Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
17-6899414-C-T c.-23C>T 5_prime_UTR_premature_start_codon_gain ALOX12 2 47444 4.2155E-5 23722 0 NA
17-6899438-T-A p.Met1? start_lost ALOX12 1 51496 1.9419E-5 25748 0 NA
17-6899441-G-T p.Gly2Val missense ALOX12 1 51798 1.93058E-5 25899 0 NA
17-6899478-C-T p.Leu14Leu synonymous ALOX12 1 54726 1.82729E-5 27363 0 NA
17-6899479-T-C p.Phe15Leu missense ALOX12 2 54736 3.6539E-5 27368 0 3.18634E-5
17-6899494-A-T p.Asn20Tyr missense ALOX12 1 53880 1.85598E-5 26940 0 NA
17-6899500-G-T p.Val22Leu missense ALOX12 56 53156 0.0010535 26578 0 0.00211566
17-6899533-G-A p.Ala33Thr missense ALOX12 1 47610 2.1004E-5 23805 0 NA
17-6899534-C-T p.Ala33Val missense ALOX12 1 47044 2.12567E-5 23522 0 NA
17-6899535-G-A p.Ala33Ala synonymous ALOX12 1 46998 2.12775E-5 23499 0 NA
17-6899559-C-G p.Pro41Pro synonymous ALOX12 39017 40026 0.974791 20013 19095 0.997408
17-6899559-C-T p.Pro41Pro synonymous ALOX12 35 41526 8.42845E-4 20763 2 0.00233495
17-6899559-C-A p.Pro41Pro synonymous ALOX12 3 41526 7.22439E-5 20763 1 6.39713E-5
17-6899567-G-A p.Gly44Asp missense ALOX12 1 39856 2.50903E-5 19928 0 3.19509E-5
17-6900142-CAGG-C p.Glu46fs frameshift ALOX12 1 80130 1.24797E-5 40065 0 3.18431E-5
17-6900150-G-A p.Glu47Glu synonymous ALOX12 1 80368 1.24428E-5 40184 0 NA
17-6900155-T-A p.Phe49Tyr missense ALOX12 1 80550 1.24146E-5 40275 0 NA
17-6900166-G-A p.Val53Ile missense ALOX12 25 80788 3.09452E-4 40394 0 8.59654E-4
17-6900181-G-A p.Gly58Arg missense ALOX12 1 80920 1.23579E-5 40460 0 8.03962E-6
17-6900184-C-A p.Leu59Ile missense ALOX12 1 80910 1.23594E-5 40455 0 NA
17-6900196-G-T p.Val63Leu missense ALOX12 1 80974 1.23496E-5 40487 0 NA
17-6900201-G-C p.Arg64Ser missense ALOX12 2 80970 2.47005E-5 40485 0 8.58634E-6
17-6900213-C-G p.His68Gln missense ALOX12 1 80864 1.23664E-5 40432 0 8.76347E-6
17-6900216-C-A p.His69Gln missense ALOX12 6 80914 7.41528E-5 40457 0 1.27364E-4
17-6900217-T-C p.Trp70Arg missense ALOX12 2 80890 2.47249E-5 40445 0 NA
17-6900221-T-G p.Leu71Arg missense ALOX12 1 80812 1.23744E-5 40406 0 4.03678E-6
17-6900229-G-A p.Asp74Asn missense ALOX12 2 80054 2.49831E-5 40027 0 NA
17-6900245-A-C p.Asp79Ala missense ALOX12 1 79632 1.25578E-5 39816 0 NA
17-6900248-G-A p.Arg80His missense ALOX12 2 79600 2.51256E-5 39800 0 0.00455927
17-6900257-T-C p.Val83Ala missense ALOX12 1 79330 1.26056E-5 39665 0 NA
17-6900269-G-A p.Gly87Glu missense ALOX12 1 79130 1.26374E-5 39565 0 3.82093E-4
