Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
2-202566411-T-C c.*1485A>G splice_region ALS2 849 70294 0.0120778 35147 9 0.0153257
2-202566584-T-G p.Lys1655Thr missense ALS2 21 82338 2.55046E-4 41169 0 5.41574E-4
2-202566590-C-T p.Arg1653His missense ALS2 2 82336 2.42907E-5 41168 0 1.16639E-4
2-202566591-G-A p.Arg1653Cys missense ALS2 12 82322 1.45769E-4 41161 1 9.56023E-5
2-202566613-CTGGAAGAAAAG-C c.4936-12_4936-2delCTTTTCTTCCA splice_acceptor ALS2 3 82330 3.64387E-5 41165 1 NA
2-202566613-C-G c.4936-1G>C splice_acceptor ALS2 1 82330 1.21462E-5 41165 0 NA
2-202566614-T-TTCAA c.4936-3_4936-2insTTGA splice_region ALS2 2 82314 2.42972E-5 41157 0 NA
2-202566615-G-A c.4936-3C>T splice_region ALS2 4 82286 4.86109E-5 41143 0 NA
2-202568859-A-G p.Phe1641Leu missense ALS2 1 82694 1.20928E-5 41347 0 NA
2-202568870-T-C p.Gln1637Arg missense ALS2 1 82752 1.20843E-5 41376 0 NA
2-202568882-T-A p.Gln1633Leu missense ALS2 1 82726 1.20881E-5 41363 0 NA
2-202568888-T-C p.Tyr1631Cys missense ALS2 1 82726 1.20881E-5 41363 0 8.026E-6
2-202568894-T-C p.Asp1629Gly missense ALS2 4 82732 4.83489E-5 41366 0 0.00125
2-202568909-A-G p.Ile1624Thr missense ALS2 3 82730 3.62625E-5 41365 0 2.49132E-5
2-202568914-G-T p.His1622Gln missense ALS2 1 82700 1.20919E-5 41350 0 NA
2-202568919-C-T p.Val1621Ile missense ALS2 1 82686 1.20939E-5 41343 0 1.49541E-4
2-202568926-G-A p.Gly1618Gly synonymous ALS2 7 82646 8.46986E-5 41323 0 2.81034E-5
2-202568935-C-T p.Arg1615Arg synonymous ALS2 4 82580 4.84379E-5 41290 0 3.18593E-5
2-202568944-G-GGCCCGTAGCA c.4839-4_4839-3insTGCTACGGGC splice_region ALS2 1 82468 1.21259E-5 41234 0 NA
2-202569175-AC-A c.4838+1delG splice_donor ALS2 1 82580 1.21095E-5 41290 0 3.18492E-5
2-202569176-C-T c.4838+1G>A splice_donor ALS2 1 82608 1.21054E-5 41304 0 NA
2-202569184-G-A p.Arg1611Trp missense ALS2 1 82666 1.20969E-5 41333 0 2.497E-5
2-202569195-T-A p.Tyr1607Phe missense ALS2 1 82740 1.20861E-5 41370 0 4.01545E-6
2-202569198-A-G p.Leu1606Ser missense ALS2 1 82752 1.20843E-5 41376 0 6.37146E-5
2-202569221-C-T p.Met1598Ile missense ALS2 1 82892 1.20639E-5 41446 0 8.29876E-6
2-202569230-C-G p.Leu1595Phe missense ALS2 1 82914 1.20607E-5 41457 0 3.18573E-5
2-202569241-C-T p.Glu1592Lys missense ALS2 1 82938 1.20572E-5 41469 0 1.20412E-5
2-202569242-G-A p.His1591His synonymous ALS2 2 82938 2.41144E-5 41469 0 2.40819E-5
2-202569251-C-T p.Ala1588Ala synonymous ALS2 214 82948 0.00257993 41474 0 0.00477859
2-202569251-C-G p.Ala1588Ala synonymous ALS2 1 82948 1.20557E-5 41474 0 8.29091E-6
2-202569252-G-A p.Ala1588Val missense ALS2 6 82942 7.23397E-5 41471 0 3.18471E-5
2-202569254-C-T p.Leu1587Leu synonymous ALS2 3 82952 3.61655E-5 41476 0 4.0132E-6
2-202569283-T-A p.Thr1578Ser missense ALS2 1 82952 1.20552E-5 41476 0 8.02542E-6
2-202569318-A-G p.Phe1566Ser missense ALS2 1 82906 1.20619E-5 41453 0 NA
2-202569329-G-GATCTGCTGCAGACATTCTACTGCTGAGGCAAAACAAGCATC c.4689-4_4689-3insGATGCTTGTTTTGCCTCAGCAGTAGAATGTCTGCAGCAGAT splice_region ALS2 3 82868 3.62022E-5 41434 1 NA
2-202569330-T-C c.4689-4A>G splice_region ALS2 1 82852 1.20697E-5 41426 0 NA
2-202569855-A-C c.4688+7T>G splice_region ALS2 2 82414 2.42677E-5 41207 0 4.017E-6
2-202569871-T-C p.Gln1560Arg missense ALS2 1 82554 1.21133E-5 41277 0 NA
2-202569872-G-A p.Gln1560* stop_gained ALS2 1 82560 1.21124E-5 41280 0 NA
2-202569884-C-T p.Val1556Ile missense ALS2 1 82620 1.21036E-5 41310 0 3.18451E-5
2-202569897-AC-A p.Cys1551fs frameshift ALS2 1 82642 1.21004E-5 41321 0 NA
2-202569908-T-C p.Lys1548Glu missense ALS2 1 82612 1.21048E-5 41306 0 NA
2-202569909-C-T p.Thr1547Thr synonymous ALS2 1 82620 1.21036E-5 41310 0 6.25E-4
2-202569910-G-A p.Thr1547Met missense ALS2 2 82600 2.42131E-5 41300 0 NA
2-202569926-G-A c.4627-3C>T splice_region ALS2 1 82598 1.21068E-5 41299 0 NA
2-202569927-C-T c.4627-4G>A splice_region ALS2 1 82600 1.21065E-5 41300 0 8.33861E-6
2-202569928-A-G c.4627-5T>C splice_region ALS2 2 82600 2.42131E-5 41300 0 3.33545E-5
2-202570132-A-G c.4626+7T>C splice_region ALS2 1 82584 1.21089E-5 41292 0 NA
2-202570187-A-G c.4581-3T>C splice_region ALS2 3 82336 3.64361E-5 41168 0 3.21417E-5
2-202570191-T-C c.4581-7A>G splice_region ALS2 297 82204 0.00361296 41102 2 0.00862783
2-202571562-C-T c.4580+7G>A splice_region ALS2 13073 82308 0.15883 41154 1069 0.209076
2-202571572-T-C p.Gln1526Arg missense ALS2 2 83032 2.40871E-5 41516 0 NA
2-202571576-C-A p.Val1525Leu missense ALS2 1 83030 1.20438E-5 41515 0 NA
2-202571599-A-G p.Ile1517Thr missense ALS2 1 82970 1.20525E-5 41485 0 NA
2-202571600-T-C p.Ile1517Val missense ALS2 2 82976 2.41034E-5 41488 0 NA
2-202571613-A-C p.Asn1512Lys missense ALS2 1 82970 1.20525E-5 41485 0 NA
2-202571642-T-C p.Ile1503Val missense ALS2 1 82938 1.20572E-5 41469 0 1.65923E-5
2-202571646-T-C p.Glu1501Glu synonymous ALS2 1 82928 1.20587E-5 41464 0 8.02568E-6
2-202571650-T-A p.Glu1500Val missense ALS2 1 82890 1.20642E-5 41445 0 NA
2-202571654-G-A p.Arg1499Cys missense ALS2 6 82878 7.23956E-5 41439 0 6.37146E-5
2-202571668-G-A p.Ala1494Val missense ALS2 1 82880 1.20656E-5 41440 0 NA
2-202571669-C-T p.Ala1494Thr missense ALS2 4 82882 4.82614E-5 41441 0 NA
2-202571691-G-A p.Tyr1486Tyr synonymous ALS2 1 82864 1.2068E-5 41432 0 NA
2-202571698-C-T p.Arg1484Gln missense ALS2 1 82864 1.2068E-5 41432 0 8.35939E-6
2-202571701-G-C p.Pro1483Arg missense ALS2 2 82878 2.41319E-5 41439 0 NA
2-202571717-G-C p.Leu1478Val missense ALS2 2 82810 2.41517E-5 41405 1 NA
2-202571733-C-T p.Thr1472Thr synonymous ALS2 140 82642 0.00169405 41321 1 8.34442E-4
2-202571734-G-A p.Thr1472Met missense ALS2 5 82638 6.05049E-5 41319 0 2.41766E-4
2-202571742-A-G p.Tyr1469Tyr synonymous ALS2 9 82566 1.09004E-4 41283 0 9.82241E-5
2-202571750-A-G c.4404-5T>C splice_region ALS2 1 82426 1.21321E-5 41213 0 3.1837E-5
2-202572596-G-A p.Pro1467Ser missense ALS2 2 81842 2.44373E-5 40921 0 NA
2-202572613-C-T p.Arg1461Gln missense ALS2 1 81946 1.22032E-5 40973 0 1.65711E-5
2-202572628-C-T p.Gly1456Glu missense ALS2 1 82178 1.21687E-5 41089 0 8.2861E-6
2-202572630-A-C p.Thr1455Thr synonymous ALS2 1 82198 1.21657E-5 41099 0 4.01619E-6
2-202572648-T-C p.Glu1449Glu synonymous ALS2 2 82364 2.42825E-5 41182 0 NA
2-202572650-C-T p.Glu1449Lys missense ALS2 1 82368 1.21406E-5 41184 0 5.10204E-4
2-202572669-G-A p.Leu1442Leu synonymous ALS2 1 82510 1.21197E-5 41255 0 NA
2-202572687-T-C p.Glu1436Glu synonymous ALS2 2 82504 2.42412E-5 41252 0 NA
2-202572687-T-G p.Glu1436Asp missense ALS2 1 82504 1.21206E-5 41252 0 NA
