshift ALS2CL 1 82948 1.20557E-5 41474 0 8.44994E-6
3-46727924-G-A p.His180His synonymous ALS2CL 1545 82884 0.0186405 41442 96 0.0393076
3-46727931-T-TCCCCAATGGTGTCCCCGA c.535-3_535-2insTCGGGGACACCATTGGGG splice_region ALS2CL 2 82916 2.41208E-5 41458 1 NA
3-46727935-G-A c.535-6C>T splice_region ALS2CL 4 82898 4.82521E-5 41449 0 6.37592E-5
3-46728468-C-A c.534+5G>T splice_region ALS2CL 2 80842 2.47396E-5 40421 0 2.67678E-5
3-46728470-C-T c.534+3G>A splice_region ALS2CL 2 80928 2.47133E-5 40464 0 NA
3-46728480-A-G p.Ile176Thr missense ALS2CL 27 81268 3.32234E-4 40634 0 5.04541E-4
3-46728481-T-C p.Ile176Val missense ALS2CL 1 81290 1.23016E-5 40645 0 NA
3-46728484-T-A p.Thr175Ser missense ALS2CL 3 81324 3.68895E-5 40662 0 3.19387E-5
3-46728485-G-A p.Asp174Asp synonymous ALS2CL 3 81328 3.68877E-5 40664 0 4.26829E-6
3-46728488-C-T p.Gly173Gly synonymous ALS2CL 74 81488 9.08109E-4 40744 0 0.00258373
3-46728490-C-T p.Gly173Arg missense ALS2CL 3 81538 3.67927E-5 40769 0 0.00100908
3-46728491-G-A p.Leu172Leu synonymous ALS2CL 4 81536 4.90581E-5 40768 0 6.8473E-5
3-46728494-G-T p.Ser171Arg missense ALS2CL 23 81610 2.81828E-4 40805 0 0.0030303
3-46728495-C-T p.Ser171Asn missense ALS2CL 1 81628 1.22507E-5 40814 0 NA
3-46728500-C-G p.Leu169Leu synonymous ALS2CL 3 81690 3.67242E-5 40845 0 3.86332E-5
3-46728509-C-T p.Val166Val synonymous ALS2CL 1 81768 1.22297E-5 40884 0 NA
3-46728512-G-A p.Tyr165Tyr synonymous ALS2CL 14 81806 1.71137E-4 40903 0 1.63286E-4
3-46728524-G-A p.His161His synonymous ALS2CL 1 81862 1.22157E-5 40931 0 1.24141E-5
3-46728527-AT-A p.His160fs frameshift ALS2CL 8 81834 9.77589E-5 40917 0 9.6043E-5
3-46728529-G-A p.His160Tyr missense ALS2CL 1 81852 1.22172E-5 40926 0 1.96452E-5
3-46728532-C-T p.Ala159Thr missense ALS2CL 3 81802 3.66739E-5 40901 0 1.98843E-5
3-46728533-G-C p.Leu158Leu synonymous ALS2CL 1 81800 1.22249E-5 40900 0 1.25054E-5
3-46728533-G-A p.Leu158Leu synonymous ALS2CL 1 81800 1.22249E-5 40900 0 3.19591E-5
3-46728539-C-A p.Gln156His missense ALS2CL 9 81704 1.10154E-4 40852 0 4.61266E-5
3-46728539-C-G p.Gln156His missense ALS2CL 1 81704 1.22393E-5 40852 0 NA
3-46728540-T-C p.Gln156Arg missense ALS2CL 1 81676 1.22435E-5 40838 0 NA
3-46728541-G-A p.Gln156* stop_gained ALS2CL 1 81648 1.22477E-5 40824 0 6.38896E-5
3-46728543-T-G p.His155Pro missense ALS2CL 1 81116 1.2328E-5 40558 0 0.0688259
3-46728546-A-G p.Leu154Pro missense ALS2CL 6 81098 7.39846E-5 40549 0 0.00759109
3-46728557-C-T p.Leu150Leu synonymous ALS2CL 1 80992 1.23469E-5 40496 0 NA
3-46728560-C-T p.Ser149Ser synonymous ALS2CL 4 80772 4.95221E-5 40386 0 3.74766E-5
3-46728561-G-A p.Ser149Leu missense ALS2CL 2 80782 2.4758E-5 40391 0 1.13128E-4
3-46728566-G-A p.Gly147Gly synonymous ALS2CL 1 80610 1.24054E-5 40305 0 3.95956E-5
3-46728572-C-T p.Ser145Ser synonymous ALS2CL 2 80528 2.48361E-5 40264 0 NA
3-46728573-G-A p.Ser145Leu missense ALS2CL 4 80276 4.98281E-5 40138 0 6.40287E-5
