Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
1-63833359-G-GATACTTCTACATAGACATAATCAAGTTT c.-208+1_-208+2insATACTTCTACATAGACATAATCAAGTTT splice_donor ALG6 1 74 0.0135135 37 0 NA
1-63836438-T-G c.-207-4T>G splice_region ALG6 1 50442 1.98247E-5 25221 0 NA
1-63836476-A-G c.-173A>G 5_prime_UTR_premature_start_codon_gain ALG6 1 58126 1.7204E-5 29063 0 NA
1-63836513-C-G c.-136C>G 5_prime_UTR_premature_start_codon_gain ALG6 11106 60332 0.184081 30166 342 0.227444
1-63836529-C-T c.-120C>T 5_prime_UTR_premature_start_codon_gain ALG6 1 65756 1.52077E-5 32878 0 NA
1-63836602-C-G c.-47C>G 5_prime_UTR_premature_start_codon_gain ALG6 1 76786 1.30232E-5 38393 0 NA
1-63836667-A-G p.Met7Val missense ALG6 1 79530 1.25739E-5 39765 0 3.18634E-5
1-63836668-T-C p.Met7Thr missense ALG6 1 79540 1.25723E-5 39770 0 NA
1-63836670-A-T p.Thr8Ser missense ALG6 1 79518 1.25758E-5 39759 0 8.23696E-6
1-63836682-T-A p.Leu12Ile missense ALG6 2 79506 2.51553E-5 39753 0 NA
1-63836684-A-C p.Leu12Phe missense ALG6 1 79492 1.25799E-5 39746 0 6.37024E-5
1-63836700-C-T p.Arg18* stop_gained ALG6 1 79372 1.25989E-5 39686 0 2.81183E-5
1-63836702-A-G p.Arg18Arg synonymous ALG6 2 79418 2.51832E-5 39709 0 1.52648E-4
1-63836703-T-C p.Trp19Arg missense ALG6 1 79456 1.25856E-5 39728 0 8.23723E-6
1-63836711-G-T p.Val21Val synonymous ALG6 1 79274 1.26145E-5 39637 0 NA
1-63836722-C-G p.Ser25Cys missense ALG6 1 79192 1.26275E-5 39596 0 3.19428E-5
1-63836729-A-AGGTGCT p.Gly28_Asn29insAlaGly conservative_inframe_insertion ALG6 5 79034 6.32639E-5 39517 2 NA
1-63836737-C-A p.Thr30Lys missense ALG6 1 78752 1.26981E-5 39376 0 NA
1-63836750-T-TA p.Thr38fs frameshift ALG6 27 71820 3.7594E-4 35910 0 0.0154254
1-63836750-TA-T p.Thr38fs frameshift ALG6 7 77814 8.99581E-5 38907 0 0.00420778
1-63836760-A-C p.Thr38Pro missense ALG6 10 77410 1.29182E-4 38705 0 2.0961E-4
1-63836761-C-A p.Thr38Lys missense ALG6 1 77094 1.29712E-5 38547 0 4.03675E-6
1-63836762-G-A p.Thr38Thr synonymous ALG6 1 76976 1.29911E-5 38488 0 8.0707E-6
1-63836778-T-A p.Ter44Lysext*? stop_lost ALG6 2 75486 2.6495E-5 37743 0 1.85247E-5
1-63862196-C-T p.Pro32Leu missense ALG6 5 83176 6.01135E-5 41588 0 3.18573E-5
1-63862197-G-A p.Pro32Pro synonymous ALG6 4 83184 4.80862E-5 41592 0 1.31865E-4
1-63862202-T-C p.Met34Thr missense ALG6 3 83210 3.60534E-5 41605 0 3.1839E-5
1-63862237-G-A p.Glu46Lys missense ALG6 2 83236 2.40281E-5 41618 0 NA
1-63862247-T-C p.Phe49Ser missense ALG6 1 83204 1.20187E-5 41602 0 NA
1-63862256-C-T p.Pro52Leu missense ALG6 3 83120 3.60924E-5 41560 0 8.35395E-5
1-63862257-G-A p.Pro52Pro synonymous ALG6 1 83122 1.20305E-5 41561 0 4.12603E-5
1-63862272-T-TTTTAACAGCAGTGATAACAATTTACAGTATTGGGGATTG c.167+4_167+5insTTTAACAGCAGTGATAACAATTTACAGTATTGGGGATTG splice_region ALG6 4 83056 4.81603E-5 41528 2 NA
