Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
2-3705817-C-T c.-130C>T 5_prime_UTR_premature_start_codon_gain ALLC 30 2948 0.0101764 1474 2 0.0295298
2-3718679-CT-C c.-62-6delT splice_region ALLC 1 81348 1.22929E-5 40674 0 NA
2-3718692-C-T c.-56C>T 5_prime_UTR_premature_start_codon_gain ALLC 28869 79816 0.361694 39908 5149 0.40487
2-3718693-G-T c.-55G>T 5_prime_UTR_premature_start_codon_gain ALLC 3 81616 3.67575E-5 40808 0 NA
2-3718704-C-T c.-44C>T 5_prime_UTR_premature_start_codon_gain ALLC 1 81748 1.22327E-5 40874 0 1.1214E-5
2-3718724-C-T c.-24C>T 5_prime_UTR_premature_start_codon_gain ALLC 4 82026 4.8765E-5 41013 0 1.31501E-4
2-3718749-T-C p.Met1? start_lost ALLC 9 82180 1.09516E-4 41090 0 6.35593E-5
2-3718751-G-A p.Asp2Asn missense ALLC 3 82174 3.65079E-5 41087 0 6.37227E-5
2-3718752-A-G p.Asp2Gly missense ALLC 1 82166 1.21705E-5 41083 0 NA
2-3718755-T-C p.Met3Thr missense ALLC 2 82166 2.4341E-5 41083 0 1.22241E-5
2-3718766-T-A p.Ser7Thr missense ALLC 7 82168 8.51913E-5 41084 0 1.27429E-4
2-3718768-C-T p.Ser7Ser synonymous ALLC 8 82164 9.73662E-5 41082 0 2.86734E-4
2-3718769-G-A p.Val8Ile missense ALLC 4 82146 4.86938E-5 41073 0 3.24009E-5
2-3718770-T-C p.Val8Ala missense ALLC 1 82140 1.21743E-5 41070 0 NA
2-3718773-G-C p.Gly9Ala missense ALLC 14 82146 1.70428E-4 41073 0 0.00125
2-3721662-T-C c.34-3T>C splice_region ALLC 1 81978 1.21984E-5 40989 0 5.97036E-6
2-3721684-A-T p.Asp18Val missense ALLC 1 82134 1.21752E-5 41067 0 3.73134E-5
2-3721711-T-C p.Ile27Thr missense ALLC 1 82154 1.21723E-5 41077 0 3.1839E-5
2-3721712-A-G p.Ile27Met missense ALLC 1 82162 1.21711E-5 41081 0 NA
2-3721714-AG-A p.Asn25fs frameshift ALLC 1 82166 1.21705E-5 41083 0 1.12671E-5
2-3726052-C-A c.85-6C>A splice_region ALLC 1009 82380 0.0122481 41190 38 0.0251178
2-3726057-G-C c.85-1G>C splice_acceptor ALLC 1 82470 1.21256E-5 41235 0 2.80845E-5
2-3726068-C-G p.Pro32Arg missense ALLC 5 82480 6.06208E-5 41240 0 6.82074E-5
2-3726068-C-T p.Pro32Leu missense ALLC 1 82480 1.21242E-5 41240 0 4.0122E-6
2-3726069-G-A p.Pro32Pro synonymous ALLC 7 82486 8.48629E-5 41243 0 5.81096E-5
2-3726070-T-C p.Cys33Arg missense ALLC 5 82488 6.06149E-5 41244 0 3.1841E-5
2-3726077-A-G p.Lys35Arg missense ALLC 1 82514 1.21192E-5 41257 0 8.29573E-6
2-3726083-A-C p.His37Pro missense ALLC 294 82506 0.00356338 41253 1 0.00286429
2-3726084-T-G p.His37Gln missense ALLC 1 82520 1.21183E-5 41260 0 NA
2-3726090-T-C p.Tyr39Tyr synonymous ALLC 1039 82492 0.0125952 41246 41 0.0255144
2-3726092-C-T p.Thr40Met missense ALLC 4 82518 4.84743E-5 41259 0 1.91071E-4