17-6900275-G-A p.Cys89Tyr missense ALOX12 1 78970 1.2663E-5 39485 0 NA
17-6900283-G-A p.Val92Met missense ALOX12 1 78878 1.26778E-5 39439 0 NA
17-6900284-T-A p.Val92Glu missense ALOX12 3 78810 3.80662E-5 39405 0 1.00781E-5
17-6900296-G-C p.Cys96Ser missense ALOX12 1 78492 1.27402E-5 39246 0 1.08639E-5
17-6900297-C-T p.Cys96Cys synonymous ALOX12 3 78464 3.82341E-5 39232 0 5.63889E-5
17-6900309-G-A p.Val100Val synonymous ALOX12 1 78074 1.28084E-5 39037 0 5.86841E-6
17-6900316-G-A p.Glu103Lys missense ALOX12 1 77744 1.28627E-5 38872 0 3.87507E-5
17-6900319-G-C p.Asp104His missense ALOX12 1 77634 1.2881E-5 38817 0 NA
17-6900321-C-T p.Asp104Asp synonymous ALOX12 2 77570 2.57832E-5 38785 0 0.00102987
17-6900336-C-T p.Pro109Pro synonymous ALOX12 2 76722 2.60681E-5 38361 0 NA
17-6900351-G-A c.337+5G>A splice_region ALOX12 3 75972 3.94882E-5 37986 0 NA
17-6901823-C-T c.338-5C>T splice_region ALOX12 1 82676 1.20954E-5 41338 0 8.04596E-6
17-6901831-G-T p.Arg114Leu missense ALOX12 10 82836 1.2072E-4 41418 0 1.1883E-4
17-6901831-G-A p.Arg114His missense ALOX12 2 82836 2.41441E-5 41418 0 8.40955E-5
17-6901832-C-A p.Arg114Arg synonymous ALOX12 15 82904 1.80932E-4 41452 0 8.00019E-6
17-6901839-G-C p.Gly117Arg missense ALOX12 78 83102 9.38606E-4 41551 0 0.0020141
17-6901849-C-T p.Ala120Val missense ALOX12 2 83178 2.40448E-5 41589 0 NA
17-6901857-A-G p.Met123Val missense ALOX12 1 83234 1.20143E-5 41617 0 8.56164E-6
17-6901878-A-G p.Lys130Glu missense ALOX12 1 83258 1.20109E-5 41629 0 NA
17-6901880-G-A p.Lys130Lys synonymous ALOX12 5 83260 6.00528E-5 41630 0 1.68859E-4
17-6901889-A-C p.Lys133Asn missense ALOX12 216 83254 0.00259447 41627 3 0.0060423
17-6901890-G-C p.Asp134His missense ALOX12 243 83228 0.00291969 41614 2 0.00654582
17-6901898-G-A p.Gln136Gln synonymous ALOX12 1 83192 1.20204E-5 41596 0 8.43583E-6
17-6901908-TGGTGACCACCCACCCCTTAAACTAACCCCGCCACCACTGTCCCACCCCTTCCCTGCCCCTGCCCCTGCCCCTGGCCCCATCACTGACCATGACATCCTTCCTGAAGCTTTGTCCCCAACTCCTA-T p.Cys140fs frameshift ALOX12 3 83102 3.61002E-5 41551 0 NA
17-6901912-G-A c.419+3G>A splice_region ALOX12 1 83008 1.2047E-5 41504 0 NA
17-6902042-C-T p.Thr143Ile missense ALOX12 1 83268 1.20094E-5 41634 0 NA
17-6902053-G-A p.Gly147Arg missense ALOX12 1 83312 1.20031E-5 41656 0 NA
17-6902066-C-T p.Thr151Ile missense ALOX12 1 83330 1.20005E-5 41665 0 NA
17-6902070-C-T p.Ile152Ile synonymous ALOX12 4 83352 4.79893E-5 41676 0 1.19307E-5
