Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
17-4534781-G-A c.*114C>T splice_region ALOX15 23 79076 2.90859E-4 39538 0 3.18817E-4
17-4534782-G-A c.*113C>T splice_region ALOX15 7 79126 8.84665E-5 39563 0 NA
17-4534896-T-TA p.Ter663fs frameshift ALOX15 2 83282 2.40148E-5 41641 0 3.98508E-6
17-4534918-C-T p.Val656Met missense ALOX15 1 83314 1.20028E-5 41657 0 NA
17-4534922-G-A p.Ser654Ser synonymous ALOX15 2 83310 2.40067E-5 41655 0 5.96948E-5
17-4534928-C-A p.Arg652Arg synonymous ALOX15 1 83304 1.20042E-5 41652 0 NA
17-4534930-G-A p.Arg652Trp missense ALOX15 2 83322 2.40033E-5 41661 0 3.29554E-5
17-4534931-C-T p.Leu651Leu synonymous ALOX15 1 83326 1.20011E-5 41663 0 NA
17-4534932-AG-A p.Leu651fs frameshift ALOX15 3 83330 3.60014E-5 41665 0 3.97947E-6
17-4534940-G-A p.Tyr648Tyr synonymous ALOX15 4 83340 4.79962E-5 41670 0 3.18552E-5
17-4534943-G-C p.Pro647Pro synonymous ALOX15 22 83338 2.63985E-4 41669 0 0.00206543
17-4534943-G-A p.Pro647Pro synonymous ALOX15 1 83338 1.19993E-5 41669 0 NA
17-4534954-G-C p.Leu644Val missense ALOX15 1 83352 1.19973E-5 41676 0 NA
17-4534965-C-T p.Arg640Gln missense ALOX15 9 83376 1.07945E-4 41688 0 8.2375E-6
17-4534966-G-A p.Arg640Trp missense ALOX15 6 83372 7.19666E-5 41686 0 1.27413E-4
17-4534970-C-T p.Glu638Glu synonymous ALOX15 1 83374 1.19941E-5 41687 0 1.27421E-4
17-4534990-C-A p.Ala632Ser missense ALOX15 1 83378 1.19936E-5 41689 0 NA
17-4535008-ACTT-A p.Lys625del conservative_inframe_deletion ALOX15 1 83338 1.19993E-5 41669 0 NA
17-4535028-G-C p.Pro619Arg missense ALOX15 2 83314 2.40056E-5 41657 0 6.37105E-5
17-4535034-G-A p.Pro617Leu missense ALOX15 1 83300 1.20048E-5 41650 0 8.24022E-6
17-4535035-G-A p.Pro617Ser missense ALOX15 1083 83292 0.0130024 41646 29 0.027121
17-4535039-C-G p.Ser615Ser synonymous ALOX15 3 83292 3.60179E-5 41646 0 3.1904E-5
17-4535039-C-T p.Ser615Ser synonymous ALOX15 2 83292 2.40119E-5 41646 0 3.1904E-5
17-4535040-G-A p.Ser615Leu missense ALOX15 2 83292 2.40119E-5 41646 0 9.56572E-5
17-4535046-T-C p.Tyr613Cys missense ALOX15 3 83274 3.60256E-5 41637 0 NA
17-4535047-ACTC-A p.Glu612del conservative_inframe_deletion ALOX15 1 83272 1.20088E-5 41636 0 1.99469E-5
17-4535049-T-C p.Glu612Gly missense ALOX15 4 83282 4.80296E-5 41641 0 6.37267E-5
17-4535056-C-T p.Glu610Lys missense ALOX15 2 83260 2.40211E-5 41630 0 NA
17-4535057-A-G p.His609His synonymous ALOX15 1 83256 1.20111E-5 41628 0 6.37633E-5
17-4535058-T-A p.His609Leu missense ALOX15 1 83254 1.20114E-5 41627 0 NA
17-4535066-C-T p.Val606Val synonymous ALOX15 1 83210 1.20178E-5 41605 0 NA
17-4535071-CCACCTGGGAGGGAGAGGAAAAGGTGGCTGAGAGCCTTATGACCCCCAGTCTGGGATGCCACACGTCCCCACAGCTGCCTCCTTCCTTAGGGCCCTGGGCACTCAGCTCT-C p.Val604_Ala605del splice_acceptor ALOX15 2 83202 2.40379E-5 41601 0 NA
17-4535075-CTGGGAGGGAGAGGAAAAGGTGGCTGAGAGCCTTATG-C c.1810-37_1810-2delCATAAGGCTCTCAGCCACCTTTTCCTCTCCCTCCCA splice_acceptor ALOX15 1 83196 1.20198E-5 41598 0 NA
17-4535077-G-A c.1810-3C>T splice_region ALOX15 2 83166 2.40483E-5 41583 0 7.98703E-6
17-4535185-A-G p.Met603Thr missense+splice_region ALOX15 2 83076 2.40743E-5 41538 0 NA
17-4535186-T-C p.Met603Val missense+splice_region ALOX15 141 83060 0.00169757 41530 0 0.00251762
17-4535187-A-G p.Val602Val synonymous ALOX15 2 83060 2.4079E-5 41530 0 8.398E-6
17-4535189-C-T p.Val602Ile missense ALOX15 3 83046 3.61246E-5 41523 0 8.40774E-6
17-4535190-G-A p.Pro601Pro synonymous ALOX15 17 83026 2.04755E-4 41513 0 3.02328E-4
17-4535195-G-A p.Gln600* stop_gained ALOX15 1 83068 1.20383E-5 41534 0 NA
17-4535197-C-T p.Arg599His missense ALOX15 1 83060 1.20395E-5 41530 0 4.01629E-6
17-4535198-G-A p.Arg599Cys missense ALOX15 3 83082 3.61089E-5 41541 0 5.86569E-5
17-4535201-T-C p.Arg598Gly missense ALOX15 1 83102 1.20334E-5 41551 0 NA
17-4535204-C-G p.Gly597Arg missense ALOX15 1 83102 1.20334E-5 41551 0 2.50928E-5
17-4535206-A-G p.Leu596Pro missense ALOX15 5 83112 6.01598E-5 41556 0 3.18451E-5
17-4535210-G-T p.Gln595Lys missense ALOX15 2 83102 2.40668E-5 41551 0 1.66889E-5
17-4535211-C-T p.Trp594* stop_gained ALOX15 2 83108 2.40651E-5 41554 0 1.19749E-5
17-4535216-T-A p.Thr593Ser missense ALOX15 1 83136 1.20285E-5 41568 0 NA
17-4535237-C-A p.Ala586Ser missense ALOX15 1 83162 1.20247E-5 41581 0 8.27102E-6
17-4535248-T-C p.Asn582Ser missense ALOX15 1 83176 1.20227E-5 41588 0 3.18573E-5
17-4535251-G-A p.Pro581Leu missense ALOX15 1 83170 1.20236E-5 41585 0 NA
17-4535256-T-C p.Thr579Thr synonymous ALOX15 1 83164 1.20244E-5 41582 0 NA
17-4535259-C-T p.Ala578Ala synonymous ALOX15 1 83168 1.20239E-5 41584 0 1.59229E-5