2-3726093-G-A p.Thr40Thr synonymous ALLC 3 82512 3.63583E-5 41256 0 4.01152E-6
2-3726100-G-A p.Gly43Arg missense ALLC 1 82518 1.21186E-5 41259 0 8.02298E-6
2-3726103-A-AAATG p.Trp45fs frameshift ALLC 2 82522 2.4236E-5 41261 0 NA
2-3726106-T-C p.Trp45Arg missense ALLC 11 82518 1.33304E-4 41259 0 3.18552E-4
2-3726122-A-G p.Glu50Gly missense ALLC 1 82496 1.21218E-5 41248 0 6.25E-4
2-3726136-A-G p.Arg55Gly missense ALLC 20 82462 2.42536E-4 41231 0 2.86569E-4
2-3727454-C-T c.173-5C>T splice_region ALLC 1 82532 1.21165E-5 41266 0 2.48381E-5
2-3727455-G-A c.173-4G>A splice_region ALLC 2 82538 2.42313E-5 41269 0 3.18552E-5
2-3727464-G-T p.Asp60Tyr missense ALLC 12 82550 1.45366E-4 41275 0 0.00125
2-3727472-T-C p.Cys62Cys synonymous ALLC 1 82562 1.21121E-5 41281 0 5.2141E-5
2-3727482-C-G p.Leu66Val missense ALLC 1 82572 1.21106E-5 41286 0 NA
2-3727487-G-A p.Gly67Gly synonymous ALLC 2 82568 2.42225E-5 41284 0 3.18532E-5
2-3727488-A-T p.Ile68Phe missense ALLC 1 82568 1.21112E-5 41284 0 4.01097E-6
2-3727493-A-G p.Gln69Gln synonymous ALLC 5 82576 6.05503E-5 41288 0 4.96771E-5
2-3727500-A-C p.Ile72Leu missense ALLC 1 82582 1.21092E-5 41291 0 NA
2-3727503-C-T p.Arg73Trp missense ALLC 16 82582 1.93747E-4 41291 0 0.00100705
2-3727511-C-T p.Phe75Phe synonymous ALLC 1 82580 1.21095E-5 41290 0 6.37105E-5
2-3727512-G-A p.Asp76Asn missense ALLC 1 82582 1.21092E-5 41291 0 8.27965E-6
2-3727514-C-T p.Asp76Asp synonymous ALLC 8 82580 9.68758E-5 41290 0 1.32367E-4
2-3727519-A-C p.Asp78Ala missense ALLC 1 82572 1.21106E-5 41286 0 NA
2-3727521-G-A p.Val79Ile missense ALLC 2 82568 2.42225E-5 41284 0 5.03525E-4
2-3727525-C-G p.Ser80Cys missense ALLC 6 82576 7.26603E-5 41288 0 2.86642E-4
2-3727530-T-C p.Phe82Leu missense ALLC 1 82578 1.21098E-5 41289 0 8.27965E-6
2-3727535-G-A p.Thr83Thr synonymous ALLC 7 82576 8.47704E-5 41288 0 6.0167E-5
2-3727536-G-A p.Gly84Arg missense ALLC 2 82576 2.42201E-5 41288 0 8.27965E-6
2-3727544-C-T p.Tyr86Tyr synonymous ALLC 70 82576 8.47704E-4 41288 0 0.00151057
2-3727544-C-G p.Tyr86* stop_gained ALLC 2 82578 2.42195E-5 41289 0 1.65601E-5
2-3727545-G-A p.Ala87Thr missense ALLC 18 82576 2.17981E-4 41288 0 6.25E-4
2-3727546-C-T p.Ala87Val missense ALLC 2 82574 2.42207E-5 41287 0 8.28007E-6
2-3727547-T-C p.Ala87Ala synonymous ALLC 2 82574 2.42207E-5 41287 0 8.2802E-6
2-3727551-C-T p.Arg89* stop_gained ALLC 20 82568 2.42225E-4 41284 0 6.37024E-4
2-3727552-G-C p.Arg89Pro missense ALLC 1 82570 1.21109E-5 41285 0 3.18512E-5
2-3727559-C-T p.Ser91Ser synonymous ALLC 1 82564 1.21118E-5 41282 0 NA
