Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
11-111656786-T-G p.Asn206His missense ALG9 2 52860 3.78358E-5 26430 0 2.21451E-5
11-111656793-G-A p.Tyr203Tyr synonymous ALG9 2 52592 3.80286E-5 26296 0 2.21743E-5
11-111656797-G-C p.Thr202Ser missense ALG9 2 52432 3.81446E-5 26216 0 NA
11-111656798-T-C p.Thr202Ala missense ALG9 28 52310 5.3527E-4 26155 0 0.00108232
11-111656807-C-T p.Ala199Thr missense ALG9 47 51952 9.04681E-4 25976 0 8.48033E-4
11-111656809-C-A p.Arg198Ile missense ALG9 1 51980 1.92382E-5 25990 0 NA
11-111656815-C-T p.Arg196Gln missense ALG9 1 51258 1.95092E-5 25629 0 5.18442E-5
11-111656816-G-A p.Arg196Trp missense+splice_region ALG9 1 51018 1.96009E-5 25509 0 8.43455E-5
11-111656822-G-C c.584-4C>G splice_region ALG9 1 50844 1.9668E-5 25422 0 NA
11-111656981-C-T n.2028G>A splice_region ALG9 1 80566 1.24122E-5 40283 0 NA
11-111657125-C-A c.583+1G>T splice_donor ALG9 1 83354 1.1997E-5 41677 0 NA
11-111657125-C-T c.583+1G>A splice_donor ALG9 2 83354 2.3994E-5 41677 0 8.2802E-6
11-111657158-C-T p.Arg429Gln missense ALG9 2 83342 2.39975E-5 41671 0 3.60701E-5
11-111657159-G-A p.Arg429Trp missense ALG9 3 83344 3.59954E-5 41672 0 6.37105E-5
11-111657166-G-A p.Leu426Leu synonymous ALG9 1 83340 1.1999E-5 41670 0 NA
11-111657171-T-C p.Ile425Val missense ALG9 1 83332 1.20002E-5 41666 0 1.82164E-4
11-111657184-G-A p.Tyr420Tyr synonymous ALG9 86 83326 0.00103209 41663 0 0.00207152
11-111657186-A-G p.Tyr420His missense ALG9 48 83322 5.76078E-4 41661 2 0.00140154
11-111657210-A-G p.Phe412Leu missense ALG9 5 83262 6.00514E-5 41631 0 3.31219E-5
11-111657216-C-A p.Val410Phe missense ALG9 38 83248 4.56467E-4 41624 0 5.41884E-4
11-111657217-A-G p.Tyr409Tyr synonymous ALG9 1 83244 1.20129E-5 41622 0 NA
11-111657225-C-T p.Ala407Thr missense ALG9 6 83216 7.21015E-5 41608 0 7.45403E-5
11-111657226-C-T p.Arg406Arg synonymous ALG9 1 83212 1.20175E-5 41606 0 8.28226E-6
11-111657228-G-A p.Arg406Trp missense ALG9 55 83212 6.60962E-4 41606 0 4.91025E-4
11-111657231-G-A p.Leu405Leu synonymous ALG9 1 83202 1.20189E-5 41601 0 8.28404E-6
11-111657232-C-T p.Leu404Leu synonymous ALG9 1 83206 1.20184E-5 41603 0 NA
11-111659167-C-G n.1779G>C splice_region ALG9 1 7228 1.38351E-4 3614 0 3.18634E-5
11-111659295-T-C n.1653-2A>G splice_acceptor ALG9 1 9272 1.07852E-4 4636 0 1.29467E-5
11-111668914-G-A p.Ser18Leu missense ALG9 2 6410 3.12012E-4 3205 0 0.00219298
11-111668917-AC-A p.Val17fs frameshift ALG9 1 6524 1.5328E-4 3262 0 2.07297E-5
11-111676007-G-T p.Pro33Gln missense ALG9 1 9562 1.04581E-4 4781 0 7.7895E-6
11-111676037-A-G p.Phe23Ser missense+splice_region ALG9 1 9560 1.04603E-4 4780 0 1.86081E-4
11-111676045-AGAAGTAAACGTTTGTTGTTTAAG-A c.66-29_66-7delCTTAAACAACAAACGTTTACTTC splice_region ALG9 1 9560 1.04603E-4 4780 0 1.91034E-4
11-111680359-C-T c.1199+8G>A splice_region ALG9 1 83286 1.20068E-5 41643 0 NA
11-111680363-A-C c.1199+4T>G splice_region ALG9 1 83304 1.20042E-5 41652 0 NA
11-111680385-G-C p.Pro394Arg missense ALG9 1 83324 1.20013E-5 41662 0 NA
11-111680391-T-C p.Tyr392Cys missense ALG9 1 83316 1.20025E-5 41658 0 4.00831E-6
11-111680395-C-A p.Ala391Ser missense ALG9 1 83310 1.20034E-5 41655 0 8.28404E-6
11-111680399-G-C p.Ser389Arg missense ALG9 2 83312 2.40061E-5 41656 0 NA
11-111680413-C-T p.Glu385Lys missense ALG9 1 83304 1.20042E-5 41652 0 4.00859E-6
11-111680418-T-C p.Asn383Ser missense ALG9 2 83288 2.40131E-5 41644 0 0.00100705
11-111680429-T-G p.Lys379Asn missense ALG9 4 83270 4.80365E-5 41635 0 2.80626E-5
11-111680433-G-A p.Pro378Leu missense ALG9 1 83254 1.20114E-5 41627 0 NA
11-111680433-G-T p.Pro378Gln missense ALG9 1 83254 1.20114E-5 41627 0 NA
11-111680438-C-T p.Arg376Arg synonymous ALG9 1 83230 1.20149E-5 41615 0 3.18512E-5
11-111680439-C-T p.Arg376Gln missense ALG9 1 83234 1.20143E-5 41617 0 3.18512E-5
11-111680440-G-A p.Arg376Trp missense ALG9 5 83234 6.00716E-5 41617 0 3.31417E-5