17-4535259-C-G p.Ala578Ala synonymous ALOX15 1 83168 1.20239E-5 41584 0 NA
17-4535260-G-A p.Ala578Val missense ALOX15 3 83172 3.60698E-5 41586 0 4.7776E-5
17-4535262-C-T p.Met577Ile missense ALOX15 1 83186 1.20213E-5 41593 0 NA
17-4535278-G-A p.Thr572Met missense ALOX15 1 83184 1.20215E-5 41592 0 3.30497E-5
17-4535281-G-A p.Ala571Val missense ALOX15 17 83174 2.04391E-4 41587 0 7.9647E-5
17-4535289-G-A p.Thr568Thr synonymous ALOX15 2 83156 2.40512E-5 41578 0 9.55353E-5
17-4535291-TGGTTGGC-T p.Thr567fs frameshift ALOX15 2 83142 2.40552E-5 41571 0 8.27048E-6
17-4535294-T-C p.Thr567Ala missense ALOX15 1 83134 1.20288E-5 41567 0 1.27489E-4
17-4535298-C-T p.Pro565Pro synonymous ALOX15 89 83084 0.00107121 41542 0 0.00197528
17-4535299-G-A p.Pro565Leu missense ALOX15 23 83112 2.76735E-4 41556 0 2.22916E-4
17-4535301-G-A p.Pro564Pro synonymous ALOX15 1406 83102 0.016919 41551 70 0.0367043
17-4535304-C-T p.Leu563Leu synonymous ALOX15 1 83112 1.2032E-5 41556 0 8.31919E-6
17-4535308-C-T p.Arg562Gln missense ALOX15 10 83114 1.20317E-4 41557 0 5.03525E-4
17-4535309-G-A p.Arg562Trp missense ALOX15 10 83100 1.20337E-4 41550 0 0.001875
17-4535313-C-T p.Thr560Thr synonymous ALOX15 2 83088 2.40709E-5 41544 0 1.99695E-5
17-4535314-G-A p.Thr560Met missense ALOX15 1517 83058 0.0182643 41529 32 0.0274146
17-4535333-C-T p.Val554Met missense ALOX15 6 83062 7.22352E-5 41531 0 3.18492E-5
17-4535340-G-C p.Tyr551* stop_gained ALOX15 1 83054 1.20404E-5 41527 0 8.32972E-6
17-4535351-GCTAAGGAAGGGCAGGGATCCAGAGTCAGTGCCTACCAAGCACGCGAGCCCCGTGGTCCACCTGCACACAGACCCCTCCCTCACTCCAGGCCCCAAATTCCCAGCTGCCCATCTCTGGTAAGTAC-G c.1641+1_1642-1del splice_acceptor ALOX15 3 83014 3.61385E-5 41507 1 NA
17-4535353-T-G c.1642-2A>C splice_acceptor ALOX15 6 83010 7.22804E-5 41505 0 6.37227E-5
17-4535353-T-C c.1642-2A>G splice_acceptor ALOX15 5 83010 6.02337E-5 41505 0 2.50192E-5
17-4535476-C-T p.Gln547Gln splice_region+synonymous ALOX15 2 83222 2.40321E-5 41611 0 5.03525E-4
17-4535496-C-T p.Ala541Thr missense ALOX15 2 83226 2.4031E-5 41613 0 NA
17-4535497-G-A p.His540His synonymous ALOX15 8 83240 9.61076E-5 41620 0 1.63069E-4
17-4535499-GT-G p.Gln539fs frameshift ALOX15 11 83242 1.32145E-4 41621 0 9.55475E-5
17-4535503-G-C p.Gly538Gly synonymous ALOX15 2 83224 2.40315E-5 41612 0 3.977E-5
17-4535506-G-A p.Thr537Thr synonymous ALOX15 1 83224 1.20158E-5 41612 0 8.23927E-5
17-4535525-A-G p.Met531Thr missense ALOX15 40 83242 4.80527E-4 41621 0 0.005625
17-4535528-G-T p.Thr530Asn missense ALOX15 2 83250 2.4024E-5 41625 0 NA
17-4535537-T-G p.His527Pro missense ALOX15 1 83218 1.20166E-5 41609 0 NA
17-4535539-G-A p.Cys526Cys synonymous ALOX15 22 83210 2.64391E-4 41605 0 0.00100705
17-4535545-C-A p.Gln524His missense ALOX15 1 83208 1.20181E-5 41604 0 3.97738E-6
17-4535553-G-A p.Arg522Trp missense ALOX15 3 83246 3.60378E-5 41623 0 3.18431E-5
17-4535566-G-A p.Val517Val synonymous ALOX15 2 83212 2.4035E-5 41606 0 3.9781E-6
17-4535571-G-A p.Pro516Ser missense ALOX15 1 83178 1.20224E-5 41589 0 8.27568E-6
17-4535576-C-T p.Gly514Glu missense+splice_region ALOX15 2 83132 2.40581E-5 41566 0 NA
17-4535583-G-A c.1541-7C>T splice_region ALOX15 1 83054 1.20404E-5 41527 0 1.5929E-5
17-4536158-C-T p.Arg513Gln missense+splice_region ALOX15 2 83264 2.402E-5 41632 0 1.99026E-5
17-4536159-G-A p.Arg513* stop_gained ALOX15 3 83274 3.60256E-5 41637 0 3.1902E-5
17-4536159-G-T p.Arg513Arg synonymous ALOX15 1 83274 1.20085E-5 41637 0 NA
17-4536165-G-A p.Gln511* stop_gained ALOX15 1 83312 1.20031E-5 41656 0 3.19081E-5
17-4536180-C-T p.Gly506Arg missense ALOX15 2 83334 2.39998E-5 41667 0 6.38203E-5
17-4536181-G-A p.Ile505Ile synonymous ALOX15 3 83334 3.59997E-5 41667 0 7.95469E-5
17-4536196-T-C p.Arg500Arg synonymous ALOX15 1 83360 1.19962E-5 41680 0 3.97684E-6
17-4536198-G-A p.Arg500* stop_gained ALOX15 5 83354 5.99851E-5 41677 0 1.63058E-4
17-4536214-C-T p.Glu494Glu synonymous ALOX15 2 83362 2.39917E-5 41681 0 3.97668E-6
17-4536222-C-T p.Asp492Asn missense ALOX15 2 83350 2.39952E-5 41675 0 9.54464E-5
17-4536231-C-T p.Val489Met missense ALOX15 1 83354 1.1997E-5 41677 0 NA
17-4536237-C-A p.Val487Leu missense ALOX15 1 83346 1.19982E-5 41673 0 3.18959E-5
17-4536238-G-A p.Asp486Asp synonymous ALOX15 1 83340 1.1999E-5 41670 0 4.94226E-5
17-4536241-T-C p.Thr485Thr synonymous ALOX15 8460 83194 0.10169 41597 535 0.10574
17-4536247-A-G p.Tyr483Tyr synonymous ALOX15 1 83330 1.20005E-5 41665 0 NA
17-4536248-T-G p.Tyr483Ser missense ALOX15 2 83330 2.4001E-5 41665 0 3.97693E-6