2-202572692-C-T p.Glu1435Lys missense ALS2 1 82540 1.21153E-5 41270 0 NA
2-202572703-G-A p.Pro1431Leu missense ALS2 1 82542 1.2115E-5 41271 0 NA
2-202572704-G-A p.Pro1431Ser missense ALS2 3 82552 3.63407E-5 41276 0 6.37024E-5
2-202574599-C-G c.4280+5G>C splice_region ALS2 1 83190 1.20207E-5 41595 0 NA
2-202574614-G-A p.Gln1424* stop_gained ALS2 1 83204 1.20187E-5 41602 0 NA
2-202574622-C-T p.Arg1421Gln missense ALS2 1 83198 1.20195E-5 41599 0 1.20315E-5
2-202574623-G-A p.Arg1421* stop_gained ALS2 1 83200 1.20192E-5 41600 0 4.01068E-6
2-202574666-C-T p.Arg1406Arg synonymous ALS2 2 83186 2.40425E-5 41593 0 5.04032E-4
2-202574671-G-A p.Arg1405Cys missense ALS2 1 83158 1.20253E-5 41579 0 4.81332E-5
2-202574684-G-A p.Gly1400Gly synonymous ALS2 1 83070 1.2038E-5 41535 0 9.55657E-5
2-202574689-C-T p.Val1399Met missense ALS2 2 83022 2.409E-5 41511 0 4.81529E-5
2-202574690-G-A p.Tyr1398Tyr synonymous ALS2 5 83008 6.02352E-5 41504 0 0.00101112
2-202574707-C-T p.Val1393Met missense ALS2 1 82856 1.20691E-5 41428 0 3.32342E-5
2-202574739-G-A p.Pro1382Leu missense ALS2 1 82592 1.21077E-5 41296 0 8.3783E-6
2-202574740-G-T p.Pro1382Thr missense ALS2 1 82566 1.21115E-5 41283 0 NA
2-202574751-G-T p.Thr1378Asn missense ALS2 2 82464 2.4253E-5 41232 0 8.39476E-6
2-202574763-T-TTTATTAAATATTTCCTGATGTCATCATATTTCTCCACA c.4123-3_4123-2insTGTGGAGAAATATGATGACATCAGGAAATATTTAATAA splice_region ALS2 6 82200 7.29927E-5 41100 3 NA
2-202575717-T-C p.Ile1373Met missense ALS2 185 81076 0.00228181 40538 2 0.00304524
2-202575729-C-T p.Arg1369Arg synonymous ALS2 6 81514 7.3607E-5 40757 0 9.55475E-5
2-202575731-T-C p.Arg1369Gly missense ALS2 2 81562 2.45212E-5 40781 0 4.01484E-6
2-202575735-GTCA-G p.Asp1367del disruptive_inframe_deletion ALS2 3 81528 3.67972E-5 40764 0 4.01452E-6
2-202575745-T-C p.Lys1364Arg missense ALS2 1 81794 1.22258E-5 40897 0 8.29408E-6
2-202575767-C-T p.Val1357Ile missense ALS2 1 81930 1.22055E-5 40965 0 0.00125
2-202575769-T-C p.His1356Arg missense ALS2 1 81872 1.22142E-5 40936 0 3.1837E-5
2-202575811-G-A p.Ser1342Leu missense ALS2 1 81568 1.22597E-5 40784 0 NA
2-202575815-G-A p.Arg1341Cys missense ALS2 2 81412 2.45664E-5 40706 0 1.20591E-5
2-202575816-A-G p.Ser1340Ser synonymous ALS2 1 81410 1.22835E-5 40705 0 NA
2-202575821-G-A p.Leu1339Leu synonymous ALS2 69926 77984 0.896671 38992 31436 0.9325
2-202575832-C-CTGTCTCTGTGCTGGCGCCGACTGGTGG c.4005-2_4005-1insCCACCAGTCGGCGCCAGCACAGAGACA splice_acceptor ALS2 1 80898 1.23612E-5 40449 0 NA
2-202575833-T-TGTCTCTGTGCTGGCGCCGACTGGTGGTCAAGGCCACAGCA c.4005-3_4005-2insTGCTGTGGCCTTGACCACCAGTCGGCGCCAGCACAGAGAC splice_region ALS2 1 80872 1.23652E-5 40436 0 NA
2-202575833-T-TGTCTCTGTGCTGGCGCCGACTGGTGGTC c.4005-3_4005-2insGACCACCAGTCGGCGCCAGCACAGAGAC splice_region ALS2 1 80872 1.23652E-5 40436 0 NA
2-202580391-T-G c.4004+4A>C splice_region ALS2 1 80826 1.23723E-5 40413 0 NA
2-202580396-T-G p.Ser1335Arg missense+splice_region ALS2 3 80996 3.70389E-5 40498 0 NA
2-202580410-C-T p.Arg1330His missense ALS2 4 81106 4.93182E-5 40553 0 4.0333E-5
2-202580438-T-C p.Ile1321Val missense ALS2 1 82342 1.21445E-5 41171 0 4.01574E-6
2-202580441-T-A p.Asn1320Tyr missense ALS2 2 82414 2.42677E-5 41207 0 NA
2-202580462-C-T p.Glu1313Lys missense ALS2 2 82732 2.41744E-5 41366 0 8.28336E-6
2-202580469-G-T p.Gly1310Gly synonymous ALS2 1 82804 1.20767E-5 41402 0 3.61005E-5
2-202580470-C-T p.Gly1310Asp missense ALS2 1 82822 1.20741E-5 41411 0 NA
2-202580483-A-G p.Cys1306Arg missense ALS2 4 82976 4.82067E-5 41488 0 NA
2-202580486-C-A p.Gly1305Cys missense ALS2 1 83012 1.20465E-5 41506 0 1.65642E-5
2-202580494-C-T p.Arg1302His missense ALS2 47 83024 5.66101E-4 41512 0 9.23508E-4
2-202580514-C-T p.Ala1295Ala synonymous ALS2 2851 82930 0.0343784 41465 57 0.0458207
2-202580515-G-A p.Ala1295Val missense ALS2 2 82968 2.41057E-5 41484 0 2.4062E-5
2-202580523-C-T p.Lys1292Lys synonymous ALS2 8 82928 9.64692E-5 41464 0 2.22845E-4
2-202580527-T-C p.Glu1291Gly missense ALS2 6 82870 7.24026E-5 41435 0 1.9101E-4
2-202580533-GCTGGCA-G p.Val1287_Pro1288del disruptive_inframe_deletion ALS2 5 82788 6.03952E-5 41394 0 2.22887E-4
2-202580536-G-A p.Pro1288Leu missense ALS2 7 82754 8.45881E-5 41377 0 6.62592E-5
2-202580541-T-C p.Ala1286Ala synonymous ALS2 2 82648 2.4199E-5 41324 0 8.28267E-6
2-202580562-G-A p.Phe1279Phe splice_region+synonymous ALS2 1 82218 1.21628E-5 41109 0 NA
2-202580568-A-G c.3837-6T>C splice_region ALS2 1 81968 1.21999E-5 40984 0 NA
2-202582822-C-T p.Asp1272Asn missense ALS2 2 83168 2.40477E-5 41584 0 7.50188E-5
2-202582832-T-C p.Leu1268Leu synonymous ALS2 2 83240 2.40269E-5 41620 0 NA
2-202582839-G-C p.Pro1266Arg missense ALS2 2 83238 2.40275E-5 41619 0 5.03525E-4
2-202582890-A-G p.Phe1249Ser missense ALS2 10 83278 1.2008E-4 41639 0 3.18573E-5
2-202582895-A-C p.Gly1247Gly synonymous ALS2 92 83276 0.00110476 41638 0 0.00117827
2-202582905-T-C p.Tyr1244Cys missense ALS2 1 83260 1.20106E-5 41630 0 NA
2-202582915-T-G p.Asn1241His missense ALS2 4 83258 4.80434E-5 41629 0 9.55414E-5
2-202582919-C-T p.Met1239Ile missense ALS2 1 83260 1.20106E-5 41630 0 NA
2-202582935-T-C c.3703-2A>G splice_acceptor ALS2 1 83206 1.20184E-5 41603 0 NA
2-202582937-G-A c.3703-4C>T splice_region ALS2 1 83178 1.20224E-5 41589 0 3.31691E-5
2-202582940-A-G c.3703-7T>C splice_region ALS2 2 83156 2.40512E-5 41578 0 1.65887E-5
2-202584761-AAAG-A p.Leu584del conservative_inframe_deletion ALS2 3 50734 5.91319E-5 25367 0 4.91159E-4
2-202584764-G-A p.Leu584Phe missense ALS2 1 50798 1.96858E-5 25399 0 NA
2-202584782-C-T p.Ala578Thr missense ALS2 2 50946 3.92573E-5 25473 0 9.56084E-5
2-202584785-C-T p.Glu577Lys missense ALS2 3 50948 5.88836E-5 25474 0 5.90145E-5
2-202584786-G-A p.Cys576Cys synonymous ALS2 1 50900 1.96464E-5 25450 0 2.94542E-5
2-202584787-C-T p.Cys576Tyr missense ALS2 1 50912 1.96417E-5 25456 0 NA
2-202584813-GG-AA p.Ser567Phe missense ALS2 1 50922 1.96379E-5 25461 0 NA
2-202584814-G-A p.Ser567Phe missense ALS2 1 50950 1.96271E-5 25475 0 1.18932E-5
2-202584824-C-T p.Gly564Arg missense ALS2 2 51080 3.91543E-5 25540 0 3.14848E-5
2-202584836-TGAGGC-T p.Gly558fs frameshift ALS2 1 51034 1.95948E-5 25517 0 NA
2-202584841-C-T p.Gly558Asp missense ALS2 1 51000 1.96078E-5 25500 0 3.18959E-5
2-202584855-A-G c.1663-4T>C splice_region ALS2 2 50884 3.93051E-5 25442 0 3.18634E-5
2-202587769-T-C p.Gly1233Gly synonymous ALS2 1 82532 1.21165E-5 41266 0 NA