11-111680441-G-A p.Pro375Pro synonymous ALG9 37 83224 4.44583E-4 41612 1 0.0012179
11-111680443-G-A p.Pro375Ser missense ALG9 1 83216 1.20169E-5 41608 0 1.65703E-5
11-111680443-G-C p.Pro375Ala missense ALG9 2 83216 2.40338E-5 41608 0 NA
11-111680445-G-A p.Thr374Ile missense ALG9 1 83214 1.20172E-5 41607 0 NA
11-111680459-G-A p.Asp369Asp synonymous ALG9 1 83214 1.20172E-5 41607 0 8.28487E-6
11-111680490-A-G p.Ile359Thr missense ALG9 1 83154 1.20259E-5 41577 0 1.2028E-5
11-111680495-A-AATAT p.Asp358fs frameshift ALG9 4 83130 4.81174E-5 41565 2 NA
11-111680496-A-C p.Ile357Ser missense+splice_region ALG9 63 83124 7.57904E-4 41562 0 0.003125
11-111680504-T-C c.1069-7A>G splice_region ALG9 1 83076 1.20372E-5 41538 0 NA
11-111706882-C-T c.1068+6G>A splice_region ALG9 1 83086 1.20357E-5 41543 0 8.28144E-6
11-111706893-T-G p.Arg355Arg synonymous ALG9 2 83152 2.40523E-5 41576 0 NA
11-111706902-C-T p.Glu352Lys missense ALG9 1 83188 1.2021E-5 41594 0 4.01017E-6
11-111706906-T-C p.Leu350Leu synonymous ALG9 1 83194 1.20201E-5 41597 0 8.01983E-6
11-111706914-G-C p.Gln348Glu missense ALG9 2 83212 2.4035E-5 41606 0 NA
11-111706923-T-C p.Met345Val missense ALG9 8 83226 9.61238E-5 41613 0 0.00304878
11-111706938-TC-T p.Ile340fs frameshift ALG9 1 83228 1.20152E-5 41614 0 NA
11-111706939-C-T p.Arg339Arg synonymous ALG9 3 83232 3.60438E-5 41616 0 4.00847E-6
11-111706940-C-T p.Arg339Gln missense ALG9 1 83228 1.20152E-5 41614 0 2.48455E-5
11-111706941-G-A p.Arg339Trp missense ALG9 2 83240 2.40269E-5 41620 0 NA
11-111706952-G-A p.Pro335Leu missense ALG9 233 83216 0.00279994 41608 1 0.006875
11-111706957-T-C p.Glu333Glu synonymous ALG9 1 83238 1.20137E-5 41619 0 1.65689E-5
11-111706967-G-C p.Pro330Arg missense ALG9 2 83250 2.4024E-5 41625 0 NA
11-111706988-A-T p.Phe323Tyr missense ALG9 5 83240 6.00673E-5 41620 0 1.65876E-5
11-111706990-C-T p.Glu322Glu synonymous ALG9 2 83238 2.40275E-5 41619 0 4.00843E-6
11-111706996-T-C p.Pro320Pro synonymous ALG9 3 83234 3.6043E-5 41617 0 6.63713E-5
11-111707001-T-C p.Ile319Val missense ALG9 40 83228 4.80608E-4 41614 0 6.25E-4
11-111707017-A-G p.Asn313Asn splice_region+synonymous ALG9 2 83208 2.40361E-5 41604 0 1.20293E-5
11-111707018-C-T c.939-1G>A splice_acceptor ALG9 5 83206 6.00918E-5 41603 2 NA
11-111707023-A-AGGAAGAAGGAAGCTGCTGG c.939-7_939-6insCCAGCAGCTTCCTTCTTCC splice_region ALG9 5 83206 6.00918E-5 41603 2 NA
11-111708183-C-T c.938+8G>A splice_region ALG9 1 83252 1.20117E-5 41626 0 NA
11-111708193-G-A p.Asp312Asp splice_region+synonymous ALG9 2 83302 2.4009E-5 41651 0 8.29408E-6
11-111708212-C-T p.Ser306Asn missense ALG9 1 83326 1.20011E-5 41663 0 NA
11-111708214-G-A p.Pro305Pro synonymous ALG9 1 83328 1.20008E-5 41664 0 NA
11-111708231-C-G p.Glu300Gln missense ALG9 1 83344 1.19985E-5 41672 0 NA
11-111708255-G-T p.Pro292Thr missense ALG9 1 83368 1.1995E-5 41684 0 2.40454E-5
11-111708264-C-T p.Glu289Lys missense ALG9 2 83368 2.399E-5 41684 0 3.31395E-5
11-111708271-A-T p.Thr286Thr synonymous ALG9 1 83372 1.19944E-5 41686 0 3.60684E-5
11-111708279-T-C p.Ile284Val missense ALG9 1 83362 1.19959E-5 41681 0 3.31499E-5
11-111708280-G-A p.Thr283Thr synonymous ALG9 483 83362 0.00579401 41681 0 0.00563558
11-111708281-G-C p.Thr283Ser missense ALG9 1 83366 1.19953E-5 41683 0 NA
11-111708282-T-C p.Thr283Ala missense ALG9 1 83362 1.19959E-5 41681 0 8.81658E-5
11-111708298-T-G p.Arg277Arg synonymous ALG9 2 83344 2.39969E-5 41672 0 3.18532E-5
11-111708307-T-C p.Glu274Glu synonymous ALG9 7 83336 8.39973E-5 41668 0 1.49345E-4
11-111708312-G-T p.Pro273Thr missense ALG9 1 83318 1.20022E-5 41659 0 4.00821E-6
11-111708312-G-A p.Pro273Ser missense ALG9 2 83318 2.40044E-5 41659 0 2.49128E-5
11-111708313-A-G p.Tyr272Tyr synonymous ALG9 1 83322 1.20016E-5 41661 0 3.18512E-5
11-111708316-C-G p.Leu271Phe missense ALG9 1 83316 1.20025E-5 41658 0 NA
11-111708326-G-T p.Pro268His missense ALG9 1 83286 1.20068E-5 41643 0 4.00959E-6
