Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
17-7942342-C-T c.-132C>T 5_prime_UTR_premature_start_codon_gain ALOX15B 1 72170 1.38562E-5 36085 0 NA
17-7942343-G-A c.-131G>A 5_prime_UTR_premature_start_codon_gain ALOX15B 1 71446 1.39966E-5 35723 0 NA
17-7942446-C-T c.-28C>T 5_prime_UTR_premature_start_codon_gain ALOX15B 1 82326 1.21468E-5 41163 0 8.56062E-6
17-7942475-T-A p.Met1? start_lost ALOX15B 1 82610 1.21051E-5 41305 0 6.25E-4
17-7942478-C-T p.Ala2Val missense ALOX15B 1 82592 1.21077E-5 41296 0 4.00606E-6
17-7942479-C-A p.Ala2Ala synonymous ALOX15B 1 82580 1.21095E-5 41290 0 3.18573E-5
17-7942503-C-T p.Thr10Thr synonymous ALOX15B 2 82702 2.41832E-5 41351 0 3.19867E-5
17-7942510-G-A p.Ala13Thr missense ALOX15B 1 82774 1.20811E-5 41387 0 NA
17-7942511-C-G p.Ala13Gly missense ALOX15B 1 82764 1.20825E-5 41382 0 6.25E-4
17-7942515-CG-C p.Ala16fs frameshift ALOX15B 1 82768 1.2082E-5 41384 0 NA
17-7942516-G-A p.Gly15Arg missense ALOX15B 400 82758 0.00483337 41379 8 0.0118486
17-7942523-G-A p.Gly17Asp missense ALOX15B 1 82776 1.20808E-5 41388 0 3.18532E-5
17-7942527-A-G p.Thr18Thr synonymous ALOX15B 2 82790 2.41575E-5 41395 0 2.81384E-5
17-7942529-G-C p.Trp19Ser missense ALOX15B 1 82792 1.20785E-5 41396 0 NA
17-7942534-A-G p.Lys21Glu missense ALOX15B 1 82770 1.20817E-5 41385 0 NA
17-7942556-G-A p.Gly28Glu missense ALOX15B 1 82604 1.2106E-5 41302 0 4.14271E-6
17-7942562-G-A p.Arg30Gln missense ALOX15B 1 82564 1.21118E-5 41282 0 3.18613E-5
17-7942567-G-T p.Glu32* stop_gained ALOX15B 1 82516 1.21189E-5 41258 0 NA
17-7942569-G-C p.Glu32Asp missense ALOX15B 1 82498 1.21215E-5 41249 0 NA
17-7942571-G-GC p.Leu36fs frameshift ALOX15B 3 82434 3.63928E-5 41217 0 6.37227E-5
17-7942571-GC-G p.Pro35fs frameshift ALOX15B 6 82438 7.2782E-5 41219 0 5.24283E-5
17-7942582-C-T p.Pro37Ser missense ALOX15B 1 82452 1.21283E-5 41226 0 3.51401E-5
17-7942592-A-G p.Asn40Ser missense ALOX15B 2 82394 2.42736E-5 41197 0 8.82955E-6
17-7942593-T-C p.Asn40Asn synonymous ALOX15B 1 82380 1.21389E-5 41190 0 NA
17-7942597-G-A p.Gly42Ser missense ALOX15B 1 82292 1.21518E-5 41146 0 3.18471E-5
17-7942599-C-CA p.Glu44fs frameshift ALOX15B 2 82280 2.43072E-5 41140 0 NA
17-7942609-A-G p.Thr46Ala missense ALOX15B 1 82218 1.21628E-5 41109 0 4.408E-6
17-7942614-G-A p.Ala47Ala synonymous ALOX15B 3 82208 3.64928E-5 41104 0 NA
17-7942618-G-C p.Ala49Pro missense+splice_region ALOX15B 1 82224 1.21619E-5 41112 0 8.90551E-6
17-7942620-TGTGAGTGCGTGGGAGTGGATGGGGTGGAGGTGAAGGGGGCGAGCAGGAGGGTCCGGCCTGACGCATACTTAACCTCCCCTCAG-T c.147+1_148-1delGTGAGTGCGTGGGAGTGGATGGGGTGGAGGTGAAGGGGGCGAGCAGGAGGGTCCGGCCTGACGCATACTTAACCTCCCCTCAG splice_acceptor ALOX15B 2 82224 2.43238E-5 41112 1 NA
17-7942620-TGTGA-T c.147+1_147+4delGTGA splice_donor ALOX15B 1 82224 1.21619E-5 41112 0 NA
17-7942699-C-T c.148-5C>T splice_region ALOX15B 7 81816 8.55578E-5 40908 0 6.12159E-4
17-7942702-A-G c.148-2A>G splice_acceptor ALOX15B 1 81786 1.2227E-5 40893 0 8.09317E-6
17-7942704-G-A p.Glu50Lys missense+splice_region ALOX15B 1 81784 1.22273E-5 40892 0 3.18756E-5
17-7942712-C-G p.Asp52Glu missense ALOX15B 1 81646 1.2248E-5 40823 0 NA
17-7942722-A-G p.Thr56Ala missense ALOX15B 3 81402 3.68541E-5 40701 0 9.57121E-5
17-7942723-C-T p.Thr56Met missense ALOX15B 1 81380 1.2288E-5 40690 0 9.12226E-6
17-7942724-G-C p.Thr56Thr synonymous ALOX15B 1 81314 1.2298E-5 40657 0 9.15717E-6
17-7942729-C-T p.Pro58Leu missense ALOX15B 1 81262 1.23059E-5 40631 0 9.27781E-6
17-7942730-G-A p.Pro58Pro synonymous ALOX15B 1 81256 1.23068E-5 40628 0 4.06623E-6
17-7942733-G-T p.Glu59Asp missense ALOX15B 2 81250 2.46154E-5 40625 0 NA
17-7942734-G-T p.Asp60Tyr missense ALOX15B 1 81246 1.23083E-5 40623 0 NA
17-7942737-G-A p.Val61Ile missense ALOX15B 2 81162 2.46421E-5 40581 0 0.003125