2-3727570-C-A p.Ala95Glu missense ALLC 5 82554 6.05664E-5 41277 0 6.36943E-5
2-3727576-TG-T p.Glu98fs frameshift ALLC 1 82538 1.21156E-5 41269 0 NA
2-3727584-G-T p.Asp100Tyr missense+splice_region ALLC 1 82530 1.21168E-5 41265 0 4.01142E-6
2-3727585-G-T c.298+1G>T splice_donor ALLC 3 82530 3.63504E-5 41265 0 NA
2-3727589-G-A c.298+5G>A splice_region ALLC 3 82520 3.63548E-5 41260 0 3.18573E-5
2-3729177-TGATTTTGAACCCTAATCTTAATCCTGAATGGTCATTCCAACTACA-T c.299-46_299-2delGATTTTGAACCCTAATCTTAATCCTGAATGGTCATTCCAACTACA splice_acceptor ALLC 1 81094 1.23314E-5 40547 0 NA
2-3729215-C-CA c.299-9_299-8insA splice_region ALLC 4 82254 4.86299E-5 41127 0 1.40241E-5
2-3729220-A-G c.299-4A>G splice_region ALLC 6 82336 7.28721E-5 41168 0 2.86752E-4
2-3729226-A-T p.Lys101* stop_gained ALLC 14 82406 1.69891E-4 41203 0 2.2293E-4
2-3729229-C-T p.Leu102Leu synonymous ALLC 2 82424 2.42648E-5 41212 0 NA
2-3729251-G-T p.Gly109Val missense ALLC 86 82504 0.00104237 41252 0 0.001875
2-3729254-C-T p.Thr110Ile missense ALLC 15873 82020 0.193526 41010 1692 0.206865
2-3729257-G-A p.Arg111Lys missense ALLC 1 82526 1.21174E-5 41263 0 1.04052E-5
2-3729269-C-T p.Ala115Val missense ALLC 1 82544 1.21148E-5 41272 0 3.18552E-5
2-3729280-G-A p.Glu119Lys missense ALLC 1 82542 1.2115E-5 41271 0 5.03525E-4
2-3729287-T-G p.Phe121Cys missense ALLC 1 82540 1.21153E-5 41270 0 3.34978E-5
2-3729290-A-G p.Glu122Gly missense ALLC 1 82544 1.21148E-5 41272 0 NA
2-3729298-G-T p.Ala125Ser missense ALLC 29 82490 3.51558E-4 41245 0 0.00251762
2-3729305-T-C c.378+2T>C splice_donor ALLC 1 82450 1.21286E-5 41225 0 2.40356E-5
2-3730516-CTATATTTATTGCTAGCTAA-C p.Leu127fs frameshift ALLC 1 82562 1.21121E-5 41281 0 NA
2-3730538-TCC-T p.Ser129fs frameshift ALLC 1 82706 1.2091E-5 41353 0 NA
2-3730544-G-A p.Asp131Asn missense ALLC 1 82742 1.20858E-5 41371 0 1.65681E-5
2-3730554-AC-A p.Leu135fs frameshift ALLC 1 82764 1.20825E-5 41382 0 NA
2-3730567-G-T p.Met138Ile missense ALLC 1 82786 1.20793E-5 41393 0 NA
2-3730567-G-A p.Met138Ile missense ALLC 4 82788 4.83162E-5 41394 0 3.18471E-5
2-3730574-C-A p.Leu141Ile missense ALLC 1 82798 1.20776E-5 41399 0 NA
2-3730576-T-C p.Leu141Leu synonymous ALLC 2 82800 2.41546E-5 41400 0 4.01139E-6
2-3730589-C-G p.Pro146Ala missense ALLC 3 82798 3.62328E-5 41399 0 6.36862E-5
2-3730594-T-C p.Ala147Ala synonymous ALLC 29 82794 3.50267E-4 41397 0 6.25E-4
2-3730597-C-T p.Ser148Ser synonymous ALLC 3 82788 3.62371E-5 41394 0 3.1835E-5
2-3730598-G-A p.Gly149Ser missense ALLC 7 82774 8.45676E-5 41387 0 2.48414E-5
2-3730598-G-T p.Gly149Cys missense ALLC 1 82774 1.20811E-5 41387 0 NA