17-6902071-G-A p.Ala153Thr missense ALOX12 4 83344 4.79939E-5 41672 0 6.60589E-5
17-6902076-A-G p.Ala154Ala synonymous ALOX12 9 83354 1.07973E-4 41677 0 1.27397E-4
17-6902080-C-T p.Arg156Cys missense ALOX12 1 83352 1.19973E-5 41676 0 3.97693E-6
17-6902081-G-A p.Arg156His missense ALOX12 2 83354 2.3994E-5 41677 0 3.57924E-5
17-6902106-G-A p.Met164Ile missense ALOX12 1 83382 1.1993E-5 41691 0 NA
17-6902108-G-C p.Arg165Thr missense ALOX12 1 83382 1.1993E-5 41691 0 NA
17-6902124-G-A p.Lys170Lys synonymous ALOX12 1 83366 1.19953E-5 41683 0 NA
17-6902126-G-T p.Arg171Met missense ALOX12 1 83360 1.19962E-5 41680 0 NA
17-6902145-A-C p.Thr177Thr synonymous ALOX12 1 83364 1.19956E-5 41682 0 3.18451E-5
17-6902155-G-A p.Gly181Arg missense+splice_region ALOX12 1 83366 1.19953E-5 41683 0 NA
17-6902277-T-C p.Leu183Pro missense ALOX12 4 83350 4.79904E-5 41675 0 8.239E-5
17-6902294-C-T p.Arg189Cys missense ALOX12 7 83352 8.39812E-5 41676 0 5.03525E-4
17-6902295-G-A p.Arg189His missense ALOX12 239 83346 0.00286756 41673 2 0.00669301
17-6902300-T-C p.Tyr191His missense ALOX12 1 83356 1.19967E-5 41678 0 6.37389E-5
17-6902319-G-A p.Trp197* stop_gained ALOX12 1 83342 1.19988E-5 41671 0 8.23859E-6
17-6902327-C-T p.Leu200Leu synonymous ALOX12 1 83334 1.19999E-5 41667 0 8.23873E-6
17-6902346-T-C p.Ile206Thr missense ALOX12 1 83286 1.20068E-5 41643 0 5.03525E-4
17-6902374-T-C p.Ala215Ala splice_region+synonymous ALOX12 1 83248 1.20123E-5 41624 0 NA
17-6902383-G-A c.646+8G>A splice_region ALOX12 1 83216 1.20169E-5 41608 0 7.96191E-6
17-6902625-A-T p.Glu216Val missense+splice_region ALOX12 1 83392 1.19916E-5 41696 0 NA
17-6902643-G-A p.Trp222* stop_gained ALOX12 1 83396 1.1991E-5 41698 0 NA
17-6902647-GGAT-G p.Asp225del disruptive_inframe_deletion ALOX12 1 83398 1.19907E-5 41699 0 8.23859E-6
17-6902648-G-T p.Asp224Tyr missense ALOX12 1 83404 1.19898E-5 41702 0 NA
17-6902667-A-T p.Tyr230Phe missense ALOX12 1 83406 1.19895E-5 41703 0 NA
17-6902705-C-T p.Arg243Cys missense ALOX12 2 83400 2.39808E-5 41700 0 8.23655E-6
17-6902706-G-A p.Arg243His missense ALOX12 1 83394 1.19913E-5 41697 0 2.47097E-5
17-6902706-G-T p.Arg243Leu missense ALOX12 1 83394 1.19913E-5 41697 0 NA
17-6902709-C-T p.Ser244Leu missense ALOX12 2 83380 2.39866E-5 41690 0 3.97652E-6
17-6902737-G-A p.Leu253Leu synonymous ALOX12 2 83364 2.39912E-5 41682 0 NA
17-6902743-G-A p.Ser255Ser synonymous ALOX12 49234 82724 0.59516 41362 14810 0.612865