17-7942738-T-TAGGCCGA p.Val64fs frameshift ALOX15B 19 81156 2.34117E-4 40578 0 7.33325E-4
17-7942739-AG-A p.Gly62fs frameshift ALOX15B 2 81136 2.465E-5 40568 0 4.07924E-6
17-7942743-C-T p.Arg63* stop_gained ALOX15B 1 81006 1.23448E-5 40503 0 4.09179E-6
17-7942768-A-T p.Lys71Met missense ALOX15B 1 80230 1.24642E-5 40115 0 1.28405E-5
17-7942771-C-T p.Ala72Val missense ALOX15B 2 79990 2.50031E-5 39995 0 NA
17-7942775-C-T p.Pro73Pro synonymous ALOX15B 2 79900 2.50313E-5 39950 0 1.1425E-4
17-7942778-A-G p.Pro74Pro synonymous ALOX15B 1 79812 1.25294E-5 39906 0 3.18939E-5
17-7942785-C-G p.Pro77Ala missense ALOX15B 967 79354 0.0121859 39677 44 0.0259637
17-7942794-G-C p.Gly80Arg missense ALOX15B 2 78744 2.53988E-5 39372 0 9.75267E-5
17-7942797-C-T p.Pro81Ser missense ALOX15B 152 78388 0.00193907 39194 0 0.00320291
17-7942798-C-A p.Pro81His missense ALOX15B 3 78340 3.82946E-5 39170 0 4.34764E-5
17-7942807-C-G p.Pro84Arg missense ALOX15B 21 77814 2.69874E-4 38907 0 6.37674E-4
17-7942807-C-CGGATG p.Ala86fs frameshift ALOX15B 1 77814 1.28512E-5 38907 0 2.62812E-5
17-7942814-C-T p.Ala86Ala synonymous ALOX15B 2354 77348 0.0304339 38674 86 0.0561332
17-7942821-T-TGCCGCTGGTTCCAGCTGACACC p.Arg98fs frameshift ALOX15B 2 77096 2.59417E-5 38548 0 1.15568E-5
17-7942821-T-TGCCGCTGGTTCC p.Phe92_Gln93insArgArgTrpPhe disruptive_inframe_insertion ALOX15B 1 77100 1.29702E-5 38550 0 5.77841E-5
17-7942824-C-T p.Arg90Cys missense ALOX15B 6 76770 7.81555E-5 38385 0 6.38162E-5
17-7942827-T-C p.Trp91Arg missense ALOX15B 5 76698 6.51907E-5 38349 0 1.20861E-4
17-7942833-C-T p.Gln93* stop_gained ALOX15B 2 76348 2.61958E-5 38174 0 NA
17-7942836-C-T p.Leu94Leu synonymous ALOX15B 6 75798 7.91578E-5 37899 0 4.85248E-5
17-7942845-C-CT p.Pro97fs frameshift ALOX15B 1 74662 1.33937E-5 37331 0 NA
17-7942845-C-A p.Pro97Thr missense ALOX15B 1 74662 1.33937E-5 37331 0 6.37755E-4
17-7942846-C-CTGGAA p.Arg98fs frameshift ALOX15B 1 74498 1.34232E-5 37249 0 NA
17-7942848-C-T p.Arg98Trp missense ALOX15B 7 74008 9.45844E-5 37004 0 9.61107E-5
17-7942853-C-A p.Gly99Gly synonymous ALOX15B 291 73376 0.00396587 36688 5 0.00903151
17-7942854-G-A p.Gly100Ser missense ALOX15B 1 73330 1.3637E-5 36665 0 6.89826E-6
17-7942856-C-T p.Gly100Gly synonymous ALOX15B 1 73054 1.36885E-5 36527 0 6.93905E-6
17-7942863-C-T p.Leu103Phe missense ALOX15B 1 72606 1.3773E-5 36303 0 NA
17-7942865-C-T p.Leu103Leu synonymous ALOX15B 1 72314 1.38286E-5 36157 0 NA
17-7942868-C-A p.Phe104Leu missense ALOX15B 1 71872 1.39136E-5 35936 0 1.42617E-5
17-7942869-C-G p.Pro105Ala missense ALOX15B 2 71632 2.79205E-5 35816 0 NA
17-7942869-C-A p.Pro105Thr missense ALOX15B 2 71634 2.79197E-5 35817 0 NA
17-7942887-GA-G p.Glu111fs frameshift ALOX15B 1 68930 1.45075E-5 34465 0 NA
17-7942890-G-A p.Gly112Arg missense ALOX15B 1 68530 1.45921E-5 34265 0 6.70241E-5
17-7942901-C-G p.Thr115Thr synonymous ALOX15B 20005 64044 0.312363 32022 3358 0.330968
17-7942928-G-A c.367+5G>A splice_region ALOX15B 11 64484 1.70585E-4 32242 0 6.47668E-4
17-7942931-G-C c.367+8G>C splice_region ALOX15B 2 63672 3.1411E-5 31836 0 1.27869E-4
17-7943215-C-T c.368-5C>T splice_region ALOX15B 23 82802 2.77771E-4 41401 0 1.91534E-4
17-7943232-G-A p.Trp127* stop_gained ALOX15B 1 82918 1.20601E-5 41459 0 NA
17-7943237-G-A p.Asp129Asn missense ALOX15B 1 82916 1.20604E-5 41458 0 NA
17-7943238-A-G p.Asp129Gly missense ALOX15B 1 82898 1.2063E-5 41449 0 NA
17-7943249-G-A p.Val133Met missense ALOX15B 10 82946 1.2056E-4 41473 0 3.19387E-4
17-7943265-G-A p.Arg138His missense ALOX15B 5 82954 6.02744E-5 41477 0 1.27812E-4
17-7943265-G-T p.Arg138Leu missense ALOX15B 4 82954 4.82195E-5 41477 0 3.1953E-5
17-7943275-G-C p.Glu141Asp missense ALOX15B 9 82904 1.08559E-4 41452 0 3.32403E-5