2-3730612-TC-T p.Val155fs frameshift ALLC 1 82774 1.20811E-5 41387 0 NA
2-3730618-C-T p.Val155Val synonymous ALLC 4 82776 4.83232E-5 41388 0 3.18451E-5
2-3730629-A-ATTCCCAGCG p.Gln159delinsHisSerGlnArg disruptive_inframe_insertion ALLC 1 82766 1.20823E-5 41383 0 4.01136E-6
2-3730629-A-C p.Gln159Pro missense ALLC 1 82766 1.20823E-5 41383 0 8.28089E-6
2-3730635-G-A p.Trp161* stop_gained ALLC 46 82752 5.55878E-4 41376 0 7.32298E-4
2-3730643-A-G p.Ile164Val missense ALLC 2 82738 2.41727E-5 41369 0 NA
2-3730644-T-C p.Ile164Thr missense ALLC 91 82728 0.00109999 41364 0 0.00289735
2-3730653-A-G p.Asn167Ser missense ALLC 6 82686 7.25637E-5 41343 0 5.04541E-4
2-3730671-G-A c.511+7G>A splice_region ALLC 1 82578 1.21098E-5 41289 0 NA
2-3743312-G-T p.Gly173* stop_gained ALLC 1 82682 1.20945E-5 41341 0 NA
2-3743318-G-T p.Ala175Ser missense ALLC 1 82696 1.20925E-5 41348 0 NA
2-3743321-C-T p.Arg176* stop_gained ALLC 3 82704 3.62739E-5 41352 0 5.03525E-4
2-3743322-G-A p.Arg176Gln missense ALLC 1 82706 1.2091E-5 41353 0 6.37105E-5
2-3743327-A-C p.Arg178Arg synonymous ALLC 1 82720 1.2089E-5 41360 0 4.01213E-6
2-3743333-T-C p.Phe180Leu missense ALLC 2 82740 2.41721E-5 41370 0 4.45831E-4
2-3743336-G-A p.Gly181Ser missense ALLC 1 82740 1.20861E-5 41370 0 8.02452E-6
2-3743337-G-T p.Gly181Val missense ALLC 1 82740 1.20861E-5 41370 0 1.20365E-5
2-3743339-A-C p.Thr182Pro missense ALLC 2 82750 2.41692E-5 41375 0 3.31906E-5
2-3743344-A-G p.Gly183Gly synonymous ALLC 1 82760 1.20831E-5 41380 0 NA
2-3743355-G-A p.Trp187* stop_gained ALLC 5 82778 6.04025E-5 41389 0 1.65909E-5
2-3743367-AC-A p.Glu194fs frameshift ALLC 5 82774 6.04054E-5 41387 0 0.00100705
2-3743378-C-A p.Pro195Thr missense ALLC 1 82796 1.20779E-5 41398 0 8.29518E-6
2-3743384-G-C p.Asp197His missense ALLC 3 82804 3.62301E-5 41402 0 8.02542E-6
2-3743390-G-GT p.Ala200fs frameshift ALLC 1 82800 1.20773E-5 41400 0 NA
2-3743398-C-T p.Ile201Ile synonymous ALLC 15 82792 1.81177E-4 41396 0 1.40456E-4
2-3743399-G-A p.Ala202Thr missense ALLC 85 82796 0.00102662 41398 0 0.00178287
2-3743405-G-A p.Gly204Arg missense ALLC 1 82804 1.20767E-5 41402 0 NA
2-3743406-G-T p.Gly204Val missense ALLC 1 82802 1.2077E-5 41401 0 1.66165E-5
2-3743416-T-C p.Cys207Cys synonymous ALLC 1 82812 1.20755E-5 41406 0 8.32542E-6
2-3743437-G-C p.Lys214Asn missense ALLC 7 82786 8.45554E-5 41393 0 8.41864E-5
2-3743441-G-C p.Gly216Arg missense ALLC 1 82784 1.20796E-5 41392 0 8.45094E-6
2-3743453-A-G p.Asn220Asp missense ALLC 1 82774 1.20811E-5 41387 0 NA