17-4536260-A-G p.Val479Ala missense ALOX15 1 83300 1.20048E-5 41650 0 3.29495E-5
17-4536261-C-T p.Val479Met missense ALOX15 3 83304 3.60127E-5 41652 0 3.9775E-6
17-4536262-G-C p.Ile478Met missense ALOX15 1 83304 1.20042E-5 41652 0 3.97744E-6
17-4536266-C-T p.Gly477Glu missense ALOX15 1 83304 1.20042E-5 41652 0 3.97725E-6
17-4536277-C-T p.Arg473Arg splice_region+synonymous ALOX15 2 83268 2.40188E-5 41634 0 6.37836E-5
17-4536279-T-C c.1419-2A>G splice_acceptor ALOX15 1 83270 1.20091E-5 41635 0 NA
17-4536280-A-C c.1419-3T>G splice_region ALOX15 4 83252 4.80469E-5 41626 0 8.23845E-6
17-4536281-C-T c.1419-4G>A splice_region ALOX15 1 83246 1.20126E-5 41623 0 NA
17-4536433-T-A c.1418+8A>T splice_region ALOX15 1 83184 1.20215E-5 41592 0 5.73687E-4
17-4536436-C-T c.1418+5G>A splice_region ALOX15 1 83194 1.20201E-5 41597 0 NA
17-4536441-C-T p.Arg473Gln missense+splice_region ALOX15 2 83208 2.40361E-5 41604 0 3.3274E-5
17-4536442-G-A p.Arg473Trp missense+splice_region ALOX15 2 83212 2.4035E-5 41606 0 9.14578E-5
17-4536442-G-C p.Arg473Gly missense+splice_region ALOX15 1 83212 1.20175E-5 41606 0 8.31435E-6
17-4536449-G-T p.Ile470Ile synonymous ALOX15 1 83222 1.20161E-5 41611 0 NA
17-4536455-C-T p.Trp468* stop_gained ALOX15 1 83242 1.20132E-5 41621 0 NA
17-4536462-C-T p.Arg466Gln missense ALOX15 3 83226 3.60464E-5 41613 0 3.18634E-5
17-4536463-G-A p.Arg466Trp missense ALOX15 19 83232 2.28278E-4 41616 0 1.8322E-4
17-4536464-C-T p.Leu465Leu synonymous ALOX15 2 83244 2.40258E-5 41622 0 NA
17-4536467-C-T p.Ala464Ala synonymous ALOX15 2 83224 2.40315E-5 41612 0 3.98159E-6
17-4536467-C-G p.Ala464Ala synonymous ALOX15 1 83224 1.20158E-5 41612 0 1.19448E-5
17-4536468-G-A p.Ala464Val missense ALOX15 3 83214 3.60516E-5 41607 0 3.30868E-5
17-4536471-T-A p.Asp463Val missense ALOX15 6 83216 7.21015E-5 41608 0 3.18634E-5
17-4536472-C-A p.Asp463Tyr missense ALOX15 1 83208 1.20181E-5 41604 0 NA
17-4536480-T-C p.Tyr460Cys missense ALOX15 3 83200 3.60577E-5 41600 0 3.18735E-5
17-4536494-C-T p.Val455Val synonymous ALOX15 1 83170 1.20236E-5 41585 0 7.96064E-6
17-4536496-C-T p.Val455Met missense ALOX15 1 83172 1.20233E-5 41586 0 NA
17-4536499-C-T p.Gly454Arg missense ALOX15 5 83160 6.01251E-5 41580 0 7.96356E-6
17-4536510-C-G p.Arg450Pro missense ALOX15 1 83138 1.20282E-5 41569 0 NA
17-4536511-G-A p.Arg450Trp missense ALOX15 2 83112 2.40639E-5 41556 0 3.18634E-5
17-4536514-C-T p.Asp449Asn missense ALOX15 1 83124 1.20302E-5 41562 0 6.37389E-5
17-4536515-G-A p.Ala448Ala synonymous ALOX15 5 83142 6.01381E-5 41571 0 1.9118E-4
17-4536515-G-C p.Ala448Ala synonymous ALOX15 1 83142 1.20276E-5 41571 0 7.5655E-5
17-4536521-G-A p.Asp446Asp synonymous ALOX15 5 83174 6.01149E-5 41587 0 2.78669E-5
17-4536526-CA-C p.Asp445fs frameshift ALOX15 1 83174 1.2023E-5 41587 0 3.98073E-6
17-4536529-G-C p.Pro444Ala missense ALOX15 1 83170 1.20236E-5 41585 0 8.26037E-6
17-4536531-G-C p.Pro443Arg missense ALOX15 1 83146 1.2027E-5 41573 0 6.37146E-5
17-4536532-G-A p.Pro443Ser missense ALOX15 1 83130 1.20294E-5 41565 0 NA
17-4536534-CAGA-C p.Phe441del disruptive_inframe_deletion ALOX15 1 83122 1.20305E-5 41561 0 3.30415E-5
17-4536545-G-A p.Tyr438Tyr synonymous ALOX15 5 83162 6.01236E-5 41581 0 4.77756E-5
17-4536565-C-T p.Ala432Thr missense ALOX15 17 83186 2.04361E-4 41593 0 0.00375
17-4536568-G-A p.Gln431* stop_gained ALOX15 20 83198 2.4039E-4 41599 0 3.50385E-4
17-4536572-G-A p.Leu429Leu synonymous ALOX15 18 83186 2.16383E-4 41593 0 0.0020141
17-4536578-C-T p.Gln427Gln synonymous ALOX15 1 83200 1.20192E-5 41600 0 NA
17-4536582-A-C p.Val426Gly missense ALOX15 18 83216 2.16305E-4 41608 0 5.41574E-4
17-4536583-C-G p.Val426Leu missense ALOX15 1 83194 1.20201E-5 41597 0 NA
17-4536583-C-T p.Val426Met missense ALOX15 2 83194 2.40402E-5 41597 0 5.03525E-4
17-4536585-T-C p.His425Arg missense ALOX15 1 83198 1.20195E-5 41599 0 3.18654E-5
17-4536594-C-G p.Gly422Ala missense ALOX15 1 83232 1.20146E-5 41616 0 NA
17-4536595-C-T p.Gly422Arg missense ALOX15 5 83228 6.00759E-5 41614 0 9.55718E-5
17-4536595-C-G p.Gly422Arg missense ALOX15 8 83228 9.61215E-5 41614 0 1.1548E-4
17-4536595-C-A p.Gly422Trp missense ALOX15 9 83228 1.08137E-4 41614 0 6.37146E-5
17-4536600-G-A p.Thr420Ile missense ALOX15 1 83242 1.20132E-5 41621 0 8.26009E-6
17-4536601-T-C p.Thr420Ala missense ALOX15 1 83246 1.20126E-5 41623 0 1.19463E-5
17-4536608-T-C p.Ile417Met missense+splice_region ALOX15 1 83278 1.2008E-5 41639 0 NA