17-7943283-C-T p.Ala144Val missense ALOX15B 1 82852 1.20697E-5 41426 0 3.98661E-6
17-7943283-C-A p.Ala144Asp missense ALOX15B 1 82852 1.20697E-5 41426 0 NA
17-7943284-C-T p.Ala144Ala synonymous ALOX15B 1 82814 1.20753E-5 41407 0 5.8309E-5
17-7943285-C-G p.Arg145Gly missense ALOX15B 1 82818 1.20747E-5 41409 0 7.97741E-6
17-7943286-G-A p.Arg145Gln missense ALOX15B 1 82800 1.20773E-5 41400 0 1.25065E-4
17-7943286-G-C p.Arg145Pro missense ALOX15B 1 82800 1.20773E-5 41400 0 2.50129E-5
17-7943287-G-C p.Arg145Arg synonymous ALOX15B 2 82790 2.41575E-5 41395 0 3.98826E-6
17-7943293-G-T p.Glu147Asp missense ALOX15B 1 82704 1.20913E-5 41352 0 NA
17-7943295-T-C p.Met148Thr missense ALOX15B 1 82682 1.20945E-5 41341 0 1.19796E-5
17-7943296-G-A p.Met148Ile missense ALOX15B 1 82676 1.20954E-5 41338 0 NA
17-7943300-C-T p.Gln150* stop_gained ALOX15B 3 82638 3.63029E-5 41319 0 2.79749E-5
17-7943301-A-C p.Gln150Pro missense+splice_region ALOX15B 1 82616 1.21042E-5 41308 0 NA
17-7943309-G-A c.449+8G>A splice_region ALOX15B 1 82538 1.21156E-5 41269 0 NA
17-7945713-C-G p.Pro159Arg missense ALOX15B 8 83300 9.60384E-5 41650 0 6.25E-4
17-7945715-C-T p.His160Tyr missense ALOX15B 1 83300 1.20048E-5 41650 0 8.24783E-6
17-7945725-A-G p.Asp163Gly missense ALOX15B 87 83306 0.00104434 41653 0 0.00149701
17-7945726-T-A p.Asp163Glu missense ALOX15B 5 83320 6.00096E-5 41660 0 3.18552E-5
17-7945727-G-A p.Glu164Lys missense ALOX15B 1 83320 1.20019E-5 41660 0 NA
17-7945734-C-T p.Thr166Ile missense ALOX15B 2 83316 2.4005E-5 41658 0 NA
17-7945736-G-A p.Val167Met missense ALOX15B 2 83324 2.40027E-5 41662 0 NA
17-7945743-A-G p.Asp169Gly missense ALOX15B 2 83304 2.40085E-5 41652 0 3.1841E-5
17-7945751-C-T p.Leu172Phe missense ALOX15B 1 83294 1.20057E-5 41647 0 8.2462E-6
17-7945755-A-G p.Asn173Ser missense ALOX15B 1 83280 1.20077E-5 41640 0 2.78405E-5
17-7945757-A-G p.Ile174Val missense ALOX15B 4 83282 4.80296E-5 41641 0 5.03525E-4
17-7945784-A-G p.Asn183Asp missense ALOX15B 2 83150 2.40529E-5 41575 0 3.97918E-6
17-7945796-C-T p.Gln187* stop_gained ALOX15B 1 82978 1.20514E-5 41489 0 NA
17-7945808-G-A p.Ala191Thr missense+splice_region ALOX15B 1 82646 1.20998E-5 41323 0 6.37349E-5
17-7945809-C-T p.Ala191Val missense+splice_region ALOX15B 1 82590 1.2108E-5 41295 0 0.00151057
17-7945810-G-A c.572+1G>A splice_donor ALOX15B 7 82568 8.47786E-5 41284 0 1.41998E-4
17-7945813-A-C c.572+4A>C splice_region ALOX15B 2 82482 2.42477E-5 41241 0 NA
17-7946108-G-A p.Glu194Glu synonymous ALOX15B 1 81108 1.23292E-5 40554 0 1.85925E-4
17-7946110-T-C p.Met195Thr missense ALOX15B 1 81132 1.23256E-5 40566 0 NA
17-7946113-A-C p.Lys196Thr missense ALOX15B 1 81156 1.23219E-5 40578 0 NA
17-7946133-C-T p.Arg203Cys missense ALOX15B 1 81274 1.23041E-5 40637 0 4.47307E-5
17-7946134-G-A p.Arg203His missense ALOX15B 7 81294 8.61072E-5 40647 0 0.00620476
17-7946137-A-G p.Lys204Arg missense ALOX15B 1 81322 1.22968E-5 40661 0 NA
17-7946142-C-T p.Leu206Phe missense ALOX15B 1 81338 1.22944E-5 40669 0 NA
17-7946148-A-G p.Arg208Gly missense ALOX15B 1 81344 1.22935E-5 40672 0 3.18674E-5
17-7946173-TCTTCAA-T p.Asn218_Phe219del conservative_inframe_deletion ALOX15B 2 81396 2.45712E-5 40698 0 3.18857E-5
17-7946179-A-C p.Asn218Thr missense ALOX15B 10 81400 1.2285E-4 40700 0 2.50969E-5
17-7946188-G-T p.Arg221Met missense ALOX15B 5 81370 6.14477E-5 40685 0 NA
17-7946188-G-C p.Arg221Thr missense ALOX15B 1 81370 1.22895E-5 40685 0 6.33264E-6
17-7946199-G-A p.Ala225Thr missense ALOX15B 1 81330 1.22956E-5 40665 0 NA
17-7948140-C-A c.677-7C>A splice_region ALOX15B 15 81566 1.839E-4 40783 0 1.82758E-4
17-7948147-A-G p.Glu226Gly missense+splice_region ALOX15B 3 82004 3.65836E-5 41002 0 NA
17-7948151-C-T p.His227His synonymous ALOX15B 11 82238 1.33758E-4 41119 0 8.39053E-6