1-63862272-T-TTTTAACAGCAGTGATAACAATTTACAGTATTGGG c.167+4_167+5insTTTAACAGCAGTGATAACAATTTACAGTATTGGG splice_region ALG6 4 83056 4.81603E-5 41528 2 NA
1-63862275-T-C c.167+7T>C splice_region ALG6 5 82990 6.02482E-5 41495 0 9.55231E-5
1-63862276-A-G c.167+8A>G splice_region ALG6 1 82962 1.20537E-5 41481 0 7.96007E-6
1-63867954-A-G p.Gln66Arg missense ALG6 1 82160 1.21714E-5 41080 0 2.47557E-5
1-63867969-A-T p.Asp71Val missense ALG6 3 82244 3.64768E-5 41122 0 6.39182E-5
1-63867970-T-C p.Asp71Asp synonymous ALG6 1 82256 1.21572E-5 41128 0 3.97864E-6
1-63867980-C-T p.Leu75Phe missense ALG6 1 82330 1.21462E-5 41165 0 NA
1-63867994-T-G p.His79Gln missense ALG6 2 82266 2.43114E-5 41133 0 3.18918E-5
1-63868007-G-A p.Ala84Thr missense ALG6 2 82076 2.43677E-5 41038 0 8.26501E-6
1-63868019-G-A c.257+5G>A splice_region ALG6 40 81716 4.895E-4 40858 0 4.74531E-4
1-63870116-A-G c.258-8A>G splice_region ALG6 2 82402 2.42713E-5 41201 0 NA
1-63870132-T-C p.Phe89Ser missense ALG6 3 82532 3.63495E-5 41266 0 NA
1-63870136-A-G p.Ile90Met missense ALG6 1 82544 1.21148E-5 41272 0 NA
1-63870144-A-G p.Asp93Gly missense ALG6 1 82566 1.21115E-5 41283 0 3.98216E-6
1-63870148-G-T p.Trp94Cys missense ALG6 5 82576 6.05503E-5 41288 0 3.58417E-5
1-63870156-T-C p.Leu97Pro missense ALG6 1 82572 1.21106E-5 41286 0 NA
1-63870159-A-G p.His98Arg missense ALG6 1 82588 1.21083E-5 41294 0 8.24008E-6
1-63870168-G-A p.Arg101His missense ALG6 10 82546 1.21145E-4 41273 0 4.12025E-5
1-63870173-T-C p.Tyr103His missense ALG6 2 82544 2.42295E-5 41272 0 3.98321E-6
1-63870187-A-G p.Ala107Ala synonymous ALG6 2 82484 2.42471E-5 41242 0 3.18492E-5
1-63870204-G-A p.Arg113His missense ALG6 1 82318 1.2148E-5 41159 0 3.29935E-5
1-63870212-G-GTTTTAATTGCTGATCTGCTGATTTACATACCT c.346_346+1insTTTTAATTGCTGATCTGCTGATTTACATACCT splice_donor ALG6 4 82212 4.86547E-5 41106 2 NA
1-63870212-G-GTTTTAATT c.346_346+1insTTTTAATT splice_donor ALG6 2 82212 2.43273E-5 41106 1 NA
1-63870212-G-GTTTTAATTGCTGATCTGCTGATTTACATACCTGCA c.346_346+1insTTTTAATTGCTGATCTGCTGATTTACATACCTGCA splice_donor ALG6 2 82212 2.43273E-5 41106 1 NA
1-63870214-T-TA c.346+2_346+3insA splice_region ALG6 1 82180 1.21684E-5 41090 0 3.98692E-6
1-63870220-A-G c.346+8A>G splice_region ALG6 1 82106 1.21794E-5 41053 0 NA
1-63872011-T-G p.Tyr124Asp missense ALG6 4 82980 4.82044E-5 41490 0 1.11439E-4
1-63872032-T-C p.Tyr131His missense ALG6 3073 82902 0.0370679 41451 82 0.0337362
1-63872040-T-C p.Cys133Cys synonymous ALG6 1 82964 1.20534E-5 41482 0 NA
1-63872061-T-C p.Thr140Thr synonymous ALG6 3 82834 3.6217E-5 41417 0 9.57365E-5
1-63872070-G-GATTGCTAATGCATTATGCATCTTGCT c.429_429+1insATTGCTAATGCATTATGCATCTTGCT splice_donor ALG6 2 82704 2.41826E-5 41352 1 NA
1-63872075-G-A c.429+5G>A splice_region ALG6 1 82628 1.21024E-5 41314 0 NA