3-46728573-G-C p.Ser145Trp missense ALS2CL 1 80276 1.2457E-5 40138 0 NA
3-46728597-A-G p.Leu137Pro missense ALS2CL 1 79316 1.26078E-5 39658 0 NA
3-46728602-C-T p.Gln135Gln synonymous ALS2CL 1 78634 1.27171E-5 39317 0 5.50249E-6
3-46728607-G-A p.Arg134Trp missense ALS2CL 9 77758 1.15744E-4 38879 0 6.25782E-4
3-46728608-C-T p.Leu133Leu synonymous ALS2CL 2 77700 2.574E-5 38850 0 6.2054E-6
3-46728618-C-T p.Arg130Gln missense ALS2CL 1 77068 1.29756E-5 38534 0 7.42457E-6
3-46728619-G-A p.Arg130Trp missense ALS2CL 46 76814 5.98849E-4 38407 0 0.0018797
3-46728627-C-T p.Arg127Gln missense ALS2CL 8 79050 1.01202E-4 39525 0 7.58294E-5
3-46728628-G-C p.Arg127Gly missense ALS2CL 1 78928 1.26698E-5 39464 0 3.2041E-5
3-46728637-C-T p.Glu124Lys missense+splice_region ALS2CL 2 78858 2.5362E-5 39429 0 1.94795E-5
3-46728638-G-A p.Ser123Ser splice_region+synonymous ALS2CL 3 78680 3.81291E-5 39340 0 2.17572E-4
3-46728640-T-TTCTCCTCTTTGCTGCCTTCTGGAAG c.369-3_369-2insCTTCCAGAAGGCAGCAAAGAGGAGA splice_region ALS2CL 1 78678 1.271E-5 39339 0 NA
3-46728642-C-A c.369-4G>T splice_region ALS2CL 1 78470 1.27437E-5 39235 0 NA
3-46728643-G-A c.369-5C>T splice_region ALS2CL 6 78464 7.64682E-5 39232 0 8.77799E-5
3-46729101-G-C c.368+8C>G splice_region ALS2CL 2 82330 2.42925E-5 41165 0 NA
3-46729109-C-T p.Ser123Asn missense+splice_region ALS2CL 1 82424 1.21324E-5 41212 0 NA
3-46729117-C-A p.Lys120Asn missense ALS2CL 1 82464 1.21265E-5 41232 0 1.2751E-4
3-46729157-G-A p.Thr107Ile missense ALS2CL 1 82240 1.21595E-5 41120 0 NA
3-46729158-T-C p.Thr107Ala missense ALS2CL 2 82218 2.43256E-5 41109 0 NA
3-46729159-G-A p.Tyr106Tyr synonymous ALS2CL 1 82206 1.21646E-5 41103 0 NA
3-46729165-C-T p.Glu104Glu synonymous ALS2CL 1 82040 1.21892E-5 41020 0 4.02752E-6
3-46729167-C-T p.Glu104Lys missense ALS2CL 1 81974 1.2199E-5 40987 0 NA
3-46729170-T-C p.Ile103Val missense ALS2CL 1 81906 1.22091E-5 40953 0 2.01498E-5
3-46729580-G-T c.302+8C>A splice_region ALS2CL 1 81860 1.2216E-5 40930 0 NA
3-46729591-A-G p.Ile100Thr missense ALS2CL 1 82048 1.2188E-5 41024 0 4.00295E-6
3-46729592-T-C p.Ile100Val missense ALS2CL 1 82062 1.21859E-5 41031 0 1.20072E-5
3-46729597-G-A p.Ala98Val missense ALS2CL 5 82096 6.09043E-5 41048 0 6.69893E-5
3-46729605-T-C p.Val95Val synonymous ALS2CL 2 82196 2.43321E-5 41098 0 NA
3-46729609-C-T p.Arg94His missense ALS2CL 6 82164 7.30247E-5 41082 0 1.39879E-4
3-46729610-G-A p.Arg94Cys missense ALS2CL 2 82186 2.4335E-5 41093 0 2.50631E-5
3-46729621-C-CGCA p.Leu89dup conservative_inframe_insertion ALS2CL 1 82256 1.21572E-5 41128 0 1.59784E-5
3-46729622-G-A p.Arg90* stop_gained ALS2CL 1 82234 1.21604E-5 41117 0 3.99533E-6
3-46729635-G-C p.Ser85Ser synonymous ALS2CL 1 82328 1.21465E-5 41164 0 3.18898E-5
3-46729636-G-A p.Ser85Phe missense ALS2CL 1 82316 1.21483E-5 41158 0 6.78502E-5
3-46729649-T-C p.Thr81Ala missense ALS2CL 26 82286 3.15971E-4 41143 0 1.59678E-4
3-46729652-A-T p.Ser80Thr missense ALS2CL 2 82258 2.43137E-5 41129 0 2.79443E-5