17-7948152-G-T p.Ala228Ser missense ALOX15B 2 82276 2.43084E-5 41138 0 8.37128E-6
17-7948152-G-A p.Ala228Thr missense ALOX15B 4 82276 4.86169E-5 41138 0 5.04032E-4
17-7948165-G-A p.Trp232* stop_gained ALOX15B 1 82746 1.20852E-5 41373 0 NA
17-7948175-C-T p.Asp235Asp synonymous ALOX15B 39467 81392 0.4849 40696 10050 0.53901
17-7948178-C-T p.Ala236Ala synonymous ALOX15B 1 82922 1.20595E-5 41461 0 NA
17-7948184-C-T p.Phe238Phe synonymous ALOX15B 1 83012 1.20465E-5 41506 0 1.64883E-5
17-7948185-G-A p.Ala239Thr missense ALOX15B 3 82978 3.61542E-5 41489 0 6.40656E-5
17-7948195-T-C p.Phe242Ser missense ALOX15B 1 83092 1.20349E-5 41546 0 NA
17-7948204-G-C p.Gly245Ala missense ALOX15B 1 83144 1.20273E-5 41572 0 NA
17-7948218-C-T p.Leu250Leu synonymous ALOX15B 6 83176 7.21362E-5 41588 0 0.0020141
17-7948219-T-C p.Leu250Pro missense ALOX15B 1 83158 1.20253E-5 41579 0 3.97671E-6
17-7948224-C-T p.Arg252Cys missense ALOX15B 4 83196 4.80792E-5 41598 0 3.97662E-6
17-7948225-G-A p.Arg252His missense ALOX15B 1 83178 1.20224E-5 41589 0 9.57549E-5
17-7948227-C-T p.Arg253Cys missense ALOX15B 1 83192 1.20204E-5 41596 0 2.38593E-5
17-7948239-C-T p.Leu257Phe missense ALOX15B 351 83218 0.00421784 41609 0 0.00379295
17-7948250-CT-C p.Phe261fs frameshift ALOX15B 1 83222 1.20161E-5 41611 0 NA
17-7948253-C-G p.Phe261Leu missense ALOX15B 2 83216 2.40338E-5 41608 0 4.94332E-5
17-7948257-G-A p.Val263Ile missense ALOX15B 17 83134 2.04489E-4 41567 0 1.59408E-4
17-7948257-G-T p.Val263Phe missense ALOX15B 2 83134 2.40575E-5 41567 0 9.14658E-5
17-7948269-A-G p.Met267Val missense ALOX15B 5 83022 6.0225E-5 41511 0 9.56206E-5
17-7948271-G-C p.Met267Ile missense ALOX15B 1 83034 1.20433E-5 41517 0 3.18735E-5
17-7948293-G-A p.Gly275Arg missense ALOX15B 9 83092 1.08314E-4 41546 0 6.25E-4
17-7948295-G-T p.Gly275Gly synonymous ALOX15B 2 83084 2.4072E-5 41542 0 3.97753E-6
17-7948303-T-G p.Leu278Trp missense ALOX15B 3 83106 3.60985E-5 41553 0 NA
17-7948305-C-T p.Gln279* stop_gained ALOX15B 1 83088 1.20354E-5 41544 0 NA
17-7948308-G-T p.Ala280Ser missense ALOX15B 1 83076 1.20372E-5 41538 0 NA
17-7948312-A-C p.Glu281Ala missense ALOX15B 1 83092 1.20349E-5 41546 0 NA
17-7948552-G-T c.850-4G>T splice_region ALOX15B 2 83216 2.40338E-5 41608 0 7.95995E-6
17-7948563-C-T p.Ser286Phe missense ALOX15B 1 83222 1.20161E-5 41611 0 NA
17-7948564-C-T p.Ser286Ser synonymous ALOX15B 2 83222 2.40321E-5 41611 0 NA
17-7948565-C-T p.Leu287Leu synonymous ALOX15B 5 83228 6.00759E-5 41614 0 1.64737E-5
17-7948582-C-T p.His292His synonymous ALOX15B 3 83258 3.60326E-5 41629 0 6.37024E-5
17-7948593-CT-C p.Gly297fs frameshift ALOX15B 1 83300 1.20048E-5 41650 0 8.23723E-6
17-7948632-T-C p.Phe309Ser missense ALOX15B 8 83264 9.60799E-5 41632 0 3.82971E-4
17-7948638-C-T p.Ala311Val missense ALOX15B 168 83232 0.00201845 41616 0 0.00597037
17-7948640-G-T p.Ala312Ser missense ALOX15B 177 83230 0.00212664 41615 3 0.0034846
17-7948646-A-T p.Met314Leu missense ALOX15B 2 83248 2.40246E-5 41624 0 9.5584E-5
17-7948646-A-G p.Met314Val missense ALOX15B 2 83248 2.40246E-5 41624 0 5.77101E-5
17-7948655-C-T p.Leu317Leu synonymous ALOX15B 1 83202 1.20189E-5 41601 0 NA
17-7948660-C-G p.Tyr318* stop_gained ALOX15B 1 83186 1.20213E-5 41593 0 7.96331E-5
17-7948661-C-T p.Gln319* stop_gained ALOX15B 3 83180 3.60664E-5 41590 0 NA
17-7948675-C-T p.Cys323Cys synonymous ALOX15B 13 83080 1.56476E-4 41540 2 0.00125
17-7948676-G-A p.Gly324Arg missense ALOX15B 1 83084 1.2036E-5 41542 0 3.18634E-5
17-7948680-C-T p.Pro325Leu missense ALOX15B 11 83076 1.32409E-4 41538 0 1.91156E-4
17-7948681-G-A p.Pro325Pro synonymous ALOX15B 3 83054 3.61211E-5 41527 0 3.18552E-5
17-7948691-C-G p.Leu329Val missense ALOX15B 2 83060 2.4079E-5 41530 0 8.26023E-6
17-7948693-C-T p.Leu329Leu synonymous ALOX15B 7 83046 8.42906E-5 41523 0 6.25E-4