1-63872077-T-G c.429+7T>G splice_region ALG6 1 82620 1.21036E-5 41310 0 3.98597E-6
1-63872737-C-T p.Ala145Val missense ALG6 2 81652 2.44942E-5 40826 0 NA
1-63872751-A-G p.Ile150Val missense ALG6 5 81714 6.1189E-5 40857 0 6.25E-4
1-63872773-T-G p.Ile157Ser missense ALG6 1 81702 1.22396E-5 40851 0 7.9727E-6
1-63872778-A-G p.Ile159Val missense ALG6 1 81662 1.22456E-5 40831 0 5.58169E-5
1-63872783-C-T p.Asp160Asp synonymous ALG6 1 81634 1.22498E-5 40817 0 7.97442E-6
1-63872785-A-G p.Tyr161Cys missense ALG6 34 81560 4.16871E-4 40780 0 0.00805639
1-63872791-A-AT p.Gln165fs frameshift ALG6 1 81498 1.22702E-5 40749 0 NA
1-63876814-C-G p.Asn166Lys missense ALG6 2 82944 2.41127E-5 41472 0 NA
1-63876815-A-G c.495-2A>G splice_acceptor ALG6 3 82956 3.61638E-5 41478 0 7.96775E-6
1-63876815-A-T c.495-2A>T splice_acceptor ALG6 1 82956 1.20546E-5 41478 0 NA
1-63876817-A-G p.Ile167Met missense ALG6 2 82990 2.40993E-5 41495 0 3.98276E-6
1-63876828-T-C p.Val171Ala missense ALG6 1 83068 1.20383E-5 41534 0 NA
1-63876837-G-A p.Gly174Asp missense ALG6 1 83120 1.20308E-5 41560 0 7.96197E-6
1-63876847-G-T p.Leu177Phe missense ALG6 2 83148 2.40535E-5 41574 0 5.03525E-4
1-63876849-G-T p.Trp178Leu missense ALG6 3 83154 3.60776E-5 41577 0 2.54793E-4
1-63876851-G-A p.Gly179Ser missense ALG6 1 83158 1.20253E-5 41579 0 3.18613E-5
1-63876877-C-T p.Cys187Cys synonymous ALG6 1 83194 1.20201E-5 41597 0 9.56206E-5
1-63876885-T-A p.Leu190Gln missense ALG6 1 83204 1.20187E-5 41602 0 3.18593E-5
1-63876893-C-T p.Leu193Leu synonymous ALG6 1 83232 1.20146E-5 41616 0 NA
1-63876896-G-A p.Ala194Thr missense ALG6 4 83236 4.80561E-5 41618 0 NA
1-63876913-A-G p.Ile199Met missense ALG6 9 83248 1.08111E-4 41624 0 6.25E-4
1-63876919-T-C p.Tyr201Tyr synonymous ALG6 1 83242 1.20132E-5 41621 0 NA
1-63876920-A-G p.Lys202Glu missense ALG6 1 83242 1.20132E-5 41621 0 NA
1-63876940-C-T p.His208His synonymous ALG6 4 83252 4.80469E-5 41626 0 0.00100705
1-63876941-G-A p.Ala209Thr missense ALG6 2 83248 2.40246E-5 41624 0 6.25E-4
1-63876949-A-AT p.Cys214fs frameshift ALG6 1 83222 1.20161E-5 41611 0 3.98086E-6
1-63876956-T-G p.Cys214Gly missense ALG6 8 83224 9.61261E-5 41612 0 NA
1-63876991-C-T p.Leu225Leu synonymous ALG6 1 83010 1.20467E-5 41505 0 3.18756E-5
1-63876999-A-T p.Lys228Met missense ALG6 1 82914 1.20607E-5 41457 0 3.38857E-5
1-63877000-G-T p.Lys228Asn missense+splice_region ALG6 531 82878 0.00640701 41439 14 0.0143649
1-63877002-G-A p.Gly229Glu missense+splice_region ALG6 2 82860 2.41371E-5 41430 0 3.40855E-5
1-63877004-T-TTTGTGTTGCTAGTTAAGCTAGCTTGTATTGTTGTG c.686+2_686+3insTTGTGTTGCTAGTTAAGCTAGCTTGTATTGTTGTG splice_region ALG6 2 82826 2.4147E-5 41413 0 NA
1-63877004-T-TTTGTGTTGCTAGTTAAGCTAGCTTGTATTGTTGTGGCTTCCTTC c.686+2_686+3insTTGTGTTGCTAGTTAAGCTAGCTTGTATTGTTGTGGCTTCCTTC splice_region ALG6 1 82828 1.20732E-5 41414 0 NA