2-3743456-A-G p.Ile221Val missense ALLC 1 82768 1.2082E-5 41384 0 9.55231E-5
2-3743458-A-G p.Ile221Met missense ALLC 3 82766 3.62468E-5 41383 0 8.66191E-6
2-3743467-GA-G c.667+6delA splice_region ALLC 1 82750 1.20846E-5 41375 0 1.31321E-4
2-3743469-T-C c.667+7T>C splice_region ALLC 1 82742 1.20858E-5 41371 0 8.53927E-6
2-3743864-G-T c.668-1G>T splice_acceptor ALLC 1 82518 1.21186E-5 41259 0 NA
2-3743868-T-C p.Val224Ala missense ALLC 3 82524 3.63531E-5 41262 0 1.59337E-4
2-3743870-G-T p.Gly225Cys missense ALLC 128 82522 0.0015511 41261 0 0.0010826
2-3743872-C-T p.Gly225Gly synonymous ALLC 2 82522 2.4236E-5 41261 0 0.00201613
2-3743873-G-A p.Gly226Arg missense ALLC 5 82524 6.05884E-5 41262 0 1.2073E-5
2-3743885-A-G p.Met230Val missense ALLC 1 82548 1.21142E-5 41274 0 8.36946E-6
2-3743889-C-T p.Ala231Val missense ALLC 4 82546 4.84578E-5 41273 0 2.51096E-5
2-3743890-G-A p.Ala231Ala synonymous ALLC 4 82538 4.84625E-5 41269 0 4.18438E-5
2-3743895-G-A p.Gly233Asp missense ALLC 1 82548 1.21142E-5 41274 0 NA
2-3743898-G-A p.Trp234* stop_gained ALLC 2 82546 2.42289E-5 41273 0 9.20564E-5
2-3743899-G-A p.Trp234* stop_gained ALLC 1 82540 1.21153E-5 41270 0 NA
2-3743907-C-A p.Ala237Glu missense ALLC 1 82542 1.2115E-5 41271 0 NA
2-3743913-G-A p.Arg239Lys missense ALLC 3 82538 3.63469E-5 41269 0 8.42332E-6
2-3743916-T-G p.Leu240Arg missense ALLC 1 82536 1.21159E-5 41268 0 NA
2-3743918-G-A p.Asp241Asn missense ALLC 1 82536 1.21159E-5 41268 0 NA
2-3743918-G-T p.Asp241Tyr missense ALLC 1 82536 1.21159E-5 41268 0 8.85127E-5
2-3743920-C-T p.Asp241Asp synonymous ALLC 2 82540 2.42307E-5 41270 0 NA
2-3743921-C-T p.Arg242Trp missense ALLC 7 82536 8.48115E-5 41268 0 6.25E-4
2-3743922-G-A p.Arg242Gln missense ALLC 8 82532 9.69321E-5 41266 0 7.66976E-5
2-3743933-T-G p.Leu246Val missense ALLC 1 82522 1.2118E-5 41261 0 1.62035E-5
2-3744931-A-G c.742-7A>G splice_region ALLC 1 82704 1.20913E-5 41352 0 9.55171E-5
2-3744946-G-C p.Glu250Asp missense ALLC 2 82744 2.41709E-5 41372 0 8.28281E-6
2-3744952-C-T p.Gly252Gly synonymous ALLC 1 82762 1.20828E-5 41381 0 8.28199E-6
2-3744964-T-C p.Val256Val synonymous ALLC 1 82786 1.20793E-5 41393 0 8.28116E-6
2-3744974-G-T p.Glu260* stop_gained ALLC 1 82784 1.20796E-5 41392 0 NA
2-3744983-G-A p.Val263Ile missense ALLC 2 82768 2.41639E-5 41384 0 3.20945E-5
2-3744989-C-T p.Arg265* stop_gained ALLC 7 82770 8.45717E-5 41385 0 1.2738E-4
2-3744990-G-A p.Arg265Gln missense ALLC 388 82770 0.00468769 41385 4 0.00818315
2-3744990-G-T p.Arg265Leu missense ALLC 1 82778 1.20805E-5 41389 0 6.25391E-4
2-3744998-C-A p.His268Asn missense ALLC 2 82762 2.41657E-5 41381 0 NA