17-7948694-G-A p.Ala330Thr missense ALOX15B 22 82982 2.65118E-4 41491 0 1.98268E-4
17-7948793-C-T c.997-8C>T splice_region ALOX15B 3 83048 3.61237E-5 41524 0 NA
17-7948795-C-T c.997-6C>T splice_region ALOX15B 33 83076 3.97227E-4 41538 0 6.0525E-4
17-7948798-C-A c.997-3C>A splice_region ALOX15B 1 83094 1.20346E-5 41547 0 3.18634E-5
17-7948806-C-T p.Ser334Ser synonymous ALOX15B 1 83106 1.20328E-5 41553 0 3.98032E-5
17-7948815-C-T p.Pro337Pro synonymous ALOX15B 1 83150 1.20265E-5 41575 0 3.30142E-5
17-7948816-G-A p.Gly338Ser missense ALOX15B 3 83124 3.60907E-5 41562 0 6.6024E-5
17-7948829-C-T p.Pro342Leu missense ALOX15B 3 83222 3.60482E-5 41611 0 5.03525E-4
17-7948834-T-C p.Phe344Leu missense ALOX15B 2 83226 2.4031E-5 41613 0 5.03525E-4
17-7948837-C-T p.Leu345Leu synonymous ALOX15B 4 83236 4.80561E-5 41618 0 2.47419E-5
17-7948842-C-A p.Pro346Pro synonymous ALOX15B 1 83250 1.2012E-5 41625 0 NA
17-7948853-A-G p.Lys350Arg missense ALOX15B 4 83256 4.80446E-5 41628 0 2.47313E-5
17-7948854-G-A p.Lys350Lys synonymous ALOX15B 4 83256 4.80446E-5 41628 0 2.3861E-5
17-7948864-T-C p.Leu354Leu synonymous ALOX15B 2 83258 2.40217E-5 41629 0 8.24171E-6
17-7948878-C-T p.Thr358Thr synonymous ALOX15B 2 83244 2.40258E-5 41622 0 1.19303E-5
17-7948882-G-A p.Val360Met missense ALOX15B 1 83244 1.20129E-5 41622 0 3.18776E-5
17-7948885-C-T p.Arg361Cys missense ALOX15B 21 83220 2.52343E-4 41610 0 0.00251762
17-7948886-G-A p.Arg361His missense ALOX15B 35 83216 4.20592E-4 41608 0 7.01218E-4
17-7948890-T-G p.Asn362Lys missense ALOX15B 2 83246 2.40252E-5 41623 0 NA
17-7948893-C-T p.Ala363Ala synonymous ALOX15B 1 83250 1.2012E-5 41625 0 5.03525E-4
17-7948894-G-A p.Glu364Lys missense ALOX15B 3 83254 3.60343E-5 41627 0 5.03525E-4
17-7948901-C-T p.Ser366Phe missense ALOX15B 2 83252 2.40234E-5 41626 0 8.24266E-6
17-7948907-A-G p.His368Arg missense ALOX15B 1 83244 1.20129E-5 41622 0 8.24429E-6
17-7948909-G-A p.Glu369Lys missense ALOX15B 2 83230 2.40298E-5 41615 0 3.97744E-6
17-7948911-G-T p.Glu369Asp missense ALOX15B 2 83234 2.40286E-5 41617 0 8.24674E-6
17-7948919-C-T p.Thr372Met missense ALOX15B 2 83198 2.4039E-5 41599 0 0.00100705
17-7948920-G-A p.Thr372Thr synonymous ALOX15B 3 83190 3.6062E-5 41595 0 7.55774E-5
17-7948924-C-T p.Leu374Leu synonymous ALOX15B 2 83192 2.40408E-5 41596 0 0.00100705
17-7948932-C-A p.His376Gln missense ALOX15B 3 83174 3.6069E-5 41587 0 1.15544E-4
17-7948950-G-T p.Glu382Asp missense ALOX15B 4 83106 4.81313E-5 41553 0 3.18552E-5
17-7948953-C-A p.Val383Val synonymous ALOX15B 2 83102 2.40668E-5 41551 0 NA
17-7948958-C-A p.Thr385Asn missense ALOX15B 16 83076 1.92595E-4 41538 0 1.59215E-4
17-7948963-G-GC p.Thr388fs frameshift ALOX15B 2 83032 2.40871E-5 41516 0 4.14896E-5
17-7948973-G-A p.Arg390His missense ALOX15B 1 82976 1.20517E-5 41488 0 6.37024E-5
17-7948978-C-T p.Leu392Leu synonymous ALOX15B 1 82940 1.20569E-5 41470 0 8.37353E-6
17-7948990-C-T p.His396Tyr missense ALOX15B 2 82808 2.41523E-5 41404 0 NA
17-7949007-C-T c.1200+3C>T splice_region ALOX15B 1 82592 1.21077E-5 41296 0 NA
17-7949982-G-T c.1201-4G>T splice_region ALOX15B 1 82608 1.21054E-5 41304 0 NA
17-7949988-G-A p.Leu401Leu splice_region+synonymous ALOX15B 4 82710 4.83617E-5 41355 0 9.34772E-6
17-7949990-T-C p.Leu402Pro missense ALOX15B 1 82758 1.20834E-5 41379 0 NA
17-7949994-C-A p.Ile403Ile synonymous ALOX15B 1 82782 1.20799E-5 41391 0 3.99412E-6
17-7949996-C-T p.Pro404Leu missense ALOX15B 1 82792 1.20785E-5 41396 0 6.31837E-5
17-7949997-G-A p.Pro404Pro synonymous ALOX15B 2 82790 2.41575E-5 41395 0 6.3743E-5
17-7950018-C-A p.His411Gln missense ALOX15B 2 82882 2.41307E-5 41441 0 8.63081E-6
17-7950020-T-C p.Ile412Thr missense ALOX15B 1 82882 1.20653E-5 41441 0 3.18695E-5