17-6902750-G-A p.Glu258Lys missense ALOX12 1 83354 1.1997E-5 41677 0 3.5793E-5
17-6902753-G-A p.Glu259Lys missense ALOX12 5 83348 5.99894E-5 41674 0 4.14092E-4
17-6902755-G-A p.Glu259Glu synonymous ALOX12 2 83344 2.39969E-5 41672 0 3.18512E-5
17-6902759-C-T p.Gln261* stop_gained ALOX12 1 83332 1.20002E-5 41666 0 0.00100806
17-6902760-A-G p.Gln261Arg missense ALOX12 48703 82030 0.593722 41015 14585 0.614699
17-6902773-G-A p.Glu265Glu synonymous ALOX12 1 83314 1.20028E-5 41657 0 NA
17-6902775-A-G p.Lys266Arg missense ALOX12 1 83314 1.20028E-5 41657 0 6.76326E-5
17-6903659-G-C p.Gly271Ala missense ALOX12 1 83350 1.19976E-5 41675 0 NA
17-6903697-A-T p.Ile284Phe missense ALOX12 1 83392 1.19916E-5 41696 0 NA
17-6903700-C-G p.Pro285Ala missense ALOX12 2 83396 2.3982E-5 41698 0 NA
17-6903708-C-T p.Asn287Asn synonymous ALOX12 2 83396 2.3982E-5 41698 0 3.29468E-5
17-6903716-G-A p.Arg290Gln missense ALOX12 2 83396 2.3982E-5 41698 0 3.18695E-5
17-6903725-A-G p.Lys293Arg missense ALOX12 1 83388 1.19921E-5 41694 0 NA
17-6903739-G-GC p.Leu300fs frameshift ALOX12 1 83376 1.19939E-5 41688 0 3.18756E-5
17-6903747-C-T p.Leu300Leu synonymous ALOX12 3 83366 3.59859E-5 41683 0 2.47133E-5
17-6903747-C-A p.Leu300Leu synonymous ALOX12 1 83366 1.19953E-5 41683 0 3.97662E-6
17-6903748-G-A p.Val301Ile missense ALOX12 1 83370 1.19947E-5 41685 0 2.47129E-5
17-6903765-G-A p.Glu306Glu synonymous ALOX12 1 83352 1.19973E-5 41676 0 NA
17-6903785-C-T p.Pro313Leu missense ALOX12 1 83270 1.20091E-5 41635 0 NA
17-6903792-C-G p.Val315Val synonymous ALOX12 19 83246 2.28239E-4 41623 0 3.46523E-4
17-6903798-GGT-G c.951+1_951+2delGT splice_donor ALOX12 1 83204 1.20187E-5 41602 0 NA
17-6903799-G-A c.951+1G>A splice_donor ALOX12 3 83196 3.60594E-5 41598 0 6.26566E-4
17-6904934-A-G p.Asn322Ser missense ALOX12 29275 80946 0.361661 40473 5343 0.416875
17-6904938-C-T p.Pro323Pro synonymous ALOX12 2 83136 2.4057E-5 41568 0 NA
17-6904955-C-T p.Thr329Ile missense ALOX12 3 83208 3.60542E-5 41604 0 2.47105E-5
17-6904970-C-T p.Ser334Leu missense ALOX12 2 83250 2.4024E-5 41625 0 3.1841E-5
17-6904973-A-AC p.Leu338fs frameshift ALOX12 1 83216 1.20169E-5 41608 0 NA
17-6904973-AC-A p.Pro337fs frameshift ALOX12 1 83218 1.20166E-5 41609 0 NA
17-6904979-C-T p.Pro337Leu missense ALOX12 26 83240 3.1235E-4 41620 0 8.27867E-4
17-6904979-C-A p.Pro337Gln missense ALOX12 5 83240 6.00673E-5 41620 0 3.1841E-5
17-6904979-C-G p.Pro337Arg missense ALOX12 4 83240 4.80538E-5 41620 0 1.07075E-4