11-111708331-G-A p.His266His synonymous ALG9 23 83274 2.76197E-4 41637 0 0.00110202
11-111708341-G-A c.791-3C>T splice_region ALG9 3 83216 3.60508E-5 41608 0 4.01274E-6
11-111708976-G-A p.Phe262Phe synonymous ALG9 2 83144 2.40547E-5 41572 0 4.00914E-6
11-111708981-G-A p.Leu261Leu synonymous ALG9 1 83162 1.20247E-5 41581 0 NA
11-111708982-T-C p.Ala260Ala synonymous ALG9 38 83168 4.56907E-4 41584 0 6.41432E-5
11-111708992-C-T p.Arg257His missense ALG9 1 83190 1.20207E-5 41595 0 4.00888E-6
11-111709015-C-G p.Leu249Leu synonymous ALG9 1 83238 1.20137E-5 41619 0 NA
11-111709029-C-T p.Gly245Arg missense ALG9 1 83250 1.2012E-5 41625 0 NA
11-111709035-C-T p.Ala243Thr missense ALG9 1 83246 1.20126E-5 41623 0 3.18451E-5
11-111709045-C-T p.Ser239Ser synonymous ALG9 4 83242 4.80527E-5 41621 0 0.003125
11-111709046-G-A p.Ser239Leu missense ALG9 1 83248 1.20123E-5 41624 0 4.00869E-6
11-111709076-C-T p.Arg229Gln missense ALG9 1 83200 1.20192E-5 41600 0 NA
11-111709088-A-C p.Phe225Cys missense ALG9 1 83138 1.20282E-5 41569 0 NA
11-111709091-T-C p.His224Arg missense ALG9 2 83110 2.40645E-5 41555 0 NA
11-111709103-TG-T p.Gln227fs frameshift ALG9 2 83044 2.40836E-5 41522 0 NA
11-111709111-C-A p.Leu224Leu synonymous ALG9 2 82970 2.41051E-5 41485 0 NA
11-111709118-C-T p.Ser222Asn missense ALG9 2 82854 2.41388E-5 41427 0 8.86824E-6
11-111711378-C-G p.Gln220His missense+splice_region ALG9 1 83142 1.20276E-5 41571 0 4.00946E-6
11-111711393-A-C p.Ala215Ala synonymous ALG9 1 83154 1.20259E-5 41577 0 1.20276E-5
11-111711398-C-T p.Val214Met missense ALG9 1 83162 1.20247E-5 41581 0 NA
11-111711401-C-T p.Ala213Thr missense ALG9 1 83170 1.20236E-5 41585 0 1.65678E-5
11-111711402-G-A p.Gly212Gly synonymous ALG9 2 83160 2.405E-5 41580 0 1.60397E-5
11-111711410-G-C p.Leu210Val missense ALG9 1 83168 1.20239E-5 41584 0 NA
11-111711417-A-T p.Leu207Leu synonymous ALG9 5 83180 6.01106E-5 41590 0 NA
11-111711419-G-C p.Leu207Val missense ALG9 2 83184 2.40431E-5 41592 0 NA
11-111711456-A-T p.Pro194Pro synonymous ALG9 1 83222 1.20161E-5 41611 0 8.28446E-6
11-111711460-T-C p.Gln193Arg missense ALG9 1 83230 1.20149E-5 41615 0 NA
11-111711465-G-A p.Phe191Phe synonymous ALG9 2 83244 2.40258E-5 41622 0 3.18735E-5
11-111711468-G-A p.Phe190Phe synonymous ALG9 2 83238 2.40275E-5 41619 0 NA
11-111711476-T-C p.Ile188Val missense ALG9 1 83246 1.20126E-5 41623 0 NA
11-111711489-C-T p.Met183Ile missense ALG9 2 83242 2.40263E-5 41621 0 4.00859E-6
11-111711513-C-T p.Pro175Pro synonymous ALG9 2 83252 2.40234E-5 41626 0 5.04032E-4
11-111711533-C-CATGAAATCTCTGCAGCAGGTATTCCA c.506-2_506-1insTGGAATACCTGCTGCAGAGATTTCAT splice_acceptor ALG9 2 83206 2.40367E-5 41603 1 NA
11-111711535-G-A c.506-3C>T splice_region ALG9 1 83178 1.20224E-5 41589 0 NA
11-111715327-G-A p.His168Tyr missense ALG9 2 83270 2.40183E-5 41635 0 2.40494E-5
11-111715347-T-C p.Glu161Gly missense ALG9 1 83294 1.20057E-5 41647 0 NA
11-111715361-C-G p.Leu156Leu synonymous ALG9 1 83294 1.20057E-5 41647 0 NA
11-111715375-G-A p.Leu152Leu synonymous ALG9 2 83286 2.40136E-5 41643 0 2.48435E-5
11-111715376-G-A p.Leu151Leu synonymous ALG9 1 83282 1.20074E-5 41641 0 8.2813E-6
11-111715389-A-G p.Phe147Ser missense ALG9 1 83286 1.20068E-5 41643 0 NA
11-111715396-C-T p.Val145Ile missense ALG9 1 83268 1.20094E-5 41634 0 NA
11-111715397-A-G p.Asn144Asn synonymous ALG9 73 83266 8.76708E-4 41633 0 5.96263E-4
11-111715398-T-C p.Asn144Ser missense ALG9 2 83266 2.40194E-5 41633 0 9.10973E-5
11-111715403-A-G p.Asn142Asn synonymous ALG9 1 83268 1.20094E-5 41634 0 NA
11-111715423-A-T p.Leu136Ile missense ALG9 6 83242 7.2079E-5 41621 0 NA
11-111715425-T-C p.Tyr135Cys missense ALG9 2 83230 2.40298E-5 41615 0 2.4846E-5
11-111715439-T-C p.Glu130Glu synonymous ALG9 3 83186 3.60638E-5 41593 0 NA
11-111715442-T-C p.Thr129Thr synonymous ALG9 1 83172 1.20233E-5 41586 0 4.00885E-6