17-7950023-A-T p.Asn413Ile missense ALOX15B 1 82876 1.20662E-5 41438 0 NA
17-7950030-CGCCCGGGA-C p.Arg417fs frameshift ALOX15B 19 82822 2.29408E-4 41411 0 1.0765E-4
17-7950030-C-G p.Leu415Leu synonymous ALOX15B 2 82822 2.41482E-5 41411 0 NA
17-7950031-G-T p.Ala416Ser missense ALOX15B 3 82788 3.62371E-5 41394 0 4.28964E-5
17-7950034-C-A p.Arg417Arg synonymous ALOX15B 143 82746 0.00172818 41373 0 0.00331337
17-7950034-C-T p.Arg417Trp missense ALOX15B 41 82750 4.95468E-4 41375 0 4.02783E-4
17-7950035-G-A p.Arg417Gln missense ALOX15B 4 82758 4.83337E-5 41379 0 6.25E-4
17-7950040-C-G p.Leu419Val missense ALOX15B 2 82724 2.41768E-5 41362 0 3.98721E-6
17-7950048-C-T p.Ile421Ile synonymous ALOX15B 1 82682 1.20945E-5 41341 0 NA
17-7950049-G-A p.Val422Met missense ALOX15B 3 82676 3.62862E-5 41338 0 3.18552E-5
17-7950062-T-G p.Val426Gly missense ALOX15B 1 82508 1.212E-5 41254 0 NA
17-7950079-G-A c.1287+7G>A splice_region ALOX15B 1 82030 1.21907E-5 41015 0 3.18593E-5
17-7950216-GTC-G c.1201-8_1201-7delTC splice_region ALOX15B 2 82812 2.41511E-5 41406 0 3.98346E-6
17-7950220-C-T c.1201-5C>T splice_region ALOX15B 1 82906 1.20619E-5 41453 0 NA
17-7950236-C-T p.Ile404Ile synonymous ALOX15B 1 83032 1.20435E-5 41516 0 4.9456E-5
17-7950237-G-A p.Gly405Ser missense ALOX15B 20 83040 2.40848E-4 41520 0 3.82385E-4
17-7950238-G-A p.Gly405Asp missense ALOX15B 1 83066 1.20386E-5 41533 0 NA
17-7950247-G-T p.Gly408Val missense ALOX15B 1 83154 1.20259E-5 41577 0 NA
17-7950263-A-G p.Ile413Met missense ALOX15B 2 83220 2.40327E-5 41610 0 3.29522E-5
17-7950265-A-G p.Gln414Arg missense ALOX15B 335 83212 0.00402586 41606 2 0.00350519
17-7950297-C-A p.Leu425Met missense ALOX15B 2 83302 2.4009E-5 41651 0 3.9764E-6
17-7950305-G-T p.Leu427Leu synonymous ALOX15B 1 83320 1.20019E-5 41660 0 1.97707E-4
17-7950308-TGAGGATATCCGGACCC-T p.Asp430fs frameshift ALOX15B 1 83326 1.20011E-5 41663 0 3.18674E-5
17-7950318-C-T p.Arg432Trp missense ALOX15B 4 83318 4.80088E-5 41659 0 5.16989E-5
17-7950319-G-A p.Arg432Gln missense ALOX15B 275 83312 0.00330084 41656 1 0.01625
17-7950324-C-T p.Arg434* stop_gained ALOX15B 24 83310 2.88081E-4 41655 1 7.25091E-4
17-7950325-G-A p.Arg434Gln missense ALOX15B 2 83308 2.40073E-5 41654 0 0.00100705
17-7950336-GACATCCCAGGCTACT-G p.Ile439_Tyr443del conservative_inframe_deletion ALOX15B 3 83324 3.6004E-5 41662 0 NA
17-7950357-C-T p.Arg445Cys missense ALOX15B 6 83294 7.2034E-5 41647 0 3.18634E-5
17-7950377-C-T p.Ile451Ile synonymous ALOX15B 25282 82762 0.305478 41381 4158 0.330254
17-7950380-G-C p.Trp452Cys missense+splice_region ALOX15B 1 83254 1.20114E-5 41627 0 NA
17-7950393-C-T p.Arg457Cys missense+splice_region ALOX15B 1 83196 1.20198E-5 41598 0 6.37674E-5
17-7950394-G-A p.Arg457His missense+splice_region ALOX15B 4465 83148 0.0536994 41574 273 0.0946626
17-7950401-G-A c.1370+7G>A splice_region ALOX15B 1 83180 1.20221E-5 41590 0 NA
17-7950568-C-G c.1371-8C>G splice_region ALOX15B 4 83206 4.80735E-5 41603 0 2.47521E-5
17-7950569-A-G c.1371-7A>G splice_region ALOX15B 3 83210 3.60534E-5 41605 0 3.19122E-5
17-7950577-T-A p.Phe458Ile missense+splice_region ALOX15B 1 83220 1.20163E-5 41610 0 NA
17-7950594-C-T p.Ile463Ile synonymous ALOX15B 7 83234 8.41002E-5 41617 0 6.25E-4
17-7950595-G-A p.Gly464Ser missense ALOX15B 5 83224 6.00788E-5 41612 0 6.59239E-5
17-7950602-A-G p.Tyr466Cys missense ALOX15B 1 83244 1.20129E-5 41622 0 5.03525E-4
17-7950603-C-G p.Tyr466* stop_gained ALOX15B 1 83250 1.2012E-5 41625 0 8.24008E-6
17-7950605-AC-A p.Pro468fs frameshift ALOX15B 7 83246 8.40881E-5 41623 0 9.57854E-5
17-7950633-CAG-C p.Glu478fs frameshift ALOX15B 1 83234 1.20143E-5 41617 0 NA
17-7950643-C-T p.Gln480* stop_gained ALOX15B 2 83188 2.40419E-5 41594 0 6.25E-4
17-7950646-G-T p.Ala481Ser missense ALOX15B 1 83162 1.20247E-5 41581 0 3.1904E-5