2-3745016-C-T p.Arg274* stop_gained ALLC 1 82742 1.20858E-5 41371 0 8.02523E-6
2-3745017-G-C p.Arg274Pro missense ALLC 1 82728 1.20878E-5 41364 0 1.20375E-5
2-3745017-G-A p.Arg274Gln missense ALLC 2 82728 2.41756E-5 41364 0 6.37024E-5
2-3745026-T-TTGACC p.Thr279fs frameshift ALLC 19 82688 2.29779E-4 41344 0 6.69088E-4
2-3745029-A-C p.Asp278Ala missense ALLC 1 82678 1.20951E-5 41339 0 NA
2-3745030-C-G p.Asp278Glu missense ALLC 144 82674 0.00174178 41337 0 0.00149739
2-3745038-A-G p.Tyr281Cys missense ALLC 2 82630 2.42043E-5 41315 0 NA
2-3745046-G-C p.Gly284Arg missense+splice_region ALLC 1 82596 1.21071E-5 41298 0 4.01439E-6
2-3749095-C-T c.851-7C>T splice_region ALLC 2 82428 2.42636E-5 41214 0 5.066E-5
2-3749095-C-G c.851-7C>G splice_region ALLC 1 82428 1.21318E-5 41214 0 4.14491E-5
2-3749098-A-T c.851-4A>T splice_region ALLC 1 82448 1.21289E-5 41224 0 NA
2-3749107-G-A p.Ala286Thr missense ALLC 1 82482 1.21239E-5 41241 0 NA
2-3749109-T-A p.Ala286Ala synonymous ALLC 1 82494 1.21221E-5 41247 0 1.35387E-4
2-3749115-C-T p.Asp288Asp synonymous ALLC 1 82500 1.21212E-5 41250 0 2.23471E-4
2-3749118-C-T p.Ser289Ser synonymous ALLC 2 82524 2.42354E-5 41262 0 NA
2-3749119-T-C p.Cys290Arg missense ALLC 495 82512 0.00599913 41256 8 0.0114829
2-3749122-A-G p.Lys291Glu missense ALLC 1 82526 1.21174E-5 41263 0 NA
2-3749128-G-A p.Asp293Asn missense ALLC 1 82530 1.21168E-5 41265 0 4.6617E-6
2-3749130-T-C p.Asp293Asp synonymous ALLC 12 82536 1.45391E-4 41268 0 6.25E-4
2-3749133-G-A p.Gly294Gly synonymous ALLC 71 82540 8.60189E-4 41270 0 0.0017354
2-3749151-GGAA-G p.Glu303del disruptive_inframe_deletion ALLC 36769 82372 0.446377 41186 8526 0.466667
2-3749159-A-C p.Glu303Ala missense ALLC 1 82554 1.21133E-5 41277 0 4.52571E-5
2-3749163-C-T p.Ala304Ala synonymous ALLC 2 82558 2.42254E-5 41279 0 1.09345E-5
2-3749164-G-A p.Val305Met missense ALLC 2 82562 2.42242E-5 41281 0 3.1902E-5
2-3749172-G-C p.Arg307Ser missense ALLC 2 82558 2.42254E-5 41279 0 NA
2-3749185-C-T p.Leu312Phe missense ALLC 2 82564 2.42236E-5 41282 1 NA
2-3749189-C-T p.Pro313Leu missense ALLC 2 82556 2.4226E-5 41278 0 3.18552E-5
2-3749201-G-A p.Trp317* stop_gained ALLC 1 82502 1.21209E-5 41251 0 NA
2-3749205-A-G p.Lys318Lys synonymous ALLC 3 82512 3.63583E-5 41256 0 1.59266E-4
2-3749206-C-G p.Pro319Ala missense ALLC 7 82502 8.48464E-5 41251 0 9.55718E-5
2-3749222-C-T p.Thr324Ile missense ALLC 2 82428 2.42636E-5 41214 0 3.18674E-5
2-3749227-G-A c.975+1G>A splice_donor ALLC 1 82414 1.21339E-5 41207 0 NA