11-111715449-G-A c.383-3C>T splice_region ALG9 1 83124 1.20302E-5 41562 0 1.60359E-4
11-111715453-G-A c.383-7C>T splice_region ALG9 2 83122 2.4061E-5 41561 0 NA
11-111724109-G-C p.Leu126Val missense ALG9 2 82346 2.42878E-5 41173 0 3.18552E-5
11-111724118-C-T p.Gly123Arg missense ALG9 1 82488 1.2123E-5 41244 0 NA
11-111724126-G-C p.Thr120Ser missense ALG9 1 82568 1.21112E-5 41284 0 4.01703E-6
11-111724133-C-T p.Val118Ile missense ALG9 25462 81798 0.311279 40899 4261 0.3825
11-111724138-T-C p.Tyr116Cys missense ALG9 6 82642 7.26023E-5 41321 0 6.02395E-5
11-111724150-T-C p.Asn112Ser missense ALG9 2 82668 2.41932E-5 41334 0 NA
11-111724155-T-G p.Pro110Pro synonymous ALG9 1 82650 1.20992E-5 41325 0 NA
11-111724158-T-C p.Ala109Ala synonymous ALG9 1 82648 1.20995E-5 41324 0 NA
11-111724159-G-A p.Ala109Val missense ALG9 1 82640 1.21007E-5 41320 0 3.18573E-5
11-111724180-T-C p.Tyr102Cys missense ALG9 1 82500 1.21212E-5 41250 0 8.33542E-6
11-111724183-T-C p.Tyr101Cys missense ALG9 68 82486 8.24382E-4 41243 0 0.00206967
11-111724212-A-G c.277-4T>C splice_region ALG9 8 82074 9.7473E-5 41037 0 7.24824E-5
11-111724386-G-A p.Leu88Phe missense ALG9 1 82976 1.20517E-5 41488 0 8.31864E-6
11-111724389-C-T p.Ala87Thr missense ALG9 1 82984 1.20505E-5 41492 0 NA
11-111724396-C-T p.Ser84Ser synonymous ALG9 3 82994 3.61472E-5 41497 0 2.49406E-5
11-111724397-G-A p.Ser84Leu missense ALG9 450 83028 0.00541986 41514 14 0.0113079
11-111724403-T-G p.His82Pro missense ALG9 2 83052 2.40813E-5 41526 0 4.01081E-6
11-111724403-T-C p.His82Arg missense ALG9 2 83052 2.40813E-5 41526 0 3.18552E-5
11-111724414-C-T p.Lys78Lys synonymous ALG9 3 83088 3.61063E-5 41544 0 NA
11-111724418-C-A p.Trp77Leu missense ALG9 1 83096 1.20343E-5 41548 0 NA
11-111724420-C-A p.Arg76Ser missense ALG9 34 83102 4.09136E-4 41551 0 8.2792E-4
11-111724437-GC-AA p.LeuLeu70PheLeu missense ALG9 2 83114 2.40633E-5 41557 0 NA
11-111724448-GC-AA p.Ala67Phe missense ALG9 1 83096 1.20343E-5 41548 0 NA
11-111724448-G-A p.Ala67Val missense ALG9 3 83096 3.61028E-5 41548 1 4.00921E-6
11-111724449-C-A p.Ala67Ser missense ALG9 3 83092 3.61046E-5 41546 1 4.00901E-6
11-111724450-A-T p.Ile66Ile synonymous ALG9 2 83090 2.40703E-5 41545 0 NA
11-111724456-T-C p.Leu64Leu synonymous ALG9 1 83074 1.20375E-5 41537 0 NA
11-111724462-A-G c.189-3T>C splice_region ALG9 1 83012 1.20465E-5 41506 0 3.1841E-5
11-111724464-T-G c.189-5A>C splice_region ALG9 3 83018 3.61367E-5 41509 0 NA
11-111724464-T-C c.189-5A>G splice_region ALG9 1 83018 1.20456E-5 41509 0 NA
11-111724467-A-C c.189-8T>G splice_region ALG9 1 83000 1.20482E-5 41500 0 3.1837E-5
11-111728327-A-C p.Leu62Leu splice_region+synonymous ALG9 4 83308 4.80146E-5 41654 0 2.00367E-5
11-111728332-C-G p.Ala61Pro missense ALG9 34 83316 4.08085E-4 41658 1 0.00151362
11-111728332-C-T p.Ala61Thr missense ALG9 1 83318 1.20022E-5 41659 0 NA
11-111728335-C-T p.Ala60Thr missense ALG9 1 83322 1.20016E-5 41661 0 1.65686E-5
11-111728356-T-C p.Ile53Val missense ALG9 1 83352 1.19973E-5 41676 0 NA
11-111728375-C-T p.Leu46Leu synonymous ALG9 10 83348 1.19979E-4 41674 0 1.27413E-4
11-111728404-A-G p.Tyr37His missense ALG9 2 83326 2.40021E-5 41663 0 NA
11-111728408-T-C p.Gly35Gly synonymous ALG9 1 83324 1.20013E-5 41662 0 NA
11-111728418-G-T p.Ala32Asp missense ALG9 1 83322 1.20016E-5 41661 0 4.00769E-6
11-111728426-C-T p.Thr29Thr synonymous ALG9 1 83310 1.20034E-5 41655 0 3.18674E-5
11-111728427-G-A p.Thr29Met missense ALG9 1 83304 1.20042E-5 41652 0 1.20234E-5
11-111728430-G-C p.Thr28Ser missense ALG9 3 83298 3.60153E-5 41649 0 1.65981E-5
11-111728441-G-A p.Phe24Phe synonymous ALG9 1 83286 1.20068E-5 41643 0 NA
11-111728446-T-C p.Ser23Gly missense ALG9 5 83280 6.00384E-5 41640 0 6.25E-4
11-111728458-A-T p.Phe19Ile missense+splice_region ALG9 1 83260 1.20106E-5 41630 0 NA
11-111728463-G-GATGATGAGCAAAACATGCCAGTGCTGAGAAC c.53-4_53-3insGTTCTCAGCACTGGCATGTTTTGCTCATCAT splice_region ALG9 2 83246 2.40252E-5 41623 0 NA