2-202587776-A-T p.Leu1231His missense ALS2 1 82654 1.20986E-5 41327 0 NA
2-202587792-A-C p.Ser1226Ala missense ALS2 2 82798 2.41552E-5 41399 0 NA
2-202587803-T-G p.Glu1222Ala missense ALS2 3 82832 3.62179E-5 41416 0 8.29325E-6
2-202587806-T-C p.Tyr1221Cys missense ALS2 1 82842 1.20712E-5 41421 0 8.2927E-6
2-202587810-T-C p.Ile1220Val missense ALS2 2 82858 2.41377E-5 41429 0 3.31675E-5
2-202587812-G-T p.Thr1219Asn missense ALS2 6 82870 7.24026E-5 41435 0 3.31669E-5
2-202587822-C-T p.Glu1216Lys missense ALS2 4 82852 4.82789E-5 41426 0 3.18857E-5
2-202587823-G-A p.Ser1215Ser synonymous ALS2 4 82848 4.82812E-5 41424 0 NA
2-202587844-C-CATCATTT c.3625-2_3625-1insAAATGAT splice_acceptor ALS2 4 82810 4.83033E-5 41405 2 NA
2-202587847-C-T c.3625-4G>A splice_region ALS2 2 82784 2.41593E-5 41392 0 NA
2-202587848-A-G c.3625-5T>C splice_region ALS2 6 82782 7.24795E-5 41391 0 1.59439E-4
2-202588048-C-T c.3624+5G>A splice_region ALS2 1 83020 1.20453E-5 41510 0 NA
2-202588055-T-A p.Met1208Leu missense+splice_region ALS2 6 83070 7.22282E-5 41535 0 3.18471E-5
2-202588074-G-A p.Asn1201Asn synonymous ALS2 2 83172 2.40466E-5 41586 0 NA
2-202588075-T-A p.Asn1201Ile missense ALS2 1 83170 1.20236E-5 41585 0 NA
2-202588083-G-A p.Tyr1198Tyr synonymous ALS2 6 83176 7.21362E-5 41588 0 3.31219E-5
2-202588086-G-A p.Tyr1197Tyr synonymous ALS2 1 83180 1.20221E-5 41590 0 4.00718E-6
2-202588093-C-A p.Gly1195Val missense ALS2 1 83202 1.20189E-5 41601 0 3.18451E-5
2-202588095-A-G p.Phe1194Phe synonymous ALS2 1 83202 1.20189E-5 41601 0 1.60286E-5
2-202588113-A-G p.Gly1188Gly synonymous ALS2 3 83192 3.60612E-5 41596 0 1.59226E-4
2-202588123-T-A p.Gln1185Leu missense ALS2 1 83192 1.20204E-5 41596 0 8.28061E-6
2-202588125-A-C p.Cys1184Trp missense ALS2 1 83188 1.2021E-5 41594 0 NA
2-202588130-C-T p.Val1183Met missense ALS2 5 83164 6.01222E-5 41582 0 5.03525E-4
2-202588151-T-C p.Met1176Val missense ALS2 2 83080 2.40732E-5 41540 0 8.28048E-6
2-202588152-A-G p.Tyr1175Tyr synonymous ALS2 2 83070 2.40761E-5 41535 0 NA
2-202588159-T-TC p.Glu1173fs frameshift ALS2 2 83034 2.40865E-5 41517 0 4.00795E-6
2-202588160-C-T p.Glu1173Lys missense ALS2 84 83024 0.00101176 41512 1 0.003125
2-202588166-T-TA c.3513-3_3513-2insT splice_region ALS2 2 82966 2.41063E-5 41483 1 NA
2-202589044-T-G p.Gly1162Gly synonymous ALS2 8 83222 9.61284E-5 41611 0 1.59236E-4
2-202589064-C-G p.Val1156Leu missense ALS2 1 83238 1.20137E-5 41619 0 1.15934E-4
2-202589065-C-G p.Trp1155Cys missense ALS2 1 83232 1.20146E-5 41616 0 NA
2-202589068-C-T p.Gln1154Gln synonymous ALS2 6 83238 7.20825E-5 41619 0 3.16643E-4
2-202589068-C-A p.Gln1154His missense ALS2 2 83238 2.40275E-5 41619 0 8.28089E-6
2-202589070-G-T p.Gln1154Lys missense ALS2 1 83242 1.20132E-5 41621 0 NA
2-202589075-A-G p.Ile1152Thr missense ALS2 2 83242 2.40263E-5 41621 0 1.27372E-4
2-202589077-G-A p.Phe1151Phe synonymous ALS2 5 83230 6.00745E-5 41615 0 NA
2-202589082-T-C p.Met1150Val missense ALS2 1 83224 1.20158E-5 41612 0 NA
2-202589088-G-A p.Pro1148Ser missense ALS2 4 83228 4.80607E-5 41614 0 1.60314E-5
2-202589090-G-C p.Ser1147Cys missense ALS2 6 83224 7.20946E-5 41612 0 3.60719E-5
2-202589093-G-A p.Ser1146Phe missense ALS2 2 83228 2.40304E-5 41614 0 9.55475E-5
2-202589098-C-T p.Thr1144Thr synonymous ALS2 1 83220 1.20163E-5 41610 0 3.18552E-5
2-202589099-G-A p.Thr1144Met missense ALS2 4 83218 4.80665E-5 41609 0 2.48418E-4
2-202589100-T-C p.Thr1144Ala missense ALS2 1 83216 1.20169E-5 41608 0 NA
2-202589101-CA-C p.Leu1143fs frameshift ALS2 1 83206 1.20184E-5 41603 0 NA
2-202589107-C-G p.Gly1141Gly synonymous ALS2 1 83206 1.20184E-5 41603 0 NA
2-202589114-C-T p.Arg1139Gln missense ALS2 1 83214 1.20172E-5 41607 0 3.18573E-5
2-202589114-C-A p.Arg1139Leu missense ALS2 1 83214 1.20172E-5 41607 0 NA
2-202589120-A-C p.Leu1137Arg missense ALS2 2 83224 2.40315E-5 41612 0 8.28061E-6
2-202589125-A-T p.His1135Gln missense ALS2 1 83218 1.20166E-5 41609 0 NA
2-202589136-G-A p.Arg1132Cys missense ALS2 2 83200 2.40385E-5 41600 0 3.18613E-5
2-202589138-A-G p.Met1131Thr missense ALS2 1 83206 1.20184E-5 41603 0 NA
2-202589142-T-C p.Asn1130Asp missense ALS2 1 83210 1.20178E-5 41605 0 NA
2-202589145-C-T p.Asp1129Asn missense ALS2 2 83202 2.40379E-5 41601 0 8.28089E-6
2-202589172-C-G p.Gly1120Arg missense ALS2 1 83180 1.20221E-5 41590 0 3.18613E-5
2-202590080-T-C p.Ser1116Gly missense+splice_region ALS2 1 83130 1.20294E-5 41565 0 8.28089E-6
2-202590081-G-A p.Tyr1115Tyr splice_region+synonymous ALS2 1 83136 1.20285E-5 41568 0 1.20223E-4
2-202590095-C-T p.Gly1111Ser missense ALS2 3 83172 3.60698E-5 41586 0 5.03525E-4
2-202590096-G-A p.Cys1110Cys synonymous ALS2 3 83188 3.60629E-5 41594 0 6.38366E-5
2-202590100-A-G p.Met1109Thr missense ALS2 1 83206 1.20184E-5 41603 0 5.60992E-5
2-202590107-C-T p.Gly1107Arg missense ALS2 12 83216 1.44203E-4 41608 0 6.41159E-5
2-202590117-A-G p.His1103His synonymous ALS2 84 83208 0.00100952 41604 0 0.00178469
2-202590119-G-T p.His1103Asn missense ALS2 2 83232 2.40292E-5 41616 0 3.18898E-5
2-202590132-GTCT-G p.Glu1097del disruptive_inframe_deletion ALS2 1 83212 1.20175E-5 41606 0 NA
2-202590135-T-G p.Glu1097Asp missense ALS2 1 83218 1.20166E-5 41609 0 NA
2-202590146-T-C p.Met1094Val missense ALS2 1 83184 1.20215E-5 41592 0 5.03525E-4
2-202590153-G-A p.Asn1091Asn synonymous ALS2 1 83160 1.2025E-5 41580 0 8.28089E-6
2-202590155-T-A p.Asn1091Tyr missense ALS2 2 83158 2.40506E-5 41579 0 3.1841E-5
2-202590168-T-C p.Glu1086Glu synonymous ALS2 2 83110 2.40645E-5 41555 0 1.65623E-5
2-202590176-A-G p.Tyr1084His missense+splice_region ALS2 5 83044 6.0209E-5 41522 0 1.21555E-5
2-202590176-A-ACCCATCTTCCAAGCCATT p.Gly1083_Tyr1084insAsnGlyLeuGluAspGly conservative_inframe_insertion ALS2 2 83044 2.40836E-5 41522 1 NA
2-202590181-C-T c.3249-4G>A splice_region ALS2 1 82994 1.20491E-5 41497 0 4.00956E-6
2-202590183-A-C c.3249-6T>G splice_region ALS2 1 82992 1.20494E-5 41496 0 NA
2-202590184-T-C c.3249-7A>G splice_region ALS2 4 82930 4.82335E-5 41465 0 4.00959E-6
2-202591227-G-A p.Phe1076Phe synonymous ALS2 1 83042 1.20421E-5 41521 0 NA
2-202591232-T-C p.Met1075Val missense ALS2 6 83048 7.22474E-5 41524 0 3.1837E-5
2-202591235-C-G p.Gly1074Arg missense ALS2 1 83058 1.20398E-5 41529 0 NA
2-202591249-C-T p.Gly1069Glu missense ALS2 81 83082 9.7494E-4 41541 1 0.0020141
2-202591265-A-T p.Leu1064Met missense ALS2 1 83118 1.20311E-5 41559 0 NA
2-202591269-C-A p.Gly1062Gly synonymous ALS2 1 83124 1.20302E-5 41562 0 NA