17-4536610-TCTGAGAAGTGAGGGTGAGCAGGGTCAGGCGAATCGACCTGCCCTGAATCCAGAGCTGGAAAAAAGACAGACCCAGAATCTCCCTTTCTCTTCCCATAC-T c.1248+1_1249-1delGTATGGGAAGAGAAAGGGAGATTCTGGGTCTGTCTTTTTTCCAGCTCTGGATTCAGGGCAGGTCGATTCGCCTGACCCTGCTCACCCTCACTTCTCAG splice_acceptor ALOX15 13 83272 1.56115E-4 41636 5 NA
17-4536709-C-T p.Gln416Gln splice_region+synonymous ALOX15 1 83402 1.19901E-5 41701 0 5.76844E-5
17-4536713-T-A p.Asp415Val missense ALOX15 1 83402 1.19901E-5 41701 0 NA
17-4536715-G-A p.Phe414Phe synonymous ALOX15 4 83402 4.79605E-5 41701 0 3.18552E-5
17-4536720-T-C p.Ile413Val missense ALOX15 1 83402 1.19901E-5 41701 0 1.64783E-5
17-4536721-T-C p.Gly412Gly synonymous ALOX15 1 83402 1.19901E-5 41701 0 1.64777E-5
17-4536733-G-A p.Val408Val synonymous ALOX15 3 83402 3.59704E-5 41701 0 1.19328E-5
17-4536743-G-C p.Thr405Ser missense ALOX15 2 83396 2.3982E-5 41698 0 3.97668E-6
17-4536747-T-C p.Arg404Gly missense ALOX15 21 83394 2.51817E-4 41697 0 2.38915E-4
17-4536752-C-T p.Arg402Gln missense ALOX15 2 83390 2.39837E-5 41695 0 3.18593E-5
17-4536753-G-A p.Arg402Trp missense ALOX15 7 83384 8.3949E-5 41692 0 0.00100705
17-4536757-G-A p.Asn400Asn synonymous ALOX15 6 83384 7.19563E-5 41692 0 3.18573E-5
17-4536760-A-G p.Ile399Ile synonymous ALOX15 1 83388 1.19921E-5 41694 0 3.18695E-5
17-4536777-G-A p.Arg394* stop_gained ALOX15 2 83356 2.39935E-5 41678 0 4.37522E-5
17-4536778-C-T p.Leu393Leu synonymous ALOX15 1 83354 1.1997E-5 41677 0 8.24498E-6
17-4536799-G-C c.1162-4C>G splice_region ALOX15 1 83290 1.20062E-5 41645 0 NA
17-4536801-G-C c.1162-6C>G splice_region ALOX15 1 83266 1.20097E-5 41633 0 NA
17-4536802-G-A c.1162-7C>T splice_region ALOX15 1 83260 1.20106E-5 41630 0 NA
17-4539049-G-A c.1161+5C>T splice_region ALOX15 1 82458 1.21274E-5 41229 0 NA
17-4539055-T-C p.Lys387Arg missense+splice_region ALOX15 1 82652 1.20989E-5 41326 0 8.25055E-6
17-4539062-T-C p.Ile385Val missense ALOX15 1 82740 1.20861E-5 41370 0 6.37471E-5
17-4539067-T-C p.His383Arg missense ALOX15 4 82794 4.83127E-5 41397 0 6.25E-4
17-4539071-T-C p.Ile382Val missense ALOX15 1 82832 1.20726E-5 41416 0 NA
17-4539072-C-T p.Ser381Ser synonymous ALOX15 2 82840 2.41429E-5 41420 0 7.41938E-5
17-4539072-C-A p.Ser381Ser synonymous ALOX15 2 82840 2.41429E-5 41420 0 NA
17-4539073-G-A p.Ser381Leu missense ALOX15 1 82848 1.20703E-5 41424 0 6.37064E-5
17-4539075-C-T p.Pro380Pro synonymous ALOX15 3 82858 3.62065E-5 41429 0 9.55657E-5
17-4539084-C-A p.Arg377Ser missense ALOX15 2 82944 2.41127E-5 41472 0 8.24158E-6
17-4539085-C-T p.Arg377Lys missense ALOX15 2 82996 2.40975E-5 41498 0 3.18613E-5
17-4539090-G-T p.Thr375Thr synonymous ALOX15 2 83028 2.40883E-5 41514 0 3.18532E-5
17-4539090-G-A p.Thr375Thr synonymous ALOX15 1 83028 1.20441E-5 41514 0 1.35337E-4
17-4539112-G-A p.Ala368Val missense ALOX15 1 83222 1.20161E-5 41611 0 NA
17-4539116-T-C p.Met367Val missense ALOX15 1 83252 1.20117E-5 41626 0 8.23981E-6
17-4539130-A-G p.Leu362Pro missense ALOX15 1 83260 1.20106E-5 41630 0 2.30734E-4
17-4539131-GAAGAT-G p.His360fs frameshift ALOX15 2 83262 2.40206E-5 41631 0 NA
17-4539171-G-T p.Arg348Arg synonymous ALOX15 759 83140 0.00912918 41570 14 0.0207723
17-4539173-G-A p.Arg348Cys missense ALOX15 3 83156 3.60768E-5 41578 0 3.29761E-5
17-4539180-G-A p.Cys345Cys synonymous ALOX15 2 83140 2.40558E-5 41570 0 NA
17-4539184-T-C p.Lys344Arg missense ALOX15 1 83112 1.2032E-5 41556 0 NA
17-4539203-T-C p.Met338Val missense ALOX15 11 82962 1.32591E-4 41481 0 5.03525E-4
17-4539205-G-A p.Pro337Leu missense ALOX15 1 82978 1.20514E-5 41489 0 NA
17-4539206-G-A p.Pro337Ser missense ALOX15 2 82960 2.4108E-5 41480 0 NA
17-4539215-T-C p.Thr334Ala missense ALOX15 2 82808 2.41523E-5 41404 0 NA
17-4539243-T-A p.Gly324Gly synonymous ALOX15 1 82394 1.21368E-5 41197 0 8.26556E-6
17-4539244-C-A p.Gly324Val missense ALOX15 3 82346 3.64316E-5 41173 0 2.39542E-5
17-4539245-C-T p.Gly324Arg missense ALOX15 2 82310 2.42984E-5 41155 0 NA
17-4539250-C-T p.Arg322His missense ALOX15 61 82076 7.43214E-4 41038 0 5.79532E-4
17-4539250-C-A p.Arg322Leu missense ALOX15 1 82080 1.21832E-5 41040 0 3.19742E-5
17-4539251-G-T p.Arg322Ser missense ALOX15 4 82114 4.87128E-5 41057 0 0.00188679
17-4539251-G-A p.Arg322Cys missense ALOX15 4 82114 4.87128E-5 41057 0 6.3743E-5
17-4539255-CAGCTGG-C p.Gln319_Leu320del disruptive_inframe_deletion ALOX15 6 82028 7.31458E-5 41014 0 4.96796E-5
17-4539260-G-A p.Gln319* stop_gained ALOX15 1 81924 1.22064E-5 40962 0 NA
17-4540405-C-T c.951+5G>A splice_region ALOX15 1 81954 1.2202E-5 40977 0 1.68574E-5
17-4540424-G-C p.Pro313Ala missense ALOX15 1 82440 1.213E-5 41220 0 NA
17-4540441-G-A p.Pro307Leu missense ALOX15 1 82742 1.20858E-5 41371 0 1.65229E-5