2-3749230-C-T c.975+4C>T splice_region ALLC 55 82384 6.67605E-4 41192 0 0.00101969
2-3749231-G-A c.975+5G>A splice_region ALLC 40 82380 4.85555E-4 41190 0 5.44407E-4
2-3749979-C-T p.Phe334Phe synonymous ALLC 2 81788 2.44535E-5 40894 0 5.04032E-4
2-3749980-G-C p.Asp335His missense ALLC 1 81800 1.22249E-5 40900 0 3.18512E-5
2-3749983-A-G p.Ser336Gly missense ALLC 1 81864 1.22154E-5 40932 0 NA
2-3749995-G-A p.Glu340Lys missense ALLC 3 81848 3.66533E-5 40924 0 6.37267E-5
2-3749997-G-T p.Glu340Asp missense ALLC 7 81830 8.55432E-5 40915 0 1.11859E-4
2-3749997-G-A p.Glu340Glu synonymous ALLC 1 81830 1.22205E-5 40915 0 6.37186E-5
2-3749998-C-T p.Leu341Phe missense ALLC 3 81868 3.66444E-5 40934 0 8.60067E-6
2-3750007-G-A p.Val344Ile missense ALLC 5 81852 6.10859E-5 40926 0 2.39493E-4
2-3750017-AC-A p.His347fs frameshift ALLC 1 81798 1.22252E-5 40899 0 8.60585E-6
2-3750031-A-G p.Ile352Val missense ALLC 2 81872 2.44284E-5 40936 0 9.56633E-5
2-3750033-C-T p.Ile352Ile synonymous ALLC 2 81864 2.44308E-5 40932 0 1.72807E-5
2-3750037-C-G p.Pro354Ala missense ALLC 20 81916 2.44153E-4 40958 1 7.97143E-4
2-3750042-C-T p.Asp355Asp synonymous ALLC 1 81950 1.22026E-5 40975 0 8.64424E-6
2-3750043-G-A p.Gly356Arg missense ALLC 2 81994 2.4392E-5 40997 0 4.06263E-6
2-3750053-G-A p.Ser359Asn missense ALLC 1 81974 1.2199E-5 40987 0 NA
2-3750054-C-T p.Ser359Ser synonymous ALLC 1 81990 1.21966E-5 40995 0 NA
2-3750055-C-T p.Arg360Cys missense ALLC 1 81984 1.21975E-5 40992 0 8.6801E-6
2-3750061-C-T p.Arg362Trp missense ALLC 376 82092 0.00458023 41046 4 0.00963256
2-3750062-G-A p.Arg362Gln missense ALLC 1 82100 1.21803E-5 41050 0 0.00100705
2-3750064-C-A p.Leu363Ile missense ALLC 1 82130 1.21758E-5 41065 0 NA
2-3750067-C-T p.Arg364Trp missense ALLC 4 82102 4.87199E-5 41051 0 3.18837E-5
2-3750068-G-C p.Arg364Pro missense ALLC 2 82100 2.43605E-5 41050 0 NA
2-3750068-G-T p.Arg364Leu missense ALLC 2 82100 2.43605E-5 41050 0 NA
2-3750073-T-C p.Phe366Leu missense ALLC 3 82044 3.65657E-5 41022 0 NA
2-3750091-C-G p.Leu372Val missense ALLC 6 82166 7.30229E-5 41083 0 1.42469E-4
2-3750098-G-A p.Arg374Lys missense ALLC 1 82170 1.21699E-5 41085 0 4.08634E-6
2-3750104-G-A p.Arg376Gln missense ALLC 1 82180 1.21684E-5 41090 0 NA
2-3750106-G-A p.Glu377Lys missense ALLC 1 82170 1.21699E-5 41085 0 NA
2-3750108-G-A p.Glu377Glu synonymous ALLC 2 82168 2.43404E-5 41084 0 NA
2-3750124-T-C p.Phe383Leu missense ALLC 1 82110 1.21788E-5 41055 0 NA
2-3750129-G-A p.Ser384Ser synonymous ALLC 1 82030 1.21907E-5 41015 0 NA
2-3750129-G-C p.Ser384Ser synonymous ALLC 10 82030 1.21907E-4 41015 0 3.11649E-4