2-202591272-TCTGGAATGCATAAGCAAAGAATAATGCATGTCAACTAATATTTCAGATAATTAATACTTTTTCTATCATGTGATGATCATCCTCACCCCAGGCATAAATCTTCAACATTTTCAC-T c.3182+1_3183-1del splice_acceptor ALS2 5 83116 6.01569E-5 41558 2 NA
2-202591402-C-T p.Gly1056Glu missense ALS2 2 83306 2.40079E-5 41653 0 NA
2-202591430-C-T p.Ala1047Thr missense ALS2 1 83294 1.20057E-5 41647 0 8.28185E-6
2-202591436-T-C p.Lys1045Glu missense ALS2 1 83294 1.20057E-5 41647 0 NA
2-202591441-C-T p.Arg1043His missense ALS2 5 83272 6.00442E-5 41636 0 3.18512E-5
2-202591460-T-C p.Thr1037Ala missense ALS2 1 83312 1.20031E-5 41656 0 4.00731E-6
2-202591472-T-C p.Ser1033Gly missense ALS2 1 83306 1.20039E-5 41653 0 NA
2-202591475-G-A p.Arg1032Cys missense ALS2 1 83302 1.20045E-5 41651 0 4.00737E-6
2-202591484-G-A p.Pro1029Ser missense ALS2 2 83304 2.40085E-5 41652 0 8.28377E-6
2-202591491-C-T p.Gln1026Gln synonymous ALS2 3 83296 3.60161E-5 41648 0 8.28514E-6
2-202591507-C-T p.Ser1021Asn missense ALS2 8 83286 9.60546E-5 41643 0 2.80557E-5
2-202591520-AAGGGGGGAGATC-A p.Asp1013_Pro1016del conservative_inframe_deletion ALS2 1 83276 1.20083E-5 41638 0 NA
2-202591522-G-C p.Pro1016Arg missense ALS2 1 83280 1.20077E-5 41640 0 1.07891E-4
2-202591523-G-C p.Pro1016Ala missense ALS2 41 83282 4.92303E-4 41641 0 9.87639E-4
2-202591523-G-A p.Pro1016Ser missense ALS2 1 83282 1.20074E-5 41641 0 7.21454E-5
2-202591523-G-T p.Pro1016Thr missense ALS2 3 83282 3.60222E-5 41641 0 1.65992E-5
2-202591524-G-A p.Pro1015Pro synonymous ALS2 2 83276 2.40165E-5 41638 0 8.30137E-6
2-202591527-G-A p.Leu1014Leu synonymous ALS2 1 83272 1.20088E-5 41636 0 NA
2-202591546-A-C p.Leu1008Trp missense ALS2 1 83218 1.20166E-5 41609 0 NA
2-202591559-C-A p.Val1004Leu missense ALS2 1 83160 1.2025E-5 41580 0 8.43569E-6
2-202591559-C-T p.Val1004Ile missense ALS2 1 83160 1.2025E-5 41580 0 4.01313E-6
2-202591571-T-C p.Ile1000Val missense ALS2 1 83052 1.20406E-5 41526 0 6.37146E-5
2-202591576-C-T p.Arg998Gln missense ALS2 1 82978 1.20514E-5 41489 0 6.3743E-5
2-202591577-G-T p.Arg998Arg synonymous ALS2 2 82964 2.41068E-5 41482 0 0.00453172
2-202591579-A-G p.Leu997Pro missense ALS2 1 82986 1.20502E-5 41493 0 NA
2-202591591-T-TTTTCCTGGGGTGTAGATGAAATGAGAGTGAACTGCTCCTC c.2980-3_2980-2insGAGGAGCAGTTCACTCTCATTTCATCTACACCCCAGGAAA splice_region ALS2 1 82824 1.20738E-5 41412 0 NA
2-202591591-T-TTTTCCTGGGGTGTAGATGAAATGAG c.2980-3_2980-2insCTCATTTCATCTACACCCCAGGAAA splice_region ALS2 2 82824 2.41476E-5 41412 1 NA
2-202591597-C-T c.2980-8G>A splice_region ALS2 1 82604 1.2106E-5 41302 0 4.05216E-6
2-202591927-A-G c.2979+8T>C splice_region ALS2 12 82682 1.45134E-4 41341 0 7.46331E-5
2-202591928-G-A c.2979+7C>T splice_region ALS2 1 82684 1.20942E-5 41342 0 NA
2-202591929-A-G c.2979+6T>C splice_region ALS2 1 82684 1.20942E-5 41342 0 NA
2-202591936-T-G p.Lys993Thr missense+splice_region ALS2 1 82738 1.20863E-5 41369 0 6.37267E-5
2-202591946-G-T p.Pro990Thr missense ALS2 1 82760 1.20831E-5 41380 0 4.00888E-6
2-202591989-C-T p.Lys975Lys synonymous ALS2 2 82748 2.41698E-5 41374 0 3.32005E-5
2-202592001-C-CACACCACCAG c.2913-1_2913insCTGGTGGTGT splice_acceptor ALS2 1 82736 1.20866E-5 41368 0 NA
2-202592008-C-T c.2913-7G>A splice_region ALS2 3 82594 3.63222E-5 41297 0 2.87136E-4
2-202592009-G-A c.2913-8C>T splice_region ALS2 1 82558 1.21127E-5 41279 0 4.01171E-5
2-202592420-G-A c.2912+8C>T splice_region ALS2 3 80866 3.70984E-5 40433 0 1.51057E-4
2-202592431-C-A p.Gly970Val missense ALS2 9 81156 1.10898E-4 40578 0 0.001875
2-202592439-T-G p.Glu967Asp missense ALS2 1 81226 1.23113E-5 40613 0 NA
2-202592465-G-T p.Leu959Met missense ALS2 1 81328 1.22959E-5 40664 0 NA
2-202592466-C-T p.Thr958Thr synonymous ALS2 1 81324 1.22965E-5 40662 0 1.29328E-5
2-202592485-T-A p.His952Leu missense ALS2 1 81350 1.22926E-5 40675 0 NA
2-202592485-T-C p.His952Arg missense ALS2 2 81350 2.45851E-5 40675 0 2.58719E-5
2-202592491-G-A p.Thr950Met missense ALS2 1 81316 1.22977E-5 40658 0 6.36983E-5
2-202593229-G-A c.2841+6C>T splice_region ALS2 1 83018 1.20456E-5 41509 0 2.00669E-5
2-202593232-T-C c.2841+3A>G splice_region ALS2 1 83032 1.20435E-5 41516 0 NA
2-202593237-G-A p.Gln947* stop_gained ALS2 1 83064 1.20389E-5 41532 0 NA
2-202593239-G-C p.Ala946Gly missense ALS2 1 83076 1.20372E-5 41538 0 3.18532E-5
2-202593259-A-G p.Phe939Phe synonymous ALS2 1 83128 1.20296E-5 41564 0 NA
2-202593262-G-C p.Leu938Leu synonymous ALS2 1 83142 1.20276E-5 41571 0 NA
2-202593272-C-A p.Trp935Leu missense ALS2 2 83170 2.40471E-5 41585 0 NA
2-202593274-A-G p.Asn934Asn synonymous ALS2 2 83166 2.40483E-5 41583 0 4.01023E-6
2-202593280-G-A p.Ser932Ser synonymous ALS2 6819 83092 0.0820657 41546 332 0.100705
2-202593304-A-G p.Ser924Ser synonymous ALS2 1 83282 1.20074E-5 41641 0 NA
2-202593310-G-A p.Ala922Ala synonymous ALS2 1 83284 1.20071E-5 41642 0 3.18634E-5
2-202593333-G-A p.Leu915Leu synonymous ALS2 1 83300 1.20048E-5 41650 0 NA
2-202593343-C-T n.503G>A splice_region ALS2 10 83278 1.2008E-4 41639 0 0.00100705
2-202593352-C-A p.Arg908Ser missense ALS2 1 83262 1.20103E-5 41631 0 NA
2-202593767-T-G c.2712+8A>C splice_region ALS2 1 83092 1.20349E-5 41546 0 2.48406E-5
2-202593774-C-T c.2712+1G>A splice_donor ALS2 1 83124 1.20302E-5 41562 0 NA
2-202593775-C-T p.Thr904Thr splice_region+synonymous ALS2 13 83120 1.564E-4 41560 0 2.31846E-4
2-202593786-C-T p.Gly901Arg missense ALS2 2 83148 2.40535E-5 41574 0 1.65604E-5
2-202593787-G-A p.Pro900Pro synonymous ALS2 1 83148 1.20267E-5 41574 0 2.00393E-5
2-202593816-A-T p.Tyr891Asn missense ALS2 1 83248 1.20123E-5 41624 0 NA
2-202593836-C-T p.Arg884Lys missense ALS2 2 83268 2.40188E-5 41634 0 8.28144E-6
2-202593840-C-T p.Gly883Ser missense ALS2 3 83238 3.60412E-5 41619 0 3.20307E-5
2-202593841-G-A p.Leu882Leu synonymous ALS2 6 83252 7.20703E-5 41626 0 1.92086E-4
2-202593855-G-A p.Leu878Phe missense ALS2 9 83232 1.08131E-4 41616 0 0.00125
2-202593871-A-G p.Ser872Ser synonymous ALS2 1 83198 1.20195E-5 41599 0 3.19836E-5
2-202593881-T-G p.Gln869Pro missense ALS2 2 83142 2.40552E-5 41571 0 NA
2-202598019-G-C p.Leu854Val missense ALS2 4 83036 4.81719E-5 41518 0 NA
2-202598021-T-C p.Lys853Arg missense ALS2 4 83064 4.81556E-5 41532 0 NA
2-202598024-A-G p.Leu852Pro missense ALS2 2 83058 2.40796E-5 41529 0 NA
2-202598031-CT-C p.Val850fs frameshift ALS2 1 83070 1.2038E-5 41535 0 NA
2-202598037-C-T p.Ala848Thr missense ALS2 3 83052 3.61219E-5 41526 0 0.00100705
2-202598038-G-A p.Tyr847Tyr synonymous ALS2 5 83066 6.01931E-5 41533 0 5.80788E-5