17-6904980-A-G p.Pro337Pro synonymous ALOX12 3 83234 3.6043E-5 41617 0 6.38121E-5
17-6904986-C-T p.Ala339Ala synonymous ALOX12 2 83228 2.40304E-5 41614 0 NA
17-6904989-G-A p.Trp340* stop_gained ALOX12 1 83214 1.20172E-5 41607 0 NA
17-6904993-C-T p.Leu342Leu synonymous ALOX12 1 83232 1.20146E-5 41616 0 0.00100705
17-6904998-A-C p.Ala343Ala synonymous ALOX12 79 83266 9.48767E-4 41633 0 0.0020141
17-6905003-C-T p.Ser345Phe missense ALOX12 1 83256 1.20111E-5 41628 0 NA
17-6905009-TC-T p.Arg348fs frameshift ALOX12 1 83248 1.20123E-5 41624 0 NA
17-6905011-C-T p.Arg348* stop_gained ALOX12 5 83260 6.00528E-5 41630 0 3.18634E-5
17-6905014-A-G p.Asn349Asp missense ALOX12 1 83272 1.20088E-5 41636 0 NA
17-6905015-A-G p.Asn349Ser missense ALOX12 1 83280 1.20077E-5 41640 0 NA
17-6905028-A-G p.Gln353Gln synonymous ALOX12 2 83266 2.40194E-5 41633 0 8.2371E-5
17-6905031-G-A p.Leu354Leu synonymous ALOX12 1 83252 1.20117E-5 41626 0 NA
17-6905034-C-T p.His355His synonymous ALOX12 6 83264 7.206E-5 41632 0 0.00100705
17-6905042-A-C p.Gln358Pro missense ALOX12 1 83266 1.20097E-5 41633 0 3.97636E-6
17-6905061-T-G p.Thr364Thr synonymous ALOX12 47650 82164 0.579938 41082 13955 0.591779
17-6905061-TCA-GCG p.ThrHis364ThrArg missense ALOX12 2 83208 2.40361E-5 41604 0 NA
17-6905062-C-G p.His365Asp missense ALOX12 2 83208 2.40361E-5 41604 0 NA
17-6905082-C-T p.Ile371Ile synonymous ALOX12 3 83162 3.60742E-5 41581 0 3.1841E-5
17-6905083-G-A p.Ala372Thr missense ALOX12 1 83168 1.20239E-5 41584 0 NA
17-6905086-G-A p.Val373Ile missense ALOX12 2 83140 2.40558E-5 41570 0 NA
17-6905087-T-C p.Val373Ala missense ALOX12 1 83134 1.20288E-5 41567 0 3.18593E-5
17-6905089-G-A p.Ala374Thr missense ALOX12 6 83126 7.21796E-5 41563 0 3.18634E-5
17-6905098-C-T p.Arg377Trp missense ALOX12 2 83124 2.40604E-5 41562 0 NA
17-6905116-C-T p.His383Tyr missense ALOX12 1 83012 1.20465E-5 41506 0 8.28514E-6
17-6905122-A-C p.Ile385Leu missense ALOX12 1 82996 1.20488E-5 41498 0 7.96318E-6
17-6908568-C-T c.1162-8C>T splice_region ALOX12 2 83232 2.40292E-5 41616 0 NA
17-6908594-C-T p.Arg394Cys missense ALOX12 2 83342 2.39975E-5 41671 0 5.03525E-4
17-6908595-G-A p.Arg394His missense ALOX12 1 83332 1.20002E-5 41666 0 2.47137E-5
17-6908618-C-T p.Arg402Trp missense ALOX12 1 83328 1.20008E-5 41664 0 7.95267E-6
17-6908619-G-A p.Arg402Gln missense ALOX12 9 83324 1.08012E-4 41662 0 1.03385E-4
17-6908624-C-T p.Arg404Trp missense ALOX12 3 83320 3.60058E-5 41660 0 2.78346E-5