11-111731284-A-C p.Phe13Cys missense ALG9 13 83356 1.55958E-4 41678 0 6.81286E-5
11-111731295-G-C p.Ser9Arg missense ALG9 1 83362 1.19959E-5 41681 0 NA
11-111731298-G-A p.Leu8Leu synonymous ALG9 39 83362 4.67839E-4 41681 1 6.25E-4
11-111731305-A-T p.Leu6* stop_gained ALG9 1 83370 1.19947E-5 41685 0 NA
11-111731331-G-A c.-10C>T 5_prime_UTR_premature_start_codon_gain ALG9 1 83346 1.19982E-5 41673 0 1.27421E-4
11-111731358-C-T c.-37G>A splice_region ALG9 2 83276 2.40165E-5 41638 1 NA
11-111735897-T-C c.-38+7A>G splice_region ALG9 3 82036 3.65693E-5 41018 0 NA
11-111735922-C-T c.-56G>A 5_prime_UTR_premature_start_codon_gain ALG9 1 82216 1.21631E-5 41108 0 2.52864E-5
11-111735944-G-A c.-78C>T 5_prime_UTR_premature_start_codon_gain ALG9 1 82240 1.21595E-5 41120 0 NA
11-111735961-T-C c.-95A>G 5_prime_UTR_premature_start_codon_gain ALG9 1 82136 1.21749E-5 41068 0 NA
11-111735976-T-TTATTAGTTTGTAG c.-108-3_-108-2insCTACAAACTAATA splice_region ALG9 2 81964 2.4401E-5 40982 0 NA
11-111735976-T-TTATTAGTTTGTAGAATTCTTGCATGAAATGCAGCTGGCCAGGC c.-108-3_-108-2insGCCTGGCCAGCTGCATTTCATGCAAGAATTCTACAAACTAATA splice_region ALG9 2 81964 2.4401E-5 40982 1 NA
11-111735981-G-A c.-108-7C>T splice_region ALG9 2345 81688 0.0287068 40844 35 0.0256214
11-111739317-G-T c.-109+8C>A splice_region ALG9 4 82772 4.83255E-5 41386 0 9.95074E-5
11-111739318-C-T c.-109+7G>A splice_region ALG9 7 82770 8.45717E-5 41385 0 4.45831E-4
11-111739319-C-A c.-109+6G>T splice_region ALG9 2 82784 2.41593E-5 41392 0 NA
11-111739396-G-A c.-180C>T 5_prime_UTR_premature_start_codon_gain ALG9 1 82842 1.20712E-5 41421 0 9.55962E-5
11-111739404-T-C c.-188A>G 5_prime_UTR_premature_start_codon_gain ALG9 4 82842 4.82847E-5 41421 0 4.0139E-6
11-111739458-G-A c.-242C>T splice_region ALG9 1 82720 1.2089E-5 41360 0 NA
11-111741015-T-C c.-304A>G 5_prime_UTR_premature_start_codon_gain ALG9 2 82462 2.42536E-5 41231 0 NA
11-111741088-G-A c.-377C>T 5_prime_UTR_premature_start_codon_gain ALG9 1 81344 1.22935E-5 40672 0 2.03911E-5
11-111741090-T-A p.Ile279Phe missense ALG9 2 81068 2.46706E-5 40534 0 2.1914E-5
11-111741093-C-CTCGGTCCGGTGCTCCGCG c.-382-1_-382insCGCGGAGCACCGGACCGA splice_acceptor ALG9 1 80966 1.23509E-5 40483 0 NA
11-111741093-C-T p.Val278Ile missense+splice_region ALG9 1 80966 1.23509E-5 40483 0 5.07099E-4
11-111741094-C-A c.-382-1G>T splice_acceptor ALG9 1 80882 1.23637E-5 40441 0 NA
11-111741097-T-C c.-382-4A>G splice_region ALG9 1 80226 1.24648E-5 40113 0 NA
11-111741097-TTC-T c.-382-6_-382-5delGA splice_region ALG9 1 80220 1.24657E-5 40110 0 NA
11-111741098-T-A c.-382-5A>T splice_region ALG9 1 79792 1.25326E-5 39896 0 NA
11-111741098-TC-T c.-382-6delG splice_region ALG9 1 79790 1.25329E-5 39895 0 3.05923E-5
11-111741099-C-A c.-382-6G>T splice_region ALG9 4 79516 5.03043E-5 39758 0 5.23436E-4
11-111741099-C-T c.-382-6G>A splice_region ALG9 1 79600 1.25628E-5 39800 0 NA
11-111741498-T-A c.-383A>T 5_prime_UTR_premature_start_codon_gain ALG9 1 27632 3.61899E-5 13816 0 NA
11-111741506-C-A c.-391G>T 5_prime_UTR_premature_start_codon_gain ALG9 1 27590 3.6245E-5 13795 0 NA
11-111741591-T-C c.-476A>G 5_prime_UTR_premature_start_codon_gain ALG9 1 27308 3.66193E-5 13654 0 NA
11-111741632-T-C c.-517A>G 5_prime_UTR_premature_start_codon_gain ALG9 34 27222 0.00124899 13611 0 0.00159297
11-111741658-T-G n.343+6A>C splice_region ALG9 14 27262 5.13535E-4 13631 0 0.00114672
11-111741714-G-A c.-599C>T 5_prime_UTR_premature_start_codon_gain ALG9 1 27290 3.66435E-5 13645 0 3.18695E-5
11-111741724-G-A c.-609C>T 5_prime_UTR_premature_start_codon_gain ALG9 10 27308 3.66193E-4 13654 0 9.56023E-5
11-111741772-T-C c.-657A>G 5_prime_UTR_premature_start_codon_gain ALG9 3 27562 1.08846E-4 13781 0 NA
11-111741856-A-C c.-741T>G 5_prime_UTR_premature_start_codon_gain ALG9 3 30406 9.86647E-5 15203 0 NA