2-202598043-T-C p.Asn846Asp missense ALS2 1 83082 1.20363E-5 41541 0 NA
2-202598051-C-T p.Arg843Gln missense ALS2 15 83084 1.8054E-4 41542 0 9.55475E-5
2-202598052-G-A p.Arg843* stop_gained ALS2 1 83074 1.20375E-5 41537 0 8.29531E-6
2-202598059-T-G p.Pro840Pro synonymous ALS2 15 83076 1.80558E-4 41538 0 5.03525E-4
2-202598072-A-G p.Leu836Ser missense ALS2 1 83060 1.20395E-5 41530 0 1.60434E-5
2-202598079-TCAGTATTTC-T p.Glu831_Leu833del conservative_inframe_deletion ALS2 4 83040 4.81696E-5 41520 0 0.00166722
2-202598085-T-A p.Ile832Leu missense ALS2 2 83028 2.40883E-5 41514 0 9.55049E-5
2-202598100-T-A p.Thr827Ser missense ALS2 37 83014 4.45708E-4 41507 0 0.00181506
2-202598113-C-T p.Val822Val synonymous ALS2 43971 82328 0.534095 41164 12533 0.544375
2-202598126-T-C p.Asp818Gly missense ALS2 2 82972 2.41045E-5 41486 0 8.32431E-6
2-202598129-T-C p.Gln817Arg missense ALS2 1 82980 1.20511E-5 41490 0 2.49817E-5
2-202598160-C-T p.Asp807Asn missense+splice_region ALS2 1 82814 1.20753E-5 41407 0 NA
2-202598165-G-C c.2418-4C>G splice_region ALS2 2 82758 2.41668E-5 41379 0 NA
2-202598169-C-T c.2418-8G>A splice_region ALS2 1 82648 1.20995E-5 41324 0 4.04344E-6
2-202603262-G-A n.186C>T splice_region ALS2 1 76592 1.30562E-5 38296 0 NA
2-202603263-A-C n.185T>G splice_region ALS2 41 76588 5.35332E-4 38294 0 7.96229E-4
2-202603388-C-T c.2417+5G>A splice_region ALS2 1 83004 1.20476E-5 41502 0 NA
2-202603393-A-G p.Ile806Thr missense+splice_region ALS2 1 83002 1.20479E-5 41501 0 NA
2-202603407-A-G p.Leu801Leu synonymous ALS2 1 83074 1.20375E-5 41537 0 8.2905E-6
2-202603415-G-A p.Gln799* stop_gained ALS2 1 83060 1.20395E-5 41530 0 NA
2-202603440-T-C p.Thr790Thr synonymous ALS2 1 83010 1.20467E-5 41505 0 NA
2-202603451-T-G p.Thr787Pro missense ALS2 1 82930 1.20584E-5 41465 0 NA
2-202606405-A-G p.Ser781Ser synonymous ALS2 1 82442 1.21297E-5 41221 0 NA
2-202606417-G-C p.Leu777Leu synonymous ALS2 2 82368 2.42813E-5 41184 0 3.18593E-5
2-202606422-T-C p.Ser776Gly missense ALS2 2 82368 2.42813E-5 41184 0 6.25E-4
2-202606428-G-A p.His774Tyr missense ALS2 1 82316 1.21483E-5 41158 0 2.49721E-5
2-202606435-G-C p.Ile771Met missense ALS2 1 82318 1.2148E-5 41159 0 NA
2-202606438-G-T p.Val770Val synonymous ALS2 1 82314 1.21486E-5 41157 0 4.01923E-6
2-202606459-T-C p.Val763Val synonymous ALS2 1 82428 1.21318E-5 41214 0 NA
2-202606466-T-C p.His761Arg missense ALS2 17 82490 2.06086E-4 41245 0 3.21463E-5
2-202606476-T-C p.Ser758Gly missense ALS2 1 82566 1.21115E-5 41283 0 1.66872E-5
2-202606507-G-A p.Tyr747Tyr synonymous ALS2 220 82794 0.0026572 41397 0 0.00232454
2-202606527-G-A p.Arg741* stop_gained ALS2 1 82924 1.20592E-5 41462 0 8.48436E-6
2-202606530-T-C p.Ser740Gly missense ALS2 1 82940 1.20569E-5 41470 0 4.25062E-5
2-202606548-G-A p.Leu734Leu synonymous ALS2 1 83016 1.20459E-5 41508 0 NA
2-202606555-T-C p.Thr731Thr synonymous ALS2 1 83014 1.20462E-5 41507 0 2.81226E-5
2-202606566-T-C p.Thr728Ala missense ALS2 1 83014 1.20462E-5 41507 0 NA
2-202606567-G-A p.Gly727Gly synonymous ALS2 2 83010 2.40935E-5 41505 0 2.01228E-5
2-202606580-A-G c.2171-3T>C splice_region ALS2 2 82954 2.41097E-5 41477 0 4.04636E-6
2-202606580-A-AAACTGAGAAGAGGCC c.2171-4_2171-3insGGCCTCTTCTCAGTT splice_region ALS2 1 82954 1.20549E-5 41477 0 NA
2-202606584-C-T c.2171-7G>A splice_region ALS2 4 82920 4.82393E-5 41460 0 3.18532E-5
2-202608981-C-G p.Glu724Gln missense+splice_region ALS2 1 83278 1.2008E-5 41639 0 4.00766E-6
2-202608996-G-T p.Pro719Thr missense ALS2 1 83310 1.20034E-5 41655 0 NA
2-202608997-C-A p.Arg718Ser missense ALS2 1 83312 1.20031E-5 41656 0 NA
2-202609025-A-G p.Leu709Pro missense ALS2 1 83348 1.19979E-5 41674 0 NA
2-202609042-T-C p.Arg703Arg synonymous ALS2 1 83334 1.19999E-5 41667 0 NA
2-202609043-C-G p.Arg703Thr missense ALS2 2 83342 2.39975E-5 41671 0 1.65629E-5
2-202609046-T-C p.Glu702Gly missense ALS2 1 83330 1.20005E-5 41665 0 3.18451E-5
2-202609048-T-C p.Thr701Thr synonymous ALS2 1 83326 1.20011E-5 41663 0 8.28144E-6
2-202609053-T-C p.Thr700Ala missense ALS2 3 83316 3.60075E-5 41658 0 4.00792E-5
2-202609054-A-G p.Ala699Ala synonymous ALS2 1 83316 1.20025E-5 41658 0 8.28267E-6
2-202609057-T-C p.Leu698Leu synonymous ALS2 1 83310 1.20034E-5 41655 0 NA
2-202609061-T-A p.Glu697Val missense ALS2 2 83316 2.4005E-5 41658 0 NA
2-202609062-C-T p.Glu697Lys missense ALS2 1 83314 1.20028E-5 41657 0 1.65653E-5
2-202609063-G-A p.His696His synonymous ALS2 4 83322 4.80065E-5 41661 0 1.20226E-5
2-202609066-G-A p.Leu695Leu synonymous ALS2 1 83322 1.20016E-5 41661 0 NA
2-202609069-A-C p.Ser694Arg missense ALS2 1 83306 1.20039E-5 41653 0 NA
2-202609079-T-C p.Tyr691Cys missense ALS2 1 83290 1.20062E-5 41645 0 NA
2-202609085-A-G p.Met1? start_lost ALS2 1 83304 1.20042E-5 41652 0 NA
2-202609089-T-C p.Ile688Val missense ALS2 1 83296 1.20054E-5 41648 0 6.37064E-5
2-202609123-T-C p.Gly676Gly synonymous ALS2 1 83256 1.20111E-5 41628 0 4.00882E-6
2-202609127-G-C p.Ala675Gly missense ALS2 1 83234 1.20143E-5 41617 0 NA
2-202609134-C-CAAA p.Arg672_Val673insPhe conservative_inframe_insertion ALS2 1 83218 1.20166E-5 41609 0 NA
2-202609135-T-TAATGAAAAC p.Arg672_Val673insPheSerLeu disruptive_inframe_insertion ALS2 1 83206 1.20184E-5 41603 0 NA
2-202609137-T-TGTTA p.Arg672fs frameshift ALS2 1 83198 1.20195E-5 41599 0 NA
2-202609147-T-C p.Gly668Gly synonymous ALS2 5 83172 6.01164E-5 41586 0 4.01181E-5
2-202609149-C-T p.Gly668Arg missense ALS2 2 83158 2.40506E-5 41579 0 NA
2-202611277-ATTCC-A c.1998+8_1998+11delGGAA splice_region ALS2 1 83272 1.20088E-5 41636 0 8.01571E-6
2-202611312-G-A p.Pro659Ser missense ALS2 1 83334 1.19999E-5 41667 0 NA
2-202611322-A-G p.Gly655Gly synonymous ALS2 1 83330 1.20005E-5 41665 0 NA
2-202611327-T-G p.Ser654Arg missense ALS2 1 83328 1.20008E-5 41664 0 3.31219E-5
2-202611327-T-C p.Ser654Gly missense ALS2 1 83328 1.20008E-5 41664 0 3.18471E-5
2-202611359-G-A p.Pro643Leu missense ALS2 1 83308 1.20036E-5 41654 0 NA
2-202611360-G-T p.Pro643Thr missense ALS2 1 83302 1.20045E-5 41651 0 8.28061E-6
2-202611360-G-A p.Pro643Ser missense ALS2 1 83302 1.20045E-5 41651 0 NA
2-202611368-C-T p.Arg640Gln missense ALS2 1 83284 1.20071E-5 41642 0 1.65612E-5
2-202611397-G-A p.Asp630Asp synonymous ALS2 1 83230 1.20149E-5 41615 0 NA
2-202611400-T-C p.Glu629Glu synonymous ALS2 2 83236 2.40281E-5 41618 0 3.31274E-5
2-202611428-T-C p.Asp620Gly missense ALS2 2 83132 2.40581E-5 41566 0 NA
2-202611429-C-A p.Asp620Tyr missense ALS2 1 83146 1.2027E-5 41573 0 1.20269E-5