17-7950647-C-A p.Ala481Asp missense ALOX15B 2 83156 2.40512E-5 41578 0 5.17043E-5
17-7950653-T-C p.Val483Ala missense ALOX15B 1 83128 1.20296E-5 41564 0 3.9775E-6
17-7950659-A-G p.Glu485Gly missense ALOX15B 1 83100 1.20337E-5 41550 0 NA
17-7950661-A-T p.Ile486Phe missense ALOX15B 1 83088 1.20354E-5 41544 0 6.38325E-5
17-7950692-G-A p.Ser496Asn missense ALOX15B 43 82746 5.19663E-4 41373 0 0.00187735
17-7950698-G-A c.1492+1G>A splice_donor ALOX15B 2 82650 2.41984E-5 41325 0 3.19142E-5
17-7950699-T-G c.1492+2T>G splice_donor ALOX15B 5 82610 6.05254E-5 41305 0 3.19244E-5
17-7950888-C-T p.Pro500Leu missense ALOX15B 2 81322 2.45936E-5 40661 0 4.28339E-6
17-7950895-A-G p.Ser502Ser synonymous ALOX15B 6 81400 7.37101E-5 40700 0 1.59642E-4
17-7950903-C-G p.Thr505Ser missense ALOX15B 2 81624 2.45026E-5 40812 1 NA
17-7950905-C-T p.Arg506Trp missense ALOX15B 2 81642 2.44972E-5 40821 0 6.61358E-5
17-7950905-C-G p.Arg506Gly missense ALOX15B 1 81642 1.22486E-5 40821 0 NA
17-7950906-G-A p.Arg506Gln missense ALOX15B 3 81690 3.67242E-5 40845 0 1.24674E-5
17-7950914-C-G p.Leu509Val missense ALOX15B 1 81778 1.22282E-5 40889 0 4.11482E-6
17-7950918-T-C p.Val510Ala missense ALOX15B 2 81728 2.44714E-5 40864 0 NA
17-7950919-G-A p.Val510Val synonymous ALOX15B 1 81756 1.22315E-5 40878 0 5.03525E-4
17-7950952-C-A p.Ser521Ser synonymous ALOX15B 32952 80748 0.408084 40374 7005 0.450383
17-7950953-G-A p.Ala522Thr missense ALOX15B 1 81714 1.22378E-5 40857 0 2.78329E-5
17-7950958-G-A p.Lys523Lys synonymous ALOX15B 3066 81626 0.0375616 40813 69 0.0437403
17-7950959-C-T p.His524Tyr missense ALOX15B 1 81750 1.22324E-5 40875 0 NA
17-7950963-C-T p.Ala525Val missense ALOX15B 2 81638 2.44984E-5 40819 0 2.4871E-4
17-7950964-G-A p.Ala525Ala synonymous ALOX15B 21 81648 2.57202E-4 40824 0 1.66104E-4
17-7950968-G-A p.Val527Ile missense ALOX15B 16 81664 1.95925E-4 40832 0 4.86563E-5
17-7950978-G-C p.Gly530Ala missense ALOX15B 1 81484 1.22723E-5 40742 0 3.18695E-5
17-7950990-A-G c.1593+8A>G splice_region ALOX15B 1 81220 1.23122E-5 40610 0 9.00641E-6
17-7951060-C-T c.1594-3C>T splice_region ALOX15B 1 79618 1.256E-5 39809 0 NA
17-7951062-G-A c.1594-1G>A splice_acceptor ALOX15B 2 79580 2.51319E-5 39790 0 6.37024E-5
17-7951065-T-G p.Phe532Leu missense+splice_region ALOX15B 1 79532 1.25736E-5 39766 0 8.25709E-6
17-7951077-T-C p.Ala536Ala synonymous ALOX15B 1 79792 1.25326E-5 39896 0 NA
17-7951080-G-A p.Trp537* stop_gained ALOX15B 1 79780 1.25345E-5 39890 0 NA
17-7951092-G-A p.Leu541Leu synonymous ALOX15B 2 79966 2.50106E-5 39983 0 NA
17-7951092-G-T p.Leu541Leu synonymous ALOX15B 3 79966 3.75159E-5 39983 0 4.37978E-5
17-7951097-C-T p.Pro543Leu missense ALOX15B 2 80226 2.49296E-5 40113 0 3.98073E-6
17-7951107-G-A p.Gln546Gln synonymous ALOX15B 1 80500 1.24224E-5 40250 0 3.18796E-5
17-7951112-C-G p.Pro548Arg missense ALOX15B 2 80800 2.47525E-5 40400 0 NA
17-7951114-C-G p.Pro549Ala missense ALOX15B 1 80864 1.23664E-5 40432 0 3.97896E-6
17-7951121-C-A p.Thr551Asn missense ALOX15B 1 81156 1.23219E-5 40578 0 3.97864E-6
17-7951130-G-T p.Gly554Val missense ALOX15B 1 81394 1.22859E-5 40697 0 NA
17-7951143-C-A p.Cys558* stop_gained ALOX15B 1 81694 1.22408E-5 40847 0 1.19344E-5
17-7951143-C-T p.Cys558Cys synonymous ALOX15B 3 81694 3.67224E-5 40847 0 5.04032E-4
17-7951147-G-A p.Gly560Ser missense ALOX15B 1 81800 1.22249E-5 40900 0 3.18573E-5
17-7951149-C-T p.Gly560Gly synonymous ALOX15B 4031 81622 0.0493862 40811 317 0.0920457
17-7951153-A-G p.Ile562Val missense ALOX15B 7 81930 8.54388E-5 40965 0 9.55962E-5
17-7951161-C-T p.Thr564Thr synonymous ALOX15B 3 82028 3.65729E-5 41014 0 7.42084E-5
17-7951169-C-T p.Pro567Leu missense ALOX15B 6 82082 7.30976E-5 41041 0 8.24933E-6
17-7951175-A-G p.Asn569Ser missense ALOX15B 2 82058 2.4373E-5 41029 0 3.97785E-6