11-111741920-G-A c.-805C>T 5_prime_UTR_premature_start_codon_gain ALG9 1 42644 2.345E-5 21322 0 NA
11-111741930-T-C c.-815A>G 5_prime_UTR_premature_start_codon_gain ALG9 1 46022 2.17287E-5 23011 0 3.19183E-5
11-111742069-A-T n.193+6T>A splice_region ALG9 3 74030 4.05241E-5 37015 0 6.53328E-5
11-111742070-C-A n.193+5G>T splice_region ALG9 5 74074 6.75001E-5 37037 0 3.25166E-5
11-111742070-C-T n.193+5G>A splice_region ALG9 4 74074 5.40001E-5 37037 0 8.94207E-5
11-111742071-G-C n.193+4C>G splice_region ALG9 1 74124 1.34909E-5 37062 0 NA
11-111742077-G-A p.Arg277* stop_gained ALG9 2 74624 2.6801E-5 37312 0 7.9134E-5
11-111742077-G-T p.Arg277Arg splice_region+synonymous ALG9 1 74624 1.34005E-5 37312 0 NA
11-111742081-C-G p.Pro275Pro synonymous ALG9 22 74806 2.94094E-4 37403 0 3.52361E-4
11-111742083-G-A p.Pro275Ser missense ALG9 3 74960 4.00213E-5 37480 0 1.5155E-5
11-111742089-C-CGCGCCGCCCGCCT p.Gly273fs frameshift ALG9 1 75290 1.3282E-5 37645 0 NA
11-111742092-G-A p.Arg272Cys missense ALG9 1 75372 1.32675E-5 37686 0 NA
11-111742092-G-T p.Arg272Ser missense ALG9 1 75372 1.32675E-5 37686 0 NA
11-111742098-C-A p.Gly270Trp missense ALG9 2 75958 2.63303E-5 37979 0 NA
11-111742099-G-A p.Gly269Gly synonymous ALG9 1 75976 1.31621E-5 37988 0 NA
11-111742101-C-T p.Gly269Ser missense ALG9 2 76172 2.62564E-5 38086 0 NA
11-111742105-C-T p.Pro267Pro synonymous ALG9 1 76314 1.31038E-5 38157 0 NA
11-111742113-C-T p.Gly265Arg missense ALG9 1 76510 1.30702E-5 38255 0 NA
11-111742136-C-T p.Cys257Tyr missense ALG9 2 77264 2.58853E-5 38632 0 NA
11-111742144-G-A p.Arg254Arg synonymous ALG9 4 77766 5.14364E-5 38883 0 0.144737
11-111742145-CG-C p.Arg254fs frameshift ALG9 77750 77758 0.999897 38879 38874 1.0
11-111742145-C-CAATTTTTATGAGATAGGGTCTTGCTATGTTGCCCAGGCTGGACTTAAACTCCTAG p.Arg254fs frameshift ALG9 1 77794 1.28545E-5 38897 0 NA
11-111742152-C-G p.Asp252His missense ALG9 1 78482 1.27418E-5 39241 0 1.46304E-5
11-111742180-G-A p.Arg242Arg synonymous ALG9 1 79240 1.26199E-5 39620 0 2.90736E-5
11-111742186-C-G p.Arg240Arg synonymous ALG9 4 79320 5.04286E-5 39660 0 1.27575E-4
11-111742186-C-T p.Arg240Arg synonymous ALG9 1 79320 1.26072E-5 39660 0 7.25921E-6
11-111742213-C-T p.Arg231Arg splice_region+synonymous ALG9 1 79634 1.25575E-5 39817 0 NA
11-111742216-G-C c.693-3C>G splice_region ALG9 1 79642 1.25562E-5 39821 0 7.24061E-6
11-111742219-G-T c.693-6C>A splice_region ALG9 1 79564 1.25685E-5 39782 0 3.19346E-5
11-111742219-G-GA c.693-7dupT splice_region ALG9 2 79564 2.5137E-5 39782 0 NA
11-111746828-CCT-C n.197-2_197-1delAG splice_acceptor ALG9 9 82554 1.0902E-4 41277 0 6.83089E-4
11-111746833-T-TCAACTTTCCTACAAG n.197-6_197-5insCTTGTAGGAAAGTTG splice_region ALG9 1 82512 1.21194E-5 41256 0 NA
11-111746833-T-TCAAC n.197-6_197-5insGTTG splice_region ALG9 1 82512 1.21194E-5 41256 0 NA
11-111747211-A-G p.Leu229Ser missense ALG9 2 82760 2.41663E-5 41380 0 1.61128E-5
11-111747220-A-G p.Val226Ala missense ALG9 1 82774 1.20811E-5 41387 0 2.00921E-5
11-111747221-C-A p.Val226Leu missense ALG9 1 82772 1.20814E-5 41386 0 NA
11-111747226-G-A p.Ala224Val missense ALG9 1 82768 1.2082E-5 41384 0 1.60712E-5
11-111747239-G-C p.Pro220Ala missense ALG9 1 82768 1.2082E-5 41384 0 2.81226E-5
11-111747259-CCCAGTTTGAT-C p.Ile210fs frameshift ALG9 2 82766 2.41645E-5 41383 0 NA
11-111747262-A-G p.Leu212Pro missense ALG9 2 82766 2.41645E-5 41383 0 1.65634E-5
11-111747295-T-G p.Glu201Ala missense ALG9 4 82742 4.8343E-5 41371 0 6.36862E-5
11-111747295-TCA-GCG p.PheGlu200PheAla missense ALG9 1 82742 1.20858E-5 41371 0 NA
11-111747297-A-G p.Phe200Phe synonymous ALG9 24663 82454 0.299112 41227 3790 0.320242
11-111747302-G-A p.Pro199Ser missense ALG9 4 82712 4.83606E-5 41356 0 5.03525E-4
11-111747313-G-A p.Thr195Ile missense ALG9 1 82700 1.20919E-5 41350 0 8.29586E-6
11-111747320-T-C p.Ile193Val missense ALG9 2 82668 2.41932E-5 41334 0 1.9101E-4