17-4540448-A-G p.Leu305Leu synonymous ALOX15 9 82862 1.08614E-4 41431 0 5.05051E-4
17-4540461-T-C p.Leu300Leu synonymous ALOX15 1 83048 1.20412E-5 41524 0 NA
17-4540466-G-GGGCA p.Pro299fs frameshift ALOX15 3 83102 3.61002E-5 41551 0 1.19433E-5
17-4540467-G-A n.485C>T splice_region ALOX15 1 83114 1.20317E-5 41557 0 NA
17-4540468-G-A p.Ala298Val missense ALOX15 2 83134 2.40575E-5 41567 0 NA
17-4540475-G-T p.Leu296Met missense ALOX15 1 83206 1.20184E-5 41603 0 1.64891E-5
17-4540475-G-A p.Leu296Leu synonymous ALOX15 4 83206 4.80735E-5 41603 0 2.94499E-4
17-4540478-G-A p.His295Tyr missense ALOX15 2 83224 2.40315E-5 41612 0 NA
17-4540484-G-A p.Gln293* stop_gained ALOX15 2 83274 2.40171E-5 41637 0 NA
17-4540497-GA-G p.Val288fs frameshift ALOX15 3 83316 3.60075E-5 41658 0 1.64921E-5
17-4540499-C-T p.Val288Ile missense ALOX15 2 83316 2.4005E-5 41658 0 3.18654E-5
17-4540500-G-A p.Asn287Asn synonymous ALOX15 3 83318 3.60066E-5 41659 0 3.18593E-5
17-4540505-C-T p.Ala286Thr missense ALOX15 1 83318 1.20022E-5 41659 0 3.98184E-6
17-4540506-C-T p.Lys285Lys synonymous ALOX15 2 83324 2.40027E-5 41662 0 3.18674E-5
17-4540506-C-G p.Lys285Asn missense ALOX15 1 83324 1.20013E-5 41662 0 NA
17-4540512-C-T p.Gly283Gly synonymous ALOX15 4 83322 4.80065E-5 41661 0 1.8153E-4
17-4540514-C-T p.Gly283Arg missense ALOX15 67 83312 8.04206E-4 41656 0 0.00453629
17-4540531-T-C p.Asp277Gly missense ALOX15 1 83232 1.20146E-5 41616 0 6.37308E-5
17-4540533-A-T p.Ala276Ala synonymous ALOX15 4 83220 4.80654E-5 41610 0 3.18593E-5
17-4540534-G-A p.Ala276Val missense ALOX15 2 83214 2.40344E-5 41607 0 NA
17-4540538-C-T p.Glu275Lys missense ALOX15 1 83180 1.20221E-5 41590 0 4.38838E-5
17-4540539-G-A p.Phe274Phe synonymous ALOX15 1 83170 1.20236E-5 41585 0 1.99492E-5
17-4540539-G-T p.Phe274Leu missense ALOX15 3 83170 3.60707E-5 41585 0 3.18552E-5
17-4540544-G-C p.Leu273Val missense ALOX15 6 83104 7.21987E-5 41552 1 8.31947E-6
17-4540553-C-T p.Gly270Arg missense+splice_region ALOX15 4 83030 4.81754E-5 41515 0 6.43951E-5
17-4540553-C-CTTCCCAT c.808-1_808insATGGGAA splice_acceptor ALOX15 1 83030 1.20438E-5 41515 0 NA
17-4540560-G-A c.808-7C>T splice_region ALOX15 3 82950 3.61664E-5 41475 0 6.37105E-5
17-4540560-G-T c.808-7C>A splice_region ALOX15 2 82950 2.41109E-5 41475 0 8.40237E-6
17-4540561-G-C c.808-8C>G splice_region ALOX15 2 82950 2.41109E-5 41475 0 8.4028E-6
17-4541507-C-T c.807+5G>A splice_region ALOX15 1 54320 1.84094E-5 27160 0 NA
17-4541509-T-C c.807+3A>G splice_region ALOX15 2 54076 3.6985E-5 27038 0 3.06185E-5
17-4541526-C-T p.Glu265Lys missense ALOX15 1 58564 1.70753E-5 29282 0 NA
17-4541545-C-T p.Glu258Glu synonymous ALOX15 2 60542 3.30349E-5 30271 0 1.6218E-4
17-4541547-C-T p.Glu258Lys missense ALOX15 1 60658 1.64859E-5 30329 0 3.24507E-5
17-4541558-G-T p.Pro254His missense ALOX15 3 61450 4.88202E-5 30725 0 1.29739E-4
17-4541560-G-A p.Phe253Phe synonymous ALOX15 14049 54492 0.257818 27246 1907 0.343404
17-4541563-C-A p.Val252Val synonymous ALOX15 2 61690 3.24202E-5 30845 0 NA
17-4541588-G-C p.Ser244Cys missense ALOX15 2 63610 3.14416E-5 31805 0 1.14805E-5
17-4541589-A-T p.Ser244Thr missense ALOX15 37 63520 5.82494E-4 31760 0 0.00217865
17-4541598-G-A p.Leu241Leu synonymous ALOX15 1 64732 1.54483E-5 32366 0 NA
17-4541604-C-T p.Val239Met missense ALOX15 16 65396 2.44663E-4 32698 0 0.183009
17-4541605-G-A p.Pro238Pro synonymous ALOX15 4 65508 6.10612E-5 32754 0 4.19577E-5
17-4541613-C-T p.Ala236Thr missense ALOX15 1 66262 1.50916E-5 33131 0 2.04683E-5
17-4541618-T-C p.Asn234Ser missense ALOX15 1 67472 1.4821E-5 33736 0 NA
17-4541630-T-C p.Tyr230Cys missense ALOX15 1 69108 1.44701E-5 34554 0 NA
17-4541633-C-T p.Gly229Glu missense ALOX15 1 69510 1.43864E-5 34755 0 NA
17-4541664-G-A p.Arg219Trp missense ALOX15 2 73298 2.72859E-5 36649 0 9.36382E-6
17-4541666-AC-A p.Val218fs frameshift ALOX15 2 73458 2.72264E-5 36729 0 2.80337E-5
17-4541667-C-T p.Val218Met missense ALOX15 1 73516 1.36025E-5 36758 0 7.24638E-4
17-4541668-G-A p.Arg217Arg synonymous ALOX15 2 73460 2.72257E-5 36730 0 4.75882E-5
17-4541670-G-A p.Arg217Cys missense+splice_region ALOX15 2 73622 2.71658E-5 36811 0 6.54365E-5
17-4541679-A-C c.647-7T>G splice_region ALOX15 302 73804 0.00409192 36902 0 0.00928478
17-4541872-T-A c.646+4A>T splice_region ALOX15 1 83106 1.20328E-5 41553 0 NA
17-4541880-C-T p.Leu214Leu synonymous ALOX15 2 83186 2.40425E-5 41593 0 3.33E-5
17-4541889-C-T p.Gln211Gln synonymous ALOX15 1 83222 1.20161E-5 41611 0 8.28459E-6