17-7951176-TG-T p.Ala570fs frameshift ALOX15B 1 82090 1.21818E-5 41045 0 NA
17-7951177-G-A p.Ala570Thr missense ALOX15B 1 82070 1.21847E-5 41035 0 NA
17-7951182-A-G p.Thr571Thr synonymous ALOX15B 1 82024 1.21916E-5 41012 0 3.18715E-5
17-7951212-G-A p.Leu581Leu synonymous ALOX15B 3 81316 3.68931E-5 40658 0 NA
17-7951218-G-A p.Lys583Lys synonymous ALOX15B 1 80988 1.23475E-5 40494 0 NA
17-7951232-A-C p.Gln588Pro missense+splice_region ALOX15B 2 80116 2.49638E-5 40058 0 NA
17-7951233-A-G p.Gln588Gln splice_region+synonymous ALOX15B 2 80052 2.49838E-5 40026 0 8.58266E-6
17-7951696-A-C c.1765-8A>C splice_region ALOX15B 5 83012 6.02323E-5 41506 0 6.37227E-5
17-7951705-G-C p.Arg589Thr missense+splice_region ALOX15B 1 83092 1.20349E-5 41546 0 4.02337E-6
17-7951706-G-A p.Arg589Arg splice_region+synonymous ALOX15B 1 83082 1.20363E-5 41541 0 4.02414E-6
17-7951724-G-A p.Pro595Pro synonymous ALOX15B 4 83176 4.80908E-5 41588 0 3.18634E-5
17-7951730-G-C p.Glu597Asp missense ALOX15B 1 83192 1.20204E-5 41596 0 3.18573E-5
17-7951752-C-T p.Arg605Trp missense ALOX15B 3 83188 3.60629E-5 41594 0 3.18634E-5
17-7951755-C-T p.Arg606Trp missense ALOX15B 21 83194 2.52422E-4 41597 0 6.03655E-4
17-7951756-G-A p.Arg606Gln missense ALOX15B 976 83178 0.0117339 41589 34 0.0256296
17-7951757-G-C p.Arg606Arg synonymous ALOX15B 2 83196 2.40396E-5 41598 0 NA
17-7951761-A-G p.Ile608Val missense ALOX15B 2 83210 2.40356E-5 41605 0 NA
17-7951762-T-C p.Ile608Thr missense ALOX15B 1 83218 1.20166E-5 41609 0 8.25832E-6
17-7951764-G-A p.Ala609Thr missense ALOX15B 4 83206 4.80735E-5 41603 0 3.18735E-5
17-7951765-C-T p.Ala609Val missense ALOX15B 1 83210 1.20178E-5 41605 0 3.18552E-5
17-7951772-C-T p.Phe611Phe synonymous ALOX15B 1 83226 1.20155E-5 41613 0 1.19368E-5
17-7951774-A-G p.Gln612Arg missense ALOX15B 21 83234 2.52301E-4 41617 0 6.37186E-5
17-7951779-C-T p.Arg614Cys missense ALOX15B 5 83234 6.00716E-5 41617 0 5.11509E-4
17-7951780-G-T p.Arg614Leu missense ALOX15B 2 83230 2.40298E-5 41615 0 1.19384E-5
17-7951780-G-A p.Arg614His missense ALOX15B 1 83230 1.20149E-5 41615 0 1.03466E-4
17-7951795-C-T p.Ser619Leu missense ALOX15B 3 83258 3.60326E-5 41629 0 3.18715E-5
17-7951796-G-A p.Ser619Ser synonymous ALOX15B 1 83258 1.20109E-5 41629 0 1.64929E-5
17-7951809-G-T p.Glu624* stop_gained ALOX15B 6 83292 7.20357E-5 41646 0 6.25E-4
17-7951813-G-A p.Arg625Gln missense ALOX15B 13 83306 1.56051E-4 41653 0 8.75232E-5
17-7951817-C-A p.Asn626Lys missense ALOX15B 1 83312 1.20031E-5 41656 0 NA
17-7951818-CA-TG p.Gln627Trp missense ALOX15B 1 83308 1.20036E-5 41654 0 NA
17-7951818-C-T p.Gln627* stop_gained ALOX15B 3 83308 3.60109E-5 41654 0 4.77411E-5
17-7951819-A-G p.Gln627Arg missense ALOX15B 45773 82902 0.552134 41451 13087 0.601686
17-7951822-G-A p.Gly628Asp missense ALOX15B 94 83320 0.00112818 41660 0 0.00199515
17-7951838-C-T p.Tyr633Tyr synonymous ALOX15B 31 83314 3.72086E-4 41657 0 2.55801E-4
17-7951843-A-G p.Tyr635Cys missense ALOX15B 1 83320 1.20019E-5 41660 0 NA
17-7951862-C-T p.Ile641Ile synonymous ALOX15B 2 83314 2.40056E-5 41657 0 7.97512E-6
17-7951862-C-G p.Ile641Met missense ALOX15B 3 83312 3.60092E-5 41656 0 1.23614E-4
17-7951863-G-C p.Glu642Gln missense ALOX15B 9 83304 1.08038E-4 41652 0 4.47487E-4
17-7951867-A-G p.Asn643Ser missense ALOX15B 1 83306 1.20039E-5 41653 0 3.18613E-5
17-7951870-G-T p.Ser644Ile missense ALOX15B 1 83300 1.20048E-5 41650 0 8.29972E-6
17-7951872-G-A p.Val645Ile missense ALOX15B 5 83292 6.00298E-5 41646 0 6.25E-4
17-7951877-C-T p.Ser646Ser synonymous ALOX15B 1 83294 1.20057E-5 41647 0 NA
17-7951878-A-G p.Ile647Val missense ALOX15B 3625 83160 0.0435907 41580 225 0.079736
17-7951882-A-G p.Ter603Ter splice_region ALOX15B 4 83286 4.80273E-5 41643 0 3.18715E-5