17-6908625-G-A p.Arg404Gln missense ALOX12 232 83310 0.00278478 41655 0 0.00322293
17-6908628-C-A p.Thr405Asn missense ALOX12 1 83302 1.20045E-5 41651 0 NA
17-6908632-A-G p.Gln406Gln synonymous ALOX12 1 83306 1.20039E-5 41653 0 NA
17-6908643-A-T p.Asp410Val missense ALOX12 4 83270 4.80365E-5 41635 0 3.97665E-6
17-6909202-A-G p.His425Arg missense ALOX12 1 81352 1.22923E-5 40676 0 8.28638E-6
17-6909216-C-T p.Arg430Cys missense ALOX12 3 81780 3.66838E-5 40890 0 3.30863E-5
17-6909216-C-CGTCGGG p.Arg431_Ala432insGlyArg disruptive_inframe_insertion ALOX12 3 81780 3.66838E-5 40890 0 3.19285E-5
17-6909217-G-A p.Arg430His missense ALOX12 239 81820 0.00292105 40910 2 0.00578275
17-6909219-C-T p.Arg431Trp missense ALOX12 1 81876 1.22136E-5 40938 0 1.19568E-5
17-6909220-G-A p.Arg431Gln missense ALOX12 1 81916 1.22076E-5 40958 0 5.03525E-4
17-6909223-C-T p.Ala432Val missense ALOX12 6 82030 7.3144E-5 41015 0 3.58666E-5
17-6909224-G-A p.Ala432Ala synonymous ALOX12 10 82140 1.21743E-4 41070 0 7.17126E-5
17-6909233-G-A p.Gln435Gln synonymous ALOX12 91 82360 0.00110491 41180 2 0.00251762
17-6909245-C-T p.Cys439Cys synonymous ALOX12 1 82582 1.21092E-5 41291 0 1.19378E-5
17-6909248-CCT-C p.Cys442fs frameshift ALOX12 2 82664 2.41943E-5 41332 0 NA
17-6909277-G-A p.Arg450Gln missense ALOX12 3 82708 3.62722E-5 41354 0 6.44496E-5
17-6909282-C-T p.Leu452Leu synonymous ALOX12 5 82694 6.04639E-5 41347 0 8.25832E-6
17-6909304-T-A p.Leu459His missense ALOX12 1 82214 1.21634E-5 41107 0 NA
17-6909314-T-C p.His462His synonymous ALOX12 1 81700 1.22399E-5 40850 0 8.2765E-6
17-6909324-C-T p.Arg466Trp missense ALOX12 3 80776 3.71397E-5 40388 0 7.3888E-5
17-6909348-T-TATGTG c.1418+2_1418+3insATGTG splice_region ALOX12 3 75532 3.97183E-5 37766 0 NA
17-6909802-C-A c.1419-3C>A splice_region ALOX12 1 82972 1.20523E-5 41486 0 1.65796E-5
17-6909803-AG-A c.1419-1delG splice_acceptor ALOX12 1 82984 1.20505E-5 41492 0 NA
17-6909805-G-A p.Arg473Arg splice_region+synonymous ALOX12 1 82988 1.20499E-5 41494 0 3.98632E-6
17-6909820-C-T p.Ile478Ile synonymous ALOX12 1 83084 1.2036E-5 41542 0 3.19101E-5
17-6909821-G-A p.Val479Ile missense ALOX12 6 83090 7.22109E-5 41545 0 6.38081E-5
17-6909828-T-C p.Leu481Pro missense ALOX12 1 83152 1.20262E-5 41576 0 3.30262E-5
17-6909836-C-T p.Gln484* stop_gained ALOX12 1 83220 1.20163E-5 41610 0 3.18837E-5
17-6909838-A-G p.Gln484Gln synonymous ALOX12 6240 83092 0.0750975 41546 496 0.117312