2-202611432-T-C p.Arg619Gly missense ALS2 1 83126 1.20299E-5 41563 0 8.28459E-6
2-202611455-C-G p.Gly611Ala missense ALS2 8 83022 9.636E-5 41511 0 3.18431E-4
2-202611469-T-C p.Ile606Met missense+splice_region ALS2 1 82916 1.20604E-5 41458 0 4.01085E-6
2-202611471-T-A p.Ile606Leu missense+splice_region ALS2 1 82898 1.2063E-5 41449 0 NA
2-202611471-T-C p.Ile606Val missense+splice_region ALS2 1 82898 1.2063E-5 41449 0 NA
2-202611472-CTGCAACGACAGAAAGATAG-C c.1816-20_1816-2delCTATCTTTCTGTCGTTGCA splice_acceptor ALS2 1 82868 1.20674E-5 41434 0 NA
2-202611476-AACGAC-A c.1816-10_1816-6delGTCGT splice_region ALS2 2 82790 2.41575E-5 41395 0 NA
2-202611478-C-G c.1816-7G>C splice_region ALS2 1 82742 1.20858E-5 41371 0 4.01291E-6
2-202611479-G-A c.1816-8C>T splice_region ALS2 147 82682 0.0017779 41341 0 0.001875
2-202614419-AAGTTCACAAAAG-A c.1815+4_1815+15delCTTTTGTGAACT splice_region ALS2 6 82640 7.26041E-5 41320 0 3.18512E-5
2-202614427-A-C c.1815+8T>G splice_region ALS2 1 82750 1.20846E-5 41375 0 1.66041E-5
2-202614428-A-G c.1815+7T>C splice_region ALS2 5 82756 6.04186E-5 41378 0 4.0076E-6
2-202614428-AAAG-A c.1815+4_1815+6delCTT splice_region ALS2 1 82756 1.20837E-5 41378 0 NA
2-202614431-G-GCT c.1815+3_1815+4insAG splice_region ALS2 1 82796 1.20779E-5 41398 0 NA
2-202614433-A-G c.1815+2T>C splice_donor ALS2 1 82810 1.20758E-5 41405 0 NA
2-202614440-C-T p.Ala604Thr missense ALS2 1 82908 1.20616E-5 41454 0 3.31675E-5
2-202614445-C-T p.Arg602His missense ALS2 2 82908 2.41231E-5 41454 0 4.14477E-5
2-202614461-G-C p.Pro597Ala missense ALS2 1 83026 1.20444E-5 41513 0 4.00734E-6
2-202614467-C-T p.Asp595Asn missense ALS2 7 83006 8.43313E-5 41503 0 6.6291E-5
2-202614468-G-A p.Ser594Ser synonymous ALS2 10 83020 1.20453E-4 41510 0 6.25E-4
2-202614493-T-C p.Asn586Ser missense ALS2 1 83006 1.20473E-5 41503 0 NA
2-202614512-C-T p.Val580Ile missense+splice_region ALS2 2 82908 2.41231E-5 41454 0 8.30606E-6
2-202614517-C-CA c.1738-6_1738-5insT splice_region ALS2 4 82876 4.82649E-5 41438 0 3.20451E-5
2-202617866-T-C c.1737+3A>G splice_region ALS2 2 82828 2.41464E-5 41414 0 3.1841E-5
2-202617878-C-T p.Ala576Ala synonymous ALS2 4 82946 4.82241E-5 41473 0 6.6257E-5
2-202617881-A-G p.Thr575Thr synonymous ALS2 1 82958 1.20543E-5 41479 0 NA
2-202617929-T-C p.Lys559Lys synonymous ALS2 21 83060 2.52829E-4 41530 0 4.77525E-4
2-202617943-A-G p.Cys555Arg missense ALS2 1 83026 1.20444E-5 41513 0 NA
2-202617956-C-T p.Pro550Pro synonymous ALS2 1 82934 1.20578E-5 41467 0 3.1841E-5
2-202617965-C-T p.Arg547Arg splice_region+synonymous ALS2 26 82832 3.13888E-4 41416 0 4.06329E-4
2-202617969-A-T c.1641-4T>A splice_region ALS2 1 82784 1.20796E-5 41392 0 6.3674E-5
2-202619219-C-T c.1640+7G>A splice_region ALS2 6 82846 7.24235E-5 41423 0 1.60327E-5
2-202619220-G-A c.1640+6C>T splice_region ALS2 1 82888 1.20645E-5 41444 0 3.31323E-5
2-202619239-C-T p.Asp543Asn missense ALS2 81 83110 9.74612E-4 41555 0 6.73271E-4
2-202619242-C-T p.Gly542Ser missense ALS2 2 83174 2.4046E-5 41587 0 1.65645E-5
2-202619243-G-A p.His541His synonymous ALS2 8 83174 9.61839E-5 41587 0 9.618E-5
2-202619244-T-C p.His541Arg missense ALS2 2 83182 2.40437E-5 41591 0 NA
2-202619255-C-T p.Gly537Gly synonymous ALS2 1 83278 1.2008E-5 41639 0 NA
2-202619257-C-T p.Gly537Arg missense ALS2 2 83296 2.40108E-5 41648 0 8.28212E-6
2-202619283-A-G p.Val528Ala missense ALS2 1 83320 1.20019E-5 41660 0 NA
2-202619288-T-C p.Thr526Thr synonymous ALS2 47 83318 5.64104E-4 41659 0 0.00302115
2-202619308-G-A p.Leu520Phe missense ALS2 3 83298 3.60153E-5 41649 0 1.24257E-4
2-202619308-G-C p.Leu520Val missense ALS2 1 83298 1.20051E-5 41649 0 NA
2-202619309-C-T p.Ala519Ala synonymous ALS2 14 83294 1.68079E-4 41647 0 5.03525E-4
2-202619310-G-A p.Ala519Val missense ALS2 2 83294 2.40113E-5 41647 0 0.00151057
2-202619316-G-C p.Ala517Gly missense ALS2 4 83280 4.80307E-5 41640 0 4.97018E-5
2-202619318-T-G p.Glu516Asp missense ALS2 1 83278 1.2008E-5 41639 0 NA
2-202619326-T-C p.Ser514Gly missense ALS2 10 83264 1.201E-4 41632 0 4.14182E-5
2-202619330-T-C p.Thr512Thr synonymous ALS2 1 83272 1.20088E-5 41636 0 NA
2-202619332-T-G p.Thr512Pro missense ALS2 2 83272 2.40177E-5 41636 0 NA
2-202619333-G-A p.Pro511Pro synonymous ALS2 2 83272 2.40177E-5 41636 0 4.00847E-6
2-202619344-C-T p.Val508Ile missense ALS2 1 83254 1.20114E-5 41627 0 NA
2-202619357-T-C p.Lys503Lys synonymous ALS2 3 83230 3.60447E-5 41615 0 4.00847E-6
2-202619364-C-T p.Arg501Gln missense ALS2 3 83234 3.6043E-5 41617 0 0.00100705
2-202619365-G-A p.Arg501Trp missense ALS2 9 83222 1.08144E-4 41611 0 1.65747E-5
2-202619365-G-T p.Arg501Arg synonymous ALS2 1 83222 1.20161E-5 41611 0 NA
2-202619378-T-C p.Leu496Leu synonymous ALS2 1 83196 1.20198E-5 41598 0 NA
2-202622122-T-C c.1471+3A>G splice_region ALS2 2 83122 2.4061E-5 41561 0 NA
2-202622128-G-T p.Gln490Lys missense ALS2 2 83176 2.40454E-5 41588 0 4.00911E-6
2-202622141-A-G p.Pro485Pro synonymous ALS2 1 83256 1.20111E-5 41628 0 1.65719E-5
2-202622151-A-G p.Leu482Pro missense ALS2 3 83286 3.60205E-5 41643 0 8.28555E-6
2-202622158-G-A p.Arg480* stop_gained ALS2 1 83288 1.20065E-5 41644 0 NA
2-202622160-C-G p.Ser479Thr missense ALS2 2 83288 2.40131E-5 41644 1 NA
2-202622163-C-G p.Gly478Ala missense ALS2 3 83306 3.60118E-5 41653 0 3.18451E-5
2-202622171-T-C p.Thr475Thr synonymous ALS2 2 83330 2.4001E-5 41665 0 3.1841E-5
2-202622173-T-C p.Thr475Ala missense ALS2 1 83332 1.20002E-5 41666 0 4.01049E-6
2-202622194-C-T p.Val468Met missense ALS2 1 83352 1.19973E-5 41676 0 8.02311E-6
2-202622215-C-T p.Gly461Arg missense ALS2 1 83364 1.19956E-5 41682 0 NA
2-202622222-T-C p.Ser458Ser synonymous ALS2 1 83360 1.19962E-5 41680 0 NA
2-202622248-T-A p.Arg450Trp missense ALS2 2 83354 2.3994E-5 41677 0 8.02047E-6
2-202622260-A-G p.Leu446Leu synonymous ALS2 1 83356 1.19967E-5 41678 0 8.28212E-6
2-202622267-G-A p.Pro443Pro synonymous ALS2 8 83338 9.59946E-5 41669 0 3.18492E-5
2-202622306-A-G p.Cys430Cys synonymous ALS2 1 83254 1.20114E-5 41627 0 3.18532E-5
2-202622313-G-T p.Thr428Asn missense ALS2 2 83224 2.40315E-5 41612 0 2.40602E-5
2-202622318-A-G p.Ser426Ser synonymous ALS2 1 83192 1.20204E-5 41596 0 NA
2-202622323-A-G p.Tyr425His missense ALS2 2 83172 2.40466E-5 41586 0 NA
2-202622331-A-G p.Met422Thr missense ALS2 2 83136 2.4057E-5 41568 0 9.55292E-5
2-202622342-C-T p.Leu418Leu synonymous ALS2 1 83100 1.20337E-5 41550 0 6.25E-4
2-202622353-C-T p.Ala415Thr missense ALS2 3 83018 3.61367E-5 41509 0 1.20349E-5