17-4541895-A-G p.Cys209Cys synonymous ALOX15 1 83252 1.20117E-5 41626 0 NA
17-4541898-C-G p.Trp208Cys missense ALOX15 2 83262 2.40206E-5 41631 0 6.36395E-5
17-4541908-C-T p.Arg205Gln missense ALOX15 416 83280 0.0049952 41640 6 0.00869815
17-4541909-G-A p.Arg205Trp missense ALOX15 2 83298 2.40102E-5 41649 0 6.60251E-5
17-4541913-G-A p.Phe203Phe synonymous ALOX15 3 83300 3.60144E-5 41650 0 7.95399E-6
17-4541918-C-T p.Asp202Asn missense ALOX15 1 83306 1.20039E-5 41653 0 NA
17-4541920-T-C p.Asp201Gly missense ALOX15 7 83310 8.40235E-5 41655 0 8.92061E-4
17-4541926-T-A p.Asp199Val missense ALOX15 1 83320 1.20019E-5 41660 0 NA
17-4541937-A-T p.Thr195Thr synonymous ALOX15 5 83322 6.00082E-5 41661 0 NA
17-4541949-TAG-T p.Leu191fs frameshift ALOX15 1 83310 1.20034E-5 41655 0 3.97678E-6
17-4541949-T-A p.Leu191Leu synonymous ALOX15 1 83310 1.20034E-5 41655 0 2.47272E-5
17-4541950-A-T p.Leu191Gln missense ALOX15 1 83308 1.20036E-5 41654 0 1.64845E-5
17-4541952-A-G p.Ser190Ser synonymous ALOX15 1 83310 1.20034E-5 41655 0 NA
17-4541955-G-A p.Asp189Asp synonymous ALOX15 1 83316 1.20025E-5 41658 0 4.94544E-5
17-4541957-C-T p.Asp189Asn missense ALOX15 2 83316 2.4005E-5 41658 0 4.12113E-5
17-4541963-T-C p.Ile187Val missense ALOX15 101 83314 0.00121228 41657 0 0.0040282
17-4541966-C-T p.Ala186Thr missense ALOX15 4 83294 4.80227E-5 41647 0 1.591E-5
17-4541966-C-A p.Ala186Ser missense ALOX15 1 83294 1.20057E-5 41647 0 NA
17-4541967-G-A p.Leu185Leu synonymous ALOX15 1 83290 1.20062E-5 41645 0 3.18695E-5
17-4541972-C-T p.Asp184Asn missense ALOX15 3 83282 3.60222E-5 41641 0 7.41803E-5
17-4541973-G-A p.Ala183Ala synonymous ALOX15 4 83280 4.80307E-5 41640 0 6.37714E-5
17-4541980-C-CCCTTGGCCAGCGAAACCTCAAAGTCAACTCTCTTGTCTTCCAGAAA c.543-2_543-1insTTTCTGGAAGACAAGAGAGTTGACTTTGAGGTTTCGCTGGCCAAGG splice_acceptor ALOX15 2 83280 2.40154E-5 41640 0 NA
17-4542140-C-T c.542+5G>A splice_region ALOX15 1 83286 1.20068E-5 41643 0 NA
17-4542140-C-G c.542+5G>C splice_region ALOX15 1 83286 1.20068E-5 41643 0 NA
17-4542146-C-A p.Gly181Trp missense+splice_region ALOX15 1 83306 1.20039E-5 41653 0 NA
17-4542156-C-A p.Ser177Ser synonymous ALOX15 1 83314 1.20028E-5 41657 0 NA
17-4542165-A-G p.Phe174Phe synonymous ALOX15 2 83320 2.40038E-5 41660 0 NA
17-4542194-G-A p.Arg165* stop_gained ALOX15 1 83316 1.20025E-5 41658 0 7.95273E-6
17-4542194-G-T p.Arg165Arg synonymous ALOX15 1 83316 1.20025E-5 41658 0 NA
17-4542195-C-T p.Glu164Glu synonymous ALOX15 2 83322 2.40033E-5 41661 0 NA
17-4542208-A-T p.Leu160His missense ALOX15 1 83318 1.20022E-5 41659 0 NA
17-4542216-T-C p.Leu157Leu synonymous ALOX15 1 83308 1.20036E-5 41654 0 1.64731E-5
17-4542222-G-C p.Ala4Ala splice_region+synonymous ALOX15 1 83318 1.20022E-5 41659 0 8.23655E-6
17-4542237-C-A p.Leu150Leu synonymous ALOX15 1 83330 1.20005E-5 41665 0 NA
17-4542239-G-A c.-6C>T 5_prime_UTR_premature_start_codon_gain ALOX15 1 83334 1.19999E-5 41667 0 1.19291E-5
17-4542249-G-A c.-16C>T 5_prime_UTR_premature_start_codon_gain ALOX15 3 83336 3.59988E-5 41668 0 2.47101E-5
17-4542264-CCACCTGTGGGGCAGGAAGGAAATCAAGTATGGGTGCTGGAAGCATCAGCAGCTCACGTGGGGTCAGGGGAGGAGGGCT-C p.Trp141del splice_acceptor ALOX15 7 83336 8.39973E-5 41668 0 NA
17-4542267-C-A c.-34G>T 5_prime_UTR_premature_start_codon_gain ALOX15 2 83336 2.39992E-5 41668 0 3.97712E-6
17-4542343-CACCGGTACA-C p.Leu138fs frameshift ALOX15 1 83326 1.20011E-5 41663 0 3.97712E-6
17-4542347-G-A p.Arg140Trp missense+splice_region ALOX15 4 83320 4.80077E-5 41660 0 3.18715E-5
17-4542349-T-C p.Tyr139Cys missense ALOX15 128 83310 0.00153643 41655 0 0.0018945
17-4542357-C-A p.Arg136Ser missense ALOX15 1 83306 1.20039E-5 41653 0 NA
17-4542375-T-C p.Glu130Glu synonymous ALOX15 2 83288 2.40131E-5 41644 0 9.5584E-5
17-4542376-T-C p.Glu130Gly missense ALOX15 1 83282 1.20074E-5 41641 0 NA
17-4542379-T-C p.Glu129Gly missense ALOX15 1 83260 1.20106E-5 41630 0 NA
17-4542382-C-T p.Arg128Gln missense ALOX15 4 83244 4.80515E-5 41622 0 6.37308E-5
17-4542382-C-G p.Arg128Pro missense ALOX15 1 83244 1.20129E-5 41622 0 NA
17-4542383-G-C p.Arg128Gly missense ALOX15 2 83234 2.40286E-5 41617 0 NA
17-4542402-C-T p.Gln121Gln synonymous ALOX15 8 83062 9.63136E-5 41531 0 9.55597E-5
17-4542402-CT-TC p.Gln121Arg missense ALOX15 1 83064 1.20389E-5 41532 0 NA
17-4542403-T-C p.Gln121Arg missense ALOX15 9 83030 1.08395E-4 41515 0 9.55657E-5
17-4542411-C-G p.Glu118Asp missense ALOX15 9 82868 1.08606E-4 41434 0 9.55718E-5
17-4542422-T-C p.Thr115Ala missense ALOX15 1 82488 1.2123E-5 41244 0 8.24144E-6
17-4542425-G-A p.Arg114Cys missense+splice_region ALOX15 4 82394 4.85472E-5 41197 0 NA