17-6909841-G-T p.Arg485Ser missense ALOX12 1 83230 1.20149E-5 41615 0 NA
17-6909865-T-C p.Pro493Pro synonymous ALOX12 4 83288 4.80261E-5 41644 0 8.28144E-6
17-6909884-C-T p.Arg500Trp missense ALOX12 2 83218 2.40333E-5 41609 0 1.67191E-5
17-6909885-G-A p.Arg500Gln missense ALOX12 3 83228 3.60456E-5 41614 0 5.85157E-5
17-6909890-A-T p.Ile502Phe missense ALOX12 30 83212 3.60525E-4 41606 0 1.72131E-4
17-6909894-C-T p.Thr503Met missense ALOX12 2 83188 2.40419E-5 41594 0 NA
17-6909895-G-A p.Thr503Thr synonymous ALOX12 1 83214 1.20172E-5 41607 0 1.20285E-5
17-6909901-G-A p.Val505Val synonymous ALOX12 1 83214 1.20172E-5 41607 0 NA
17-6909913-G-A p.Gln509Gln synonymous ALOX12 1 83162 1.20247E-5 41581 0 8.53373E-6
17-6909923-C-G p.Arg513Gly missense ALOX12 1 83072 1.20378E-5 41536 0 NA
17-6909923-C-A p.Arg513Arg synonymous ALOX12 2 83072 2.40755E-5 41536 0 4.2167E-6
17-6913058-C-T c.1541-8C>T splice_region ALOX12 48 83290 5.763E-4 41645 0 2.34802E-4
17-6913091-G-A p.Gln522Gln synonymous ALOX12 2 83346 2.39964E-5 41673 0 3.29522E-5
17-6913112-C-T p.Leu529Leu synonymous ALOX12 14 83350 1.67966E-4 41675 0 2.22902E-4
17-6913119-T-A p.Cys532Ser missense ALOX12 4 83344 4.79939E-5 41672 0 3.29462E-5
17-6913121-C-T p.Cys532Cys synonymous ALOX12 11 83350 1.31974E-4 41675 0 1.27462E-4
17-6913122-G-A p.Val533Ile missense ALOX12 2 83350 2.39952E-5 41675 0 6.37267E-5
17-6913129-C-T p.Thr535Met missense ALOX12 3 83332 3.60006E-5 41666 0 3.29468E-5
17-6913130-G-A p.Thr535Thr synonymous ALOX12 74 83326 8.88078E-4 41663 0 0.00149084
17-6913134-A-G p.Thr537Ala missense ALOX12 2 83330 2.4001E-5 41665 0 NA
17-6913136-T-C p.Thr537Thr synonymous ALOX12 1 83332 1.20002E-5 41666 0 3.18431E-5
17-6913162-GCCAGGTATGGACAGCTGAAAGCCCAGGTCCCTGAAGGCAAGGTGACCTGAGGGAGAGATGGGAGTTCAAACCCTAAGTACCAGGGTTCTAGGGTTACAGTTTCTTCCT-G p.Gln547fs frameshift ALOX12 7 83336 8.39973E-5 41668 0 NA
17-6913276-T-A p.Leu548Gln missense+splice_region ALOX12 1 83126 1.20299E-5 41563 0 NA
17-6913325-C-T p.Pro564Pro synonymous ALOX12 11 82794 1.3286E-4 41397 0 4.77802E-5
17-6913331-C-T p.Pro566Pro synonymous ALOX12 2 82780 2.41604E-5 41390 0 3.18512E-5
17-6913334-C-G p.Thr567Thr synonymous ALOX12 1 82814 1.20753E-5 41407 0 NA
17-6913336-C-A p.Thr568Asn missense ALOX12 366 82828 0.0044188 41414 2 0.00432407
17-6913341-G-A p.Glu570Lys missense ALOX12 2 82850 2.414E-5 41425 0 1.6503E-5
17-6913354-T-G p.Met574Arg missense ALOX12 1 82898 1.2063E-5 41449 0 NA