2-202622363-A-G p.Tyr411Tyr synonymous ALS2 1 83012 1.20465E-5 41506 0 8.02349E-6
2-202622364-T-C p.Tyr411Cys missense ALS2 1 82996 1.20488E-5 41498 0 8.28844E-6
2-202622370-G-C p.Ala409Gly missense ALS2 2 82976 2.41034E-5 41488 0 0.00704935
2-202622432-G-A p.Ser388Ser synonymous ALS2 9 83040 1.08382E-4 41520 0 1.41302E-4
2-202622433-C-T p.Ser388Asn missense ALS2 1 83036 1.2043E-5 41518 0 3.18451E-5
2-202622437-T-C p.Thr387Ala missense ALS2 1 83020 1.20453E-5 41510 0 4.04018E-6
2-202622438-G-T p.Thr386Thr synonymous ALS2 7 83006 8.43313E-5 41503 0 2.91055E-4
2-202622439-G-GA p.Thr386fs frameshift ALS2 1 82998 1.20485E-5 41499 0 NA
2-202622440-T-TATC p.Pro385_Thr386insAsp conservative_inframe_insertion ALS2 1 82976 1.20517E-5 41488 0 NA
2-202622444-C-T p.Pro384Pro synonymous ALS2 1 82916 1.20604E-5 41458 0 4.05282E-6
2-202622445-G-A p.Pro384Leu missense ALS2 3 82916 3.61812E-5 41458 0 4.16604E-5
2-202622448-C-A p.Ser383Ile missense ALS2 2 82892 2.41278E-5 41446 0 NA
2-202622453-GAGATT-G p.Asn380fs frameshift ALS2 2 82836 2.41441E-5 41418 0 NA
2-202622457-T-G p.Asn380Thr missense ALS2 1 82764 1.20825E-5 41382 0 NA
2-202622467-C-T p.Ala377Thr missense ALS2 8 82542 9.69204E-5 41271 0 4.92866E-5
2-202622481-G-C p.Pro372Arg missense+splice_region ALS2 106 82072 0.00129155 41036 0 0.00757576
2-202622489-T-C c.1114-7A>G splice_region ALS2 6 81638 7.34952E-5 40819 0 6.37186E-5
2-202624181-TTAAA-T c.*1341_*1344delTTTA splice_region ALS2 1 26484 3.77586E-5 13242 0 NA
2-202625549-A-G p.Phe390Leu missense ALS2 1 82836 1.2072E-5 41418 0 NA
2-202625561-T-C p.Asn386Asp missense ALS2 2 82966 2.41063E-5 41483 0 3.4559E-5
2-202625566-T-C p.Glu384Gly missense ALS2 1 83030 1.20438E-5 41515 0 NA
2-202625568-T-C p.Leu383Leu synonymous ALS2 1 83054 1.20404E-5 41527 0 3.18431E-5
2-202625570-GAC-G p.Cys382fs frameshift ALS2 1 83060 1.20395E-5 41530 0 9.96214E-6
2-202625575-A-G p.Val381Ala missense ALS2 25 83078 3.00922E-4 41539 0 4.45973E-4
2-202625577-T-G p.Lys380Asn missense ALS2 1 83102 1.20334E-5 41551 0 2.7894E-5
2-202625587-T-C p.Tyr377Cys missense ALS2 5 83176 6.01135E-5 41588 1 0.00100705
2-202625615-C-T p.Val368Met missense ALS2 64435 74318 0.867017 37159 27983 0.913327
2-202625616-T-G p.Pro367Pro synonymous ALS2 1 83262 1.20103E-5 41631 0 NA
2-202625626-C-T p.Gly364Asp missense ALS2 8 83276 9.60661E-5 41638 0 4.13881E-4
2-202625636-A-G p.Ser361Pro missense ALS2 1 83296 1.20054E-5 41648 0 NA
2-202625653-T-C p.His355Arg missense ALS2 2 83342 2.39975E-5 41671 0 NA
2-202625669-G-A p.Arg350Trp missense ALS2 5 83362 5.99794E-5 41681 0 5.03525E-4
2-202625680-T-C p.Asn346Ser missense ALS2 24 83378 2.87846E-4 41689 0 1.59215E-4
2-202625692-G-C p.Thr342Ser missense ALS2 1 83382 1.1993E-5 41691 0 NA
2-202625700-G-A p.Tyr339Tyr synonymous ALS2 1 83376 1.19939E-5 41688 0 4.00667E-6
2-202625708-GTA-G p.Ile336fs frameshift ALS2 1 83384 1.19927E-5 41692 0 NA
2-202625709-T-C p.Ile336Met missense ALS2 3 83382 3.5979E-5 41691 0 1.60267E-5
2-202625717-T-C p.Arg334Gly missense ALS2 2 83384 2.39854E-5 41692 0 1.20199E-5
2-202625720-C-A p.Ala333Ser missense ALS2 3 83382 3.5979E-5 41691 0 3.18613E-5
2-202625738-T-C p.Thr327Ala missense ALS2 2 83382 2.3986E-5 41691 0 0.00100705
2-202625756-GAGAGGACATGGC-G p.Ala317_Ser320del conservative_inframe_deletion ALS2 2 83368 2.399E-5 41684 0 NA
2-202625760-G-C p.Ser319Ser synonymous ALS2 1 83370 1.19947E-5 41685 0 6.36983E-5
2-202625761-G-A p.Ser319Phe missense ALS2 3 83368 3.5985E-5 41684 0 6.36943E-5
2-202625765-T-C p.Met318Val missense ALS2 3 83368 3.5985E-5 41684 0 NA
2-202625770-T-C p.Asp316Gly missense ALS2 1 83348 1.19979E-5 41674 0 4.0067E-6
2-202625771-C-T p.Asp316Asn missense ALS2 3 83352 3.59919E-5 41676 0 NA
2-202625780-T-C p.Thr313Ala missense ALS2 1 83354 1.1997E-5 41677 0 4.00673E-6
2-202625791-C-G p.Ser309Thr missense ALS2 3 83330 3.60014E-5 41665 0 3.18512E-5
2-202625796-T-G p.Ala307Ala synonymous ALS2 2 83326 2.40021E-5 41663 0 NA
2-202625799-A-G p.Asn306Asn synonymous ALS2 1 83332 1.20002E-5 41666 0 4.00683E-6
2-202625803-A-C p.Leu305Arg missense ALS2 1 83330 1.20005E-5 41665 0 4.00676E-6
2-202625813-C-T p.Ala302Thr missense ALS2 1 83314 1.20028E-5 41657 0 NA
2-202625830-G-T p.Ala296Glu missense ALS2 2 83304 2.40085E-5 41652 0 4.0075E-6
2-202625834-C-T p.Val295Ile missense ALS2 1 83314 1.20028E-5 41657 0 NA
2-202625839-G-A p.Thr293Ile missense ALS2 3 83310 3.60101E-5 41655 0 1.65601E-5
2-202625840-T-A p.Thr293Ser missense ALS2 1 83308 1.20036E-5 41654 0 NA
2-202625858-C-G p.Glu287Gln missense ALS2 1 83314 1.20028E-5 41657 0 4.00734E-6
2-202625860-T-C p.Gln286Arg missense ALS2 1 83320 1.20019E-5 41660 0 8.2802E-6
2-202625866-T-G p.Asp284Ala missense ALS2 1 83338 1.19993E-5 41669 0 8.2802E-6
2-202625867-C-T p.Asp284Asn missense ALS2 1 83340 1.1999E-5 41670 0 NA
2-202625903-C-T p.Ala272Thr missense ALS2 4 83364 4.79823E-5 41682 0 NA
2-202625905-T-C p.His271Arg missense ALS2 1 83364 1.19956E-5 41682 0 8.28089E-6
2-202625909-T-A p.Asn270Tyr missense ALS2 1 83360 1.19962E-5 41680 0 NA
2-202625916-C-A p.Gln267His missense ALS2 1 83362 1.19959E-5 41681 0 8.28144E-6
2-202625922-T-C p.Glu265Glu synonymous ALS2 3 83356 3.59902E-5 41678 0 NA
2-202625931-T-C p.Thr262Thr synonymous ALS2 1 83354 1.1997E-5 41677 0 4.00747E-6
2-202625934-C-T p.Val261Val synonymous ALS2 3 83354 3.59911E-5 41677 0 8.28144E-6
2-202625966-T-C p.Ile251Val missense ALS2 1 83324 1.20013E-5 41662 0 NA
2-202625974-T-C p.His248Arg missense ALS2 1 83292 1.2006E-5 41646 0 NA
2-202625992-A-G p.Met242Thr missense ALS2 10 83260 1.20106E-4 41630 0 2.23569E-4
2-202625993-T-C p.Met242Val missense ALS2 4 83254 4.80457E-5 41627 0 2.40473E-5
2-202626025-C-T p.Arg231Gln missense ALS2 1 83208 1.20181E-5 41604 0 NA
2-202626026-G-A p.Arg231* stop_gained ALS2 1 83206 1.20184E-5 41603 0 NA
2-202626031-G-A p.Pro229Leu missense ALS2 1 83204 1.20187E-5 41602 0 NA
2-202626038-G-A p.Pro227Ser missense ALS2 6 83200 7.21154E-5 41600 0 6.37227E-5
2-202626056-G-A p.Pro221Ser missense ALS2 2 83232 2.40292E-5 41616 0 4.0084E-6
2-202626057-G-C p.Leu220Leu synonymous ALS2 1 83238 1.20137E-5 41619 0 2.00417E-5
2-202626069-A-T p.Leu216Leu synonymous ALS2 1 83264 1.201E-5 41632 0 NA
2-202626088-G-T p.Ala210Asp missense ALS2 1 83288 1.20065E-5 41644 0 NA
2-202626089-C-T p.Ala210Thr missense ALS2 2 83292 2.40119E-5 41646 0 8.2949E-6
2-202626112-A-G p.Val202Ala missense ALS2 1 83314 1.20028E-5 41657 0 8.32251E-6