3-46729656-C-T p.Pro78Pro synonymous ALS2CL 1 82174 1.21693E-5 41087 0 3.33422E-5
3-46729659-G-A p.Tyr77Tyr synonymous ALS2CL 2 82166 2.4341E-5 41083 0 NA
3-46729663-C-T p.Arg76His missense ALS2CL 1 82136 1.21749E-5 41068 0 3.59256E-5
3-46729664-G-A p.Arg76Cys missense ALS2CL 1 82118 1.21776E-5 41059 0 3.99237E-6
3-46729680-T-A p.Ser70Ser synonymous ALS2CL 30 81954 3.66059E-4 40977 0 0.00100705
3-46729680-T-C p.Ser70Ser synonymous ALS2CL 1 81954 1.2202E-5 40977 0 NA
3-46729697-C-A p.Glu65* stop_gained ALS2CL 203 81638 0.00248659 40819 4 0.00855992
3-46729697-C-T p.Glu65Lys missense ALS2CL 2 81658 2.44924E-5 40829 0 NA
3-46729699-G-A p.Thr64Met missense ALS2CL 11 81566 1.3486E-4 40783 0 0.00187735
3-46729748-G-A p.Arg48Trp missense ALS2CL 4 79586 5.02601E-5 39793 0 9.56755E-5
3-46729751-G-A p.Leu47Leu synonymous ALS2CL 1 79458 1.25853E-5 39729 0 NA
3-46729757-C-G p.Glu45Gln missense ALS2CL 27770 76624 0.362419 38312 5400 0.465257
3-46729763-C-T p.Gly43Ser missense ALS2CL 1 78352 1.27629E-5 39176 0 3.19122E-5
3-46729767-G-C p.Pro41Pro synonymous ALS2CL 6 77962 7.69606E-5 38981 0 2.87063E-4
3-46729774-G-A p.Ser39Leu missense ALS2CL 4 76598 5.22207E-5 38299 0 6.37755E-5
3-46729782-T-C p.Pro36Pro synonymous ALS2CL 1 75272 1.32852E-5 37636 0 4.03695E-6
3-46729786-G-C p.Ala35Gly missense+splice_region ALS2CL 2 74342 2.69027E-5 37171 0 8.86745E-6
3-46729786-G-A p.Ala35Val missense+splice_region ALS2CL 1 74342 1.34513E-5 37171 0 NA
3-46730828-C-T p.Ala35Thr missense+splice_region ALS2CL 3 81592 3.67683E-5 40796 0 6.5401E-5
3-46730829-G-A p.Ala34Ala splice_region+synonymous ALS2CL 3 81570 3.67782E-5 40785 0 1.91083E-4
3-46730845-T-C p.Gln29Arg missense ALS2CL 276 81582 0.0033831 40791 3 0.00805732
3-46730853-A-G p.Leu26Leu synonymous ALS2CL 1 81566 1.226E-5 40783 0 NA
3-46730870-C-T p.Ala21Thr missense ALS2CL 1 81426 1.22811E-5 40713 0 9.35069E-6
3-46730871-G-A p.Leu20Leu synonymous ALS2CL 7 81478 8.59128E-5 40739 0 5.04032E-4
3-46730871-G-T p.Leu20Leu synonymous ALS2CL 1 81478 1.22733E-5 40739 0 9.40539E-6
3-46730877-G-A p.Ala18Ala synonymous ALS2CL 33 81410 4.05356E-4 40705 0 0.008125
3-46730893-T-C p.Glu13Gly missense ALS2CL 2 81234 2.46202E-5 40617 0 0.0176589
3-46730894-C-A p.Glu13* stop_gained ALS2CL 1 81434 1.22799E-5 40717 0 NA
3-46730899-C-T p.Arg11Gln missense ALS2CL 2 81376 2.45773E-5 40688 0 1.02707E-5
3-46730900-G-T p.Arg11Arg synonymous ALS2CL 33 81342 4.05694E-4 40671 0 6.25391E-4
3-46730904-C-A p.Leu9Leu synonymous ALS2CL 2 81332 2.45906E-5 40666 0 NA
3-46730911-G-C p.Ala7Gly missense ALS2CL 1 81236 1.23098E-5 40618 0 NA
3-46730926-C-G p.Cys2Ser missense ALS2CL 2 81118 2.46554E-5 40559 1 NA
3-46730930-T-G p.Met1? initiator_codon ALS2CL 3 81052 3.70133E-5 40526 0 3.18431E-5
3-46730930-T-C p.Met1? start_lost ALS2CL 1 81052 1.23378E-5 40526 0 NA
3-46730953-C-A c.-23G>T 5_prime_UTR_premature_start_codon_gain ALS2CL 2 80108 2.49663E-5 40054 0 NA