11-111747339-T-C p.Val186Val synonymous ALG9 1 82626 1.21027E-5 41313 0 8.312E-6
11-111747347-A-G p.Phe184Leu missense ALG9 2 82586 2.42172E-5 41293 0 5.03525E-4
11-111747354-A-G p.Asp181Asp synonymous ALG9 114 82560 0.00138081 41280 0 0.00296122
11-111747366-G-A c.534-3C>T splice_region ALG9 1 82500 1.21212E-5 41250 0 8.35701E-6
11-111747526-A-G c.533+6T>C splice_region ALG9 1 82768 1.2082E-5 41384 0 1.11531E-4
11-111747540-A-G p.Thr175Thr synonymous ALG9 4 82816 4.82998E-5 41408 0 NA
11-111747547-T-G p.Lys173Thr missense ALG9 1 82826 1.20735E-5 41413 0 NA
11-111747548-T-C p.Lys173Glu missense ALG9 4 82826 4.8294E-5 41413 0 NA
11-111747553-C-T p.Gly171Glu missense ALG9 2 82840 2.41429E-5 41420 0 6.37064E-5
11-111747568-C-G p.Cys166Ser missense ALG9 1 82836 1.2072E-5 41418 0 NA
11-111747582-C-T p.Val161Val synonymous ALG9 2 82828 2.41464E-5 41414 0 3.21339E-5
11-111747585-G-A p.Asp160Asp synonymous ALG9 3 82830 3.62188E-5 41415 0 8.65321E-6
11-111747587-C-T p.Asp160Asn missense ALG9 842 82818 0.0101669 41409 9 0.0166163
11-111747588-G-A p.Ser159Ser synonymous ALG9 855 82816 0.0103241 41408 4 0.0121837
11-111747598-A-T p.Leu156His missense ALG9 3 82828 3.62196E-5 41414 0 1.78696E-5
11-111747599-G-GC p.Leu156fs frameshift ALG9 6 82802 7.2462E-5 41401 0 0.00251762
11-111747600-C-T p.Gly155Gly synonymous ALG9 45 82826 5.43308E-4 41413 0 0.00151057
11-111747604-C-A p.Gly154Val missense ALG9 1 82822 1.20741E-5 41411 0 NA
11-111747606-C-CA p.Leu156fs frameshift ALG9 4 82820 4.82975E-5 41410 0 9.5511E-5
11-111747616-A-G p.Met150Thr missense ALG9 1 82820 1.20744E-5 41410 0 1.2096E-5
11-111747645-T-C p.Glu140Glu synonymous ALG9 13 82818 1.56971E-4 41409 0 0.00100705
11-111747659-T-G p.Lys136Gln missense ALG9 1 82800 1.20773E-5 41400 0 NA
11-111747663-C-T p.Ala134Ala synonymous ALG9 5 82802 6.0385E-5 41401 0 2.45809E-5
11-111747664-G-A p.Ala134Val missense ALG9 3 82796 3.62336E-5 41398 0 3.1837E-5
11-111747676-C-T p.Gly130Asp missense ALG9 75 82786 9.0595E-4 41393 0 0.00151057
11-111747685-C-G p.Arg127Thr missense ALG9 21 82776 2.53697E-4 41388 0 2.5468E-4
11-111747689-A-G p.Cys126Arg missense ALG9 1 82770 1.20817E-5 41385 0 NA
11-111747699-G-A p.His122His synonymous ALG9 3 82754 3.6252E-5 41377 0 8.16273E-5
11-111747700-T-C p.His122Arg missense ALG9 1 82760 1.20831E-5 41380 0 3.18431E-5
11-111747706-TCTC-T p.Gly119del disruptive_inframe_deletion ALG9 1 82740 1.20861E-5 41370 0 1.75131E-5
11-111747725-C-T p.Val114Ile missense ALG9 1001 82634 0.0121137 41317 7 0.0165134
11-111747726-G-A p.Asp113Asp synonymous ALG9 3 82638 3.63029E-5 41319 0 0.00151362
11-111747737-T-TTTGGAAAAATTTGGCAAGC c.330-3_330-2insGCTTGCCAAATTTTTCCAA splice_region ALG9 1 82544 1.21148E-5 41272 0 NA
11-111749273-T-C c.329+7A>G splice_region ALG9 1 82488 1.2123E-5 41244 0 4.96939E-6
11-111749287-A-G p.Phe108Leu missense ALG9 1 82520 1.21183E-5 41260 0 NA
11-111749309-G-A p.Asn100Asn synonymous ALG9 2 82562 2.42242E-5 41281 0 NA
11-111749314-T-A p.Lys99* stop_gained ALG9 1 82564 1.21118E-5 41282 0 3.41262E-5
11-111749324-A-G p.Ala95Ala synonymous ALG9 1 82562 1.21121E-5 41281 0 NA
11-111749333-T-TCCACA p.Arg93fs frameshift ALG9 1 82566 1.21115E-5 41283 0 NA
11-111749344-G-A p.Pro89Ser missense ALG9 1 82572 1.21106E-5 41286 0 4.29487E-6
11-111749345-G-A p.Phe88Phe synonymous ALG9 1 82566 1.21115E-5 41283 0 4.28982E-6
11-111749349-A-T p.Ile87Asn missense ALG9 70640 82382 0.857469 41191 30390 0.934375
11-111749349-A-C p.Ile87Ser missense ALG9 3 82556 3.6339E-5 41278 0 NA
11-111749353-A-C p.Phe86Val missense ALG9 1 82558 1.21127E-5 41279 0 0.00125
11-111749373-C-G p.Arg79Thr missense ALG9 1 82556 1.2113E-5 41278 0 NA
11-111749378-G-A p.His77His synonymous ALG9 2 82538 2.42313E-5 41269 0 NA
11-111749381-C-T p.Leu76Leu synonymous ALG9 1 82548 1.21142E-5 41274 0 NA
11-111749382-A-G p.Leu76Pro missense ALG9 63 82544 7.63229E-4 41272 0 0.00149662