17-4542426-G-A p.Gly113Gly splice_region+synonymous ALOX15 2 82350 2.42866E-5 41175 0 3.29701E-5
17-4542431-G-A c.338-4C>T splice_region ALOX15 1 82142 1.2174E-5 41071 0 6.37024E-5
17-4542431-G-T c.338-4C>A splice_region ALOX15 1 82142 1.2174E-5 41071 0 NA
17-4542435-G-A c.338-8C>T splice_region ALOX15 1 81958 1.22014E-5 40979 0 NA
17-4542717-G-A c.337+8C>T splice_region ALOX15 22601 80608 0.280382 40304 3078 0.299731
17-4542718-C-T c.337+7G>A splice_region ALOX15 1 81844 1.22184E-5 40922 0 8.44737E-6
17-4542725-C-T p.Gly113Ser missense+splice_region ALOX15 15 81966 1.83003E-4 40983 0 0.0933333
17-4542726-G-A c.-118C>T 5_prime_UTR_premature_start_codon_gain ALOX15 2 81982 2.43956E-5 40991 0 7.55947E-5
17-4542745-AG-A p.Leu106fs frameshift ALOX15 17 82300 2.06561E-4 41150 0 5.09684E-4
17-4542745-A-T p.Leu106Gln missense ALOX15 1 82300 1.21507E-5 41150 0 2.79834E-5
17-4542749-C-A p.Val105Phe missense ALOX15 3 82294 3.64547E-5 41147 0 1.99797E-5
17-4542753-G-C p.Asn103Lys missense ALOX15 409 82356 0.00496624 41178 6 0.00872834
17-4542753-G-A c.-145C>T 5_prime_UTR_premature_start_codon_gain ALOX15 7 82364 8.49886E-5 41182 0 6.25391E-4
17-4542755-T-C p.Asn103Asp missense ALOX15 58 82376 7.04089E-4 41188 1 0.00254842
17-4542755-TGC-CGA p.GlyAsn102ValAsp missense ALOX15 5 82384 6.06914E-5 41192 0 NA
17-4542755-T-A p.Asn103Tyr missense ALOX15 2 82384 2.42766E-5 41192 0 NA
17-4542757-C-A p.Gly102Val missense ALOX15 55 82386 6.67589E-4 41193 1 0.00254323
17-4542771-G-A p.Tyr97Tyr synonymous ALOX15 7 82602 8.47437E-5 41301 0 5.07099E-4
17-4542775-C-T p.Cys96Tyr missense ALOX15 2 82686 2.41879E-5 41343 0 NA
17-4542778-G-A p.Pro95Leu missense ALOX15 1 82708 1.20907E-5 41354 0 3.98476E-6
17-4542782-A-G p.Phe94Leu missense ALOX15 2 82730 2.4175E-5 41365 0 NA
17-4542784-C-G p.Arg93Thr missense ALOX15 1 82738 1.20863E-5 41369 0 1.66223E-5
17-4542787-A-G p.Val92Ala missense ALOX15 3 82748 3.62547E-5 41374 0 8.31006E-6
17-4542791-C-T p.Glu91Lys missense ALOX15 7 82800 8.45411E-5 41400 0 8.76278E-5
17-4542794-C-G p.Asp90His missense ALOX15 620 82806 0.00748738 41403 4 0.018125
17-4542797-C-T p.Gly89Arg missense ALOX15 1 82822 1.20741E-5 41411 0 1.66168E-5
17-4542804-G-A c.-196C>T 5_prime_UTR_premature_start_codon_gain ALOX15 2 82862 2.41365E-5 41431 0 1.66141E-5
17-4542808-C-T p.Gly46Asp missense+splice_region ALOX15 2 82906 2.41237E-5 41453 0 6.36983E-5
17-4542812-G-A p.Gln84* stop_gained ALOX15 1 82954 1.20549E-5 41477 0 0.00706357
17-4542815-C-T p.Val83Met missense ALOX15 13 82978 1.56668E-4 41489 0 1.91083E-4
17-4542831-G-A c.-223C>T 5_prime_UTR_premature_start_codon_gain ALOX15 4 83024 4.81788E-5 41512 0 1.66063E-5
17-4542838-G-C p.Ala75Gly missense ALOX15 1 83016 1.20459E-5 41508 0 8.3797E-6
17-4542852-G-A p.Leu70Leu synonymous ALOX15 1 83004 1.20476E-5 41502 0 2.50167E-5
17-4542855-G-A p.His69His synonymous ALOX15 1 83018 1.20456E-5 41509 0 6.37349E-5
17-4542859-C-T p.Arg68Gln missense ALOX15 11 83018 1.32501E-4 41509 0 2.23072E-4
17-4542860-G-A p.Arg68Trp missense ALOX15 3 83026 3.61333E-5 41513 0 2.27104E-4
17-4542860-G-C p.Arg68Gly missense ALOX15 1 83026 1.20444E-5 41513 0 NA
17-4542866-GCA-G p.Leu65fs frameshift ALOX15 4 83002 4.81916E-5 41501 0 6.37186E-5
17-4542870-T-C p.Lys64Lys synonymous ALOX15 1 82970 1.20525E-5 41485 0 NA
17-4542881-G-T p.Leu61Met missense ALOX15 3 82930 3.61751E-5 41465 0 0.00100908
17-4542886-G-A p.Pro59Leu missense ALOX15 1 82868 1.20674E-5 41434 0 1.59858E-5
17-4542887-G-A p.Pro59Ser missense ALOX15 1 82840 1.20715E-5 41420 0 NA
17-4542894-A-G p.Tyr56Tyr synonymous ALOX15 11 82786 1.32873E-4 41393 0 0.040404
17-4542900-C-T p.Pro54Pro synonymous ALOX15 1 82752 1.20843E-5 41376 0 9.71572E-6
17-4542907-TC-T p.Glu52fs frameshift ALOX15 1 82622 1.21033E-5 41311 0 NA
17-4542931-G-A c.-323C>T 5_prime_UTR_premature_start_codon_gain ALOX15 14 81966 1.70803E-4 40983 0 5.99921E-5
17-4542939-G-A c.-331C>T 5_prime_UTR_premature_start_codon_gain ALOX15 1 81760 1.22309E-5 40880 0 4.05493E-5
17-4542955-G-A c.-347C>T 5_prime_UTR_premature_start_codon_gain ALOX15 31 80688 3.84196E-4 40344 0 0.0127823
17-4542968-G-A c.-360C>T 5_prime_UTR_premature_start_codon_gain ALOX15 38 79868 4.75785E-4 39934 0 0.0114373
17-4543002-G-A c.-394C>T 5_prime_UTR_premature_start_codon_gain ALOX15 21 75646 2.77609E-4 37823 0 6.65115E-5
17-4543009-C-T c.-401G>A 5_prime_UTR_premature_start_codon_gain ALOX15 1 74422 1.34369E-5 37211 0 NA
17-4543067-G-C c.-459C>G 5_prime_UTR_premature_start_codon_gain ALOX15 2 51768 3.86339E-5 25884 0 NA