2-202626115-C-T p.Arg201Gln missense ALS2 1 83318 1.20022E-5 41659 0 NA
2-202626125-G-C p.Leu198Val missense ALS2 1 83334 1.19999E-5 41667 0 NA
2-202626127-T-C p.His197Arg missense ALS2 1 83338 1.19993E-5 41669 0 NA
2-202626141-C-G p.Pro192Pro synonymous ALS2 21 83342 2.51974E-4 41671 0 1.05247E-4
2-202626141-C-T p.Pro192Pro synonymous ALS2 3 83342 3.59963E-5 41671 0 3.18674E-5
2-202626160-G-C p.Ala186Gly missense ALS2 1 83338 1.19993E-5 41669 0 NA
2-202626184-C-A p.Cys178Phe missense ALS2 2 83322 2.40033E-5 41661 0 0.00151057
2-202626188-C-T p.Gly177Ser missense ALS2 1 83318 1.20022E-5 41659 0 NA
2-202626189-G-A p.Thr176Thr synonymous ALS2 8 83304 9.60338E-5 41652 0 9.24906E-5
2-202626198-T-C p.Ala173Ala synonymous ALS2 3 83288 3.60196E-5 41644 0 8.34042E-6
2-202626209-C-T p.Glu170Lys missense ALS2 1 83282 1.20074E-5 41641 0 3.1837E-5
2-202626213-G-T p.Ser168Arg missense ALS2 1 83274 1.20085E-5 41637 0 NA
2-202626228-C-T p.Leu163Leu synonymous ALS2 1 83254 1.20114E-5 41627 0 8.29683E-6
2-202626242-C-T p.Glu159Lys missense ALS2 386 83224 0.00463809 41612 7 0.00905433
2-202626243-G-A p.Gly158Gly synonymous ALS2 2 83216 2.40338E-5 41608 0 6.37064E-5
2-202626249-C-T p.Ala156Ala synonymous ALS2 3 83228 3.60456E-5 41614 0 0.00100705
2-202626267-G-T p.Val150Val synonymous ALS2 2 83234 2.40286E-5 41617 0 NA
2-202626269-C-G p.Val150Leu missense ALS2 2 83236 2.40281E-5 41618 0 NA
2-202626314-T-G p.Asn135His missense ALS2 1 83206 1.20184E-5 41603 0 8.28267E-6
2-202626321-C-T p.Pro132Pro synonymous ALS2 8 83206 9.61469E-5 41603 0 6.37146E-5
2-202626322-G-A p.Pro132Leu missense ALS2 1 83210 1.20178E-5 41605 0 7.61554E-5
2-202626328-T-C p.Tyr130Cys missense ALS2 1 83204 1.20187E-5 41602 0 NA
2-202626339-G-C p.Ala126Ala synonymous ALS2 1 83166 1.20241E-5 41583 0 4.00831E-6
2-202626351-C-T p.Gln122Gln synonymous ALS2 6 83146 7.21622E-5 41573 0 6.36862E-5
2-202626359-C-A p.Ala120Ser missense ALS2 3 83108 3.60976E-5 41554 0 1.27437E-4
2-202626368-C-G p.Glu117Gln missense ALS2 2 83086 2.40714E-5 41543 0 8.28542E-6
2-202626373-C-G p.Trp115Ser missense ALS2 1 83092 1.20349E-5 41546 0 NA
2-202626378-G-A p.Tyr113Tyr synonymous ALS2 1 83048 1.20412E-5 41524 0 3.18634E-5
2-202626381-C-G p.Ala112Ala synonymous ALS2 1 83014 1.20462E-5 41507 0 NA
2-202626382-G-A p.Ala112Val missense ALS2 1 82994 1.20491E-5 41497 0 6.25E-4
2-202626384-G-A p.Val111Val synonymous ALS2 2 82978 2.41028E-5 41489 0 3.18857E-5
2-202626384-G-T p.Val111Val synonymous ALS2 1 82978 1.20514E-5 41489 0 NA
2-202626386-C-T p.Val111Ile missense ALS2 25 83002 3.01198E-4 41501 0 0.0040282
2-202626388-C-A p.Gly110Val missense ALS2 4 82988 4.81997E-5 41494 0 8.28816E-6
2-202626393-G-A p.Asp108Asp synonymous ALS2 1 82998 1.20485E-5 41499 0 NA
2-202626404-C-T p.Ala105Thr missense ALS2 2 82938 2.41144E-5 41469 0 5.80412E-5
2-202626417-G-A p.Ser100Ser synonymous ALS2 5 82914 6.03034E-5 41457 0 6.25E-4
2-202626422-C-T p.Gly99Arg missense ALS2 2 82890 2.41284E-5 41445 0 NA
2-202626437-T-C p.Ile94Val missense ALS2 2170 82638 0.0262591 41319 46 0.0303755
2-202626444-T-C p.Gln91Gln synonymous ALS2 1 82660 1.20978E-5 41330 0 8.30317E-6
2-202626445-T-C p.Gln91Arg missense ALS2 1 82650 1.20992E-5 41325 0 8.30317E-6
2-202626450-A-G p.Val89Val synonymous ALS2 4 82596 4.84285E-5 41298 0 5.03525E-4
2-202626461-T-A p.Asn86Tyr missense ALS2 1 82506 1.21203E-5 41253 0 NA
2-202626503-T-C p.Ser72Gly missense ALS2 2 80666 2.47936E-5 40333 0 1.62318E-5
2-202626517-G-C p.Thr67Ser missense ALS2 1 79198 1.26266E-5 39599 0 NA
2-202626529-T-C p.Tyr63Cys missense ALS2 1 77996 1.28212E-5 38998 0 4.08027E-6
2-202626543-T-C c.176-2A>G splice_acceptor ALS2 3 75424 3.97751E-5 37712 0 NA
2-202626548-G-A c.176-7C>T splice_region ALS2 2 73480 2.72183E-5 36740 0 3.429E-5
2-202630513-T-C n.352+1A>G splice_donor ALS2 6429 42548 0.1511 21274 517 0.1709
2-202630548-T-C n.318A>G splice_region ALS2 1 42678 2.34313E-5 21339 0 NA
2-202630548-T-G n.318A>C splice_region ALS2 1 42678 2.34313E-5 21339 0 NA
2-202630553-G-GA n.316-4_316-3insT splice_region ALS2 4 42204 9.47777E-5 21102 0 1.02326E-4
2-202631948-T-C c.175+4A>G splice_region ALS2 2 82442 2.42595E-5 41221 0 8.28089E-6
2-202631968-T-G p.Gly53Gly synonymous ALS2 1 82614 1.21045E-5 41307 0 NA
2-202631982-C-T p.Gly49Arg missense ALS2 1 82726 1.20881E-5 41363 0 3.18979E-5
2-202631983-G-A p.Leu48Leu synonymous ALS2 1 82736 1.20866E-5 41368 0 0.00151057
2-202631986-G-A p.Ala47Ala synonymous ALS2 1 82822 1.20741E-5 41411 0 NA
2-202631986-G-C p.Ala47Ala synonymous ALS2 1 82822 1.20741E-5 41411 0 1.65615E-5
2-202631996-A-G p.Leu44Ser missense ALS2 2 82964 2.41068E-5 41482 0 1.65626E-5
2-202631998-A-T p.Val43Val synonymous ALS2 1 82992 1.20494E-5 41496 0 NA
2-202632039-T-C p.Ile30Val missense ALS2 1 83002 1.20479E-5 41501 0 9.56511E-5
2-202632041-G-C p.Pro29Arg missense ALS2 1 82990 1.20496E-5 41495 0 8.28555E-6
2-202632066-G-A p.His21Tyr missense ALS2 1 82840 1.20715E-5 41420 0 NA
2-202632067-G-C p.Val20Val synonymous ALS2 1 82828 1.20732E-5 41414 0 8.30041E-6
2-202632090-C-T p.Gly13Arg missense ALS2 3 82688 3.6281E-5 41344 0 6.81767E-5
2-202632092-T-C p.Glu12Gly missense ALS2 4 82682 4.83781E-5 41341 0 3.18674E-5
2-202632108-T-TTCTCTTCTTTG c.21-3_21-2insCAAAGAAGAGA splice_region ALS2 1 82446 1.21292E-5 41223 0 NA
2-202633582-A-G c.20+7T>C splice_region ALS2 12471 81936 0.152204 40968 1096 0.198994
2-202633607-A-G p.Met1? start_lost ALS2 2 82416 2.42671E-5 41208 0 4.00949E-6
2-202633653-G-A c.-45C>T 5_prime_UTR_premature_start_codon_gain ALS2 60 81774 7.3373E-4 40887 0 0.00197232
2-202633668-C-T c.-60G>A splice_region ALS2 5 81138 6.16234E-5 40569 0 NA
2-202633670-T-C c.-60-2A>G splice_acceptor ALS2 1 80804 1.23756E-5 40402 0 6.51169E-5
2-202633672-A-C c.-60-4T>G splice_region ALS2 1 80876 1.23646E-5 40438 0 NA
2-202645593-C-A c.-61+7G>T splice_region ALS2 4 43686 9.15625E-5 21843 0 NA
2-202645595-C-T c.-61+5G>A splice_region ALS2 1 43618 2.29263E-5 21809 0 NA
2-202645613-G-A c.-74C>T 5_prime_UTR_premature_start_codon_gain ALS2 1 43242 2.31257E-5 21621 0 3.18674E-5
2-202645617-G-A c.-78C>T 5_prime_UTR_premature_start_codon_gain ALS2 2 43168 4.63306E-5 21584 0 NA
2-202645703-G-A c.-164C>T 5_prime_UTR_premature_start_codon_gain ALS2 2 36188 5.52669E-5 18094 0 NA
2-202645707-G-A c.-168C>T 5_prime_UTR_premature_start_codon_gain ALS2 3 35084 8.55091E-5 17542 0 NA
2-202645866-G-A c.-327C>T 5_prime_UTR_premature_start_codon_gain ALS2 1 5030 1.98807E-4 2515 0 7.96584E-4