11-111749396-T-G p.Ala71Ala synonymous ALG9 1 82530 1.21168E-5 41265 0 4.07451E-6
11-111749405-G-T p.Thr68Thr synonymous ALG9 1 82508 1.212E-5 41254 0 1.22112E-5
11-111749406-G-A p.Thr68Ile missense ALG9 4 82504 4.84825E-5 41252 0 4.06802E-6
11-111749424-C-T p.Arg62His missense ALG9 2 82462 2.42536E-5 41231 0 3.18593E-5
11-111749425-G-A p.Arg62Cys missense ALG9 7 82464 8.48855E-5 41232 0 4.9372E-5
11-111749428-C-T p.Val61Ile missense ALG9 34 82432 4.12461E-4 41216 0 1.8515E-4
11-111749680-G-A c.172+5C>T splice_region ALG9 1 79902 1.25153E-5 39951 0 NA
11-111749685-C-G p.Gly58Arg missense+splice_region ALG9 1 80534 1.24171E-5 40267 0 9.78924E-6
11-111749696-A-C p.Leu54Arg missense ALG9 1 81068 1.23353E-5 40534 0 NA
11-111749702-T-A p.Gln52Leu missense ALG9 3 81492 3.68134E-5 40746 0 1.0647E-4
11-111749708-T-C p.Asn50Ser missense ALG9 1 81666 1.2245E-5 40833 0 3.19836E-5
11-111749716-G-A p.Ala47Ala synonymous ALG9 1 81780 1.22279E-5 40890 0 NA
11-111749719-C-G p.Leu46Leu synonymous ALG9 2 81846 2.44361E-5 40923 0 8.30751E-6
11-111749721-G-C p.Leu46Val missense ALG9 1 81864 1.22154E-5 40932 0 2.61582E-5
11-111749725-A-G p.Asp44Asp synonymous ALG9 1 81904 1.22094E-5 40952 0 3.18512E-5
11-111749730-G-C p.Arg43Gly missense ALG9 11 81942 1.34241E-4 40971 0 7.29082E-4
11-111749731-A-C p.Ala42Ala synonymous ALG9 1 81960 1.22011E-5 40980 0 1.13538E-5
11-111749737-C-T p.Glu40Glu synonymous ALG9 38 82032 4.63234E-4 41016 0 0.00250313
11-111749743-C-CG p.Ala39fs frameshift ALG9 2 82074 2.43683E-5 41037 0 NA
11-111749744-G-A p.Pro38Leu missense ALG9 2 82078 2.43671E-5 41039 0 9.94906E-6
11-111749747-C-T p.Arg37His missense ALG9 2 82082 2.43659E-5 41041 0 9.76486E-6
11-111749750-T-C p.Gln36Arg missense ALG9 1 82148 1.21732E-5 41074 0 1.21881E-5
11-111749756-C-T p.Cys34Tyr missense ALG9 1 82176 1.2169E-5 41088 0 NA
11-111749769-G-A p.Leu30Phe missense ALG9 1 82248 1.21584E-5 41124 0 1.75408E-5
11-111749774-G-A p.Thr28Ile missense ALG9 1 82282 1.21533E-5 41141 0 5.04032E-4
11-111749775-T-C p.Thr28Ala missense ALG9 444 82264 0.00539726 41132 13 0.0112847
11-111749784-C-G p.Asp25His missense ALG9 2 82330 2.42925E-5 41165 0 NA
11-111749787-G-C p.Leu24Val missense ALG9 1 82348 1.21436E-5 41174 0 3.18674E-5
11-111749797-C-G p.Leu20Leu synonymous ALG9 1 82354 1.21427E-5 41177 0 3.18613E-5
11-111749806-G-A p.Ala17Ala synonymous ALG9 1 82336 1.21454E-5 41168 0 NA
11-111749812-G-A p.Ser15Ser synonymous ALG9 1 82306 1.21498E-5 41153 0 1.28969E-4
11-111749828-C-T p.Gly10Glu missense ALG9 2 82308 2.4299E-5 41154 0 8.06647E-6
11-111749830-A-T p.Val9Val synonymous ALG9 4 82300 4.86027E-5 41150 0 4.23062E-5
11-111749850-G-A p.Pro3Ser missense ALG9 2 82126 2.43528E-5 41063 0 NA
11-111749851-G-A p.Ala2Ala synonymous ALG9 53 82104 6.45523E-4 41052 0 0.00302115
11-111749855-A-G p.Met1? start_lost ALG9 2 82092 2.43629E-5 41046 0 2.55423E-5
11-111749863-C-A c.-7G>T 5_prime_UTR_premature_start_codon_gain ALG9 2 81926 2.44123E-5 40963 0 4.16872E-6
11-111749874-G-A c.-18C>T 5_prime_UTR_premature_start_codon_gain ALG9 2 81586 2.4514E-5 40793 0 NA
11-111749935-G-A c.-79C>T 5_prime_UTR_premature_start_codon_gain ALG9 2 78796 2.5382E-5 39398 0 NA
11-111749945-G-A c.-89C>T 5_prime_UTR_premature_start_codon_gain ALG9 1 78278 1.2775E-5 39139 0 NA
11-111749950-T-C c.-94A>G 5_prime_UTR_premature_start_codon_gain ALG9 3 78028 3.84477E-5 39014 0 NA
11-111749988-G-A c.-132C>T 5_prime_UTR_premature_start_codon_gain ALG9 2 75284 2.65661E-5 37642 0 NA
11-111749988-G-C c.-132C>G 5_prime_UTR_premature_start_codon_gain ALG9 1 75284 1.3283E-5 37642 0 NA
11-111750078-G-A c.-222C>T 5_prime_UTR_premature_start_codon_gain ALG9 1 68160 1.46714E-5 34080 0 NA
11-111750104-A-G c.-248T>C 5_prime_UTR_premature_start_codon_gain ALG9 1 72738 1.3748E-5 36369 0 NA
11-111750145-C-T c.-289G>A 5_prime_UTR_premature_start_codon_gain ALG9 204 77664 0.0026267 38832 4 0.00569991