17-6913369-G-C p.Gly579Ala missense ALOX12 8 82910 9.64902E-5 41455 0 6.25E-4
17-6913387-G-A p.Arg585Gln missense ALOX12 2 83006 2.40946E-5 41503 0 6.25E-4
17-6913414-C-T p.Ser594Leu missense ALOX12 2 83164 2.40489E-5 41582 1 NA
17-6913422-C-T p.Leu597Leu synonymous ALOX12 32 83172 3.84745E-4 41586 0 7.96635E-4
17-6913429-G-A p.Arg599His missense ALOX12 2 83174 2.4046E-5 41587 0 2.40283E-5
17-6913431-C-T p.Arg600Cys missense ALOX12 1 83190 1.20207E-5 41595 0 4.00606E-6
17-6913432-G-A p.Arg600His missense ALOX12 2 83194 2.40402E-5 41597 0 1.67887E-5
17-6913444-TGGTGAGAGGGGACTCTCGGGAGAGGGAAATGACAGTTGGAAAGGAAACATCAGAGTGAGGGGCTGGGCTCTAGGTGCGTTTGTCTTTAGAAACTGACTGATCCTTTGTTCTGTCTCA-T p.Val605fs frameshift ALOX12 4 83202 4.80758E-5 41601 0 NA
17-6913450-G-C c.1812+5G>C splice_region ALOX12 1 83216 1.20169E-5 41608 0 NA
17-6913567-C-T p.Pro606Leu missense ALOX12 1 83316 1.20025E-5 41658 0 3.18512E-5
17-6913575-C-A p.His609Asn missense ALOX12 2 83318 2.40044E-5 41659 0 3.99885E-6
17-6913582-A-G p.Lys611Arg missense ALOX12 3 83346 3.59945E-5 41673 0 6.37024E-5
17-6913602-C-T p.Pro618Ser missense ALOX12 1 83344 1.19985E-5 41672 0 NA
17-6913603-C-T p.Pro618Leu missense ALOX12 3 83348 3.59937E-5 41674 0 1.65879E-5
17-6913633-G-A p.Arg628Gln missense ALOX12 37 83362 4.43847E-4 41681 0 3.72325E-4
17-6913652-G-A p.Leu634Leu synonymous ALOX12 8738 83272 0.104933 41636 504 0.145
17-6913658-G-A p.Lys636Lys synonymous ALOX12 1 83364 1.19956E-5 41682 0 NA
17-6913659-G-A p.Glu637Lys missense ALOX12 1 83364 1.19956E-5 41682 0 NA
17-6913666-C-T p.Thr639Ile missense ALOX12 1 83366 1.19953E-5 41683 0 NA
17-6913671-C-T p.Arg641Trp missense ALOX12 3 83358 3.59893E-5 41679 0 6.36983E-5
17-6913686-G-A p.Asp646Asn missense ALOX12 1 83362 1.19959E-5 41681 0 NA
17-6913695-T-C p.Tyr649His missense ALOX12 1 83362 1.19959E-5 41681 0 2.47366E-5
17-6913696-A-G p.Tyr649Cys missense ALOX12 1 83366 1.19953E-5 41683 0 8.24511E-6
17-6913697-T-C p.Tyr649Tyr synonymous ALOX12 2 83364 2.39912E-5 41682 0 8.24593E-6
17-6913704-C-G p.Leu652Val missense ALOX12 2 83350 2.39952E-5 41675 0 NA
17-6913704-C-A p.Leu652Met missense ALOX12 3 83350 3.59928E-5 41675 0 NA
17-6913704-C-T p.Leu652Leu synonymous ALOX12 1 83350 1.19976E-5 41675 0 2.38631E-5
17-6913718-C-T p.Cys656Cys synonymous ALOX12 39 83344 4.6794E-4 41672 0 9.87073E-4
17-6913724-G-A p.Glu658Glu synonymous ALOX12 2 83344 2.39969E-5 41672 0 5.03525E-4