17-4543080-C-A c.-472G>T 5_prime_UTR_premature_start_codon_gain ALOX15 5 45360 1.10229E-4 22680 0 3.05064E-4
17-4543086-G-A c.-478C>T 5_prime_UTR_premature_start_codon_gain ALOX15 3 42982 6.97967E-5 21491 0 3.75319E-5
17-4543107-G-A c.-499C>T 5_prime_UTR_premature_start_codon_gain ALOX15 659 34582 0.0190562 17291 0 0.0174497
17-4543177-C-T c.-569G>A 5_prime_UTR_premature_start_codon_gain ALOX15 2 16032 1.2475E-4 8016 0 0.0626779
17-4544811-C-A c.135+1G>T splice_donor ALOX15 1 80912 1.23591E-5 40456 0 6.37186E-5
17-4544812-C-T p.Lys45Lys splice_region+synonymous ALOX15 3 80970 3.70508E-5 40485 0 NA
17-4544821-T-C p.Ala42Ala synonymous ALOX15 6 80906 7.41601E-5 40453 0 9.55779E-5
17-4544824-G-C p.Pro41Pro synonymous ALOX15 1 81070 1.2335E-5 40535 0 4.0937E-6
17-4544825-G-A p.Pro41Leu missense ALOX15 1 81098 1.23308E-5 40549 0 NA
17-4544835-G-A p.Arg38* stop_gained ALOX15 1 81246 1.23083E-5 40623 0 1.62739E-5
17-4544837-TTCCCGAGCGCCGCC-T p.Ala34fs frameshift ALOX15 1 81290 1.23016E-5 40645 0 NA
17-4544842-G-C p.Leu35Leu synonymous ALOX15 1 81302 1.22998E-5 40651 0 NA
17-4544847-C-T p.Ala34Thr missense ALOX15 1 81444 1.22784E-5 40722 0 4.05808E-6
17-4544848-C-T p.Ala33Ala synonymous ALOX15 1 81510 1.22684E-5 40755 0 NA
17-4544856-C-G p.Gly31Arg missense ALOX15 10 81706 1.2239E-4 40853 0 6.25E-4
17-4544858-T-C p.His30Arg missense ALOX15 1 81662 1.22456E-5 40831 0 NA
17-4544865-C-T p.Gly28Ser missense ALOX15 20 81888 2.44236E-4 40944 0 2.86661E-4
17-4544880-G-A p.Gln23* stop_gained ALOX15 2 82472 2.42507E-5 41236 0 NA
17-4544880-GC-TT p.ValGln22ValLys missense ALOX15 1 82472 1.21253E-5 41236 0 NA
17-4544892-T-C p.Asn19Asp missense ALOX15 1 82644 1.21001E-5 41322 0 NA
17-4544899-G-C p.Ala16Ala synonymous ALOX15 1 82686 1.20939E-5 41343 0 NA
17-4544904-A-G p.Tyr15His missense ALOX15 41 82758 4.9542E-4 41379 0 0.001875
17-4544905-G-C p.Leu14Leu synonymous ALOX15 3 82756 3.62511E-5 41378 0 8.49372E-6
17-4544909-G-C p.Ser13Trp missense ALOX15 2 82744 2.41709E-5 41372 0 8.48968E-6
17-4544911-G-T p.Ala12Ala synonymous ALOX15 1 82756 1.20837E-5 41378 0 NA
17-4544917-A-G p.Thr10Thr synonymous ALOX15 1 82810 1.20758E-5 41405 0 9.3282E-5
17-4544930-A-C p.Ile6Ser missense ALOX15 1 82692 1.20931E-5 41346 0 NA
17-4544935-G-T p.Tyr4* stop_gained ALOX15 1 82654 1.20986E-5 41327 0 NA
17-4544936-T-C p.Tyr4Cys missense ALOX15 1 82614 1.21045E-5 41307 0 NA
17-4544947-C-A p.Lys22Asn missense ALOX15 1 82396 1.21365E-5 41198 0 NA
17-4544955-A-G c.-9T>C 5_prime_UTR_premature_start_codon_gain ALOX15 1 82122 1.2177E-5 41061 0 NA
17-4544958-A-T p.Ser19Thr missense ALOX15 87 82062 0.00106017 41031 0 0.00388929
17-4544978-G-GAGA c.42-10_42-8dupTCT splice_region ALOX15 77468 81192 0.954133 40596 37343 0.974881
17-4544978-G-GTGA c.42-8_42-7insTCA splice_region ALOX15 3615 81232 0.0445022 40616 443 0.0913412
17-4544991-G-A c.-45C>T 5_prime_UTR_premature_start_codon_gain ALOX15 2 80632 2.4804E-5 40316 0 8.88857E-6
17-4544991-G-C c.-45C>G 5_prime_UTR_premature_start_codon_gain ALOX15 2 80632 2.4804E-5 40316 0 1.22308E-5
17-4545095-G-A c.-149C>T 5_prime_UTR_premature_start_codon_gain ALOX15 1 74048 1.35048E-5 37024 0 NA
17-4545123-G-C c.-177C>G 5_prime_UTR_premature_start_codon_gain ALOX15 1 70384 1.42078E-5 35192 0 NA
17-4545158-G-A c.-212C>T 5_prime_UTR_premature_start_codon_gain ALOX15 2 61288 3.26328E-5 30644 0 3.18756E-5
17-4545180-T-C c.-234A>G 5_prime_UTR_premature_start_codon_gain ALOX15 1 56196 1.77949E-5 28098 0 NA
17-4545191-G-C c.-245C>G 5_prime_UTR_premature_start_codon_gain ALOX15 1 52802 1.89387E-5 26401 0 NA
17-4545197-G-C c.-251C>G 5_prime_UTR_premature_start_codon_gain ALOX15 1 50668 1.97363E-5 25334 0 NA
17-4545203-G-C c.-257C>G 5_prime_UTR_premature_start_codon_gain ALOX15 1 48336 2.06885E-5 24168 0 NA
17-4545218-C-A c.-272G>T 5_prime_UTR_premature_start_codon_gain ALOX15 7891 39690 0.198816 19845 544 0.196886
17-4545226-C-T c.-280G>A 5_prime_UTR_premature_start_codon_gain ALOX15 1 38212 2.61698E-5 19106 0 NA
17-4545226-C-A c.-280G>T 5_prime_UTR_premature_start_codon_gain ALOX15 1 38212 2.61698E-5 19106 0 NA
17-4545230-G-A c.-284C>T 5_prime_UTR_premature_start_codon_gain ALOX15 1 37338 2.67824E-5 18669 0 NA
17-4545531-G-C p.Leu10Val missense ALOX15 1 33836 2.95543E-5 16918 0 7.78319E-6
17-4545541-C-T p.Glu6Glu synonymous ALOX15 1 33836 2.95543E-5 16918 0 7.78222E-6
17-4545542-T-G p.Glu6Ala missense ALOX15 1 33836 2.95543E-5 16918 0 NA
17-4545554-A-G p.Leu2Pro missense ALOX15 1 33828 2.95613E-5 16914 0 NA