1-63877589-T-G c.687-8T>G splice_region ALG6 1 83276 1.20083E-5 41638 0 1.64766E-4
1-63877590-GT-G c.687-6delT splice_region ALG6 1 83276 1.20083E-5 41638 0 1.19352E-5
1-63877592-T-C c.687-5T>C splice_region ALG6 1 83286 1.20068E-5 41643 0 1.64764E-5
1-63877593-T-A c.687-4T>A splice_region ALG6 1 83284 1.20071E-5 41642 0 3.97776E-6
1-63877609-A-G p.Leu233Leu synonymous ALG6 1 83294 1.20057E-5 41647 0 8.23818E-6
1-63877620-C-G p.Ala237Gly missense ALG6 1 83298 1.20051E-5 41649 0 NA
1-63877624-T-C p.Cys238Cys synonymous ALG6 1 83304 1.20042E-5 41652 0 6.36821E-5
1-63877642-C-T p.Phe244Phe synonymous ALG6 727 83284 0.00872917 41642 14 0.0206886
1-63877643-G-A p.Val245Ile missense ALG6 2 83278 2.40159E-5 41639 0 4.13012E-5
1-63877667-A-G p.Thr253Ala missense ALG6 285 83282 0.00342211 41641 9 0.0060859
1-63877702-ACT-A p.Phe266fs frameshift ALG6 2 83282 2.40148E-5 41641 0 8.23805E-6
1-63877711-G-A p.Pro267Pro synonymous ALG6 4 83264 4.804E-5 41632 0 4.37626E-5
1-63877718-C-T p.Arg270Cys missense ALG6 1 83260 1.20106E-5 41630 0 8.23859E-6
1-63877720-T-G p.Arg270Arg synonymous ALG6 2 83256 2.40223E-5 41628 0 NA
1-63879733-A-G p.Asp275Gly missense+splice_region ALG6 1 82196 1.2166E-5 41098 0 3.98276E-6
1-63879742-C-G p.Ala278Gly missense ALG6 1 82366 1.21409E-5 41183 0 NA
1-63879767-C-G p.Val286Val synonymous ALG6 1 82600 1.21065E-5 41300 0 NA
1-63879770-T-G p.Phe287Leu missense ALG6 1 82606 1.21057E-5 41303 0 3.97991E-6
1-63879777-A-G p.Ile290Val missense ALG6 2 82628 2.42049E-5 41314 0 1.15609E-4
1-63879784-A-G p.Asp292Gly missense ALG6 1 82656 1.20983E-5 41328 0 NA
1-63879794-A-G p.Pro295Pro synonymous ALG6 3 82640 3.6302E-5 41320 0 NA
1-63879796-G-A p.Arg296His missense ALG6 1 82558 1.21127E-5 41279 0 6.37146E-5
1-63879797-T-C p.Arg296Arg synonymous ALG6 3 82598 3.63205E-5 41299 0 1.59246E-4
1-63879807-TTAA-T p.Ile301del disruptive_inframe_deletion ALG6 1 82542 1.2115E-5 41271 0 3.18532E-5
1-63879817-G-GCTTTTGTTTTACGTTTTTGAGCCTGCTTCCTGCATGCATAAAATTAATACTTCA c.908_908+1insCTTTTGTTTTACGTTTTTGAGCCTGCTTCCTGCATGCATAAAATTAATACTTCA splice_donor ALG6 2 82350 2.42866E-5 41175 1 NA
1-63879817-G-GCTTTT c.908_908+1insCTTTT splice_donor ALG6 2 82356 2.42848E-5 41178 1 NA
1-63881536-T-C c.909-8T>C splice_region ALG6 3 80802 3.71278E-5 40401 0 1.93532E-5
1-63881552-C-T p.Ser306Phe missense ALG6 57124 77550 0.736609 38775 21222 0.84418
1-63881555-C-T p.Thr307Met missense ALG6 3 81328 3.68877E-5 40664 0 5.03525E-4
1-63881556-G-A p.Arg280His missense ALG6 9 81352 1.1063E-4 40676 0 9.97208E-5
1-63881557-T-G p.Phe308Val missense ALG6 12 81436 1.47355E-4 40718 0 9.56023E-5
1-63881566-C-T p.Leu311Leu synonymous ALG6 1 81538 1.22642E-5 40769 0 NA
1-63881580-C-G p.Cys315Trp missense ALG6 1 81658 1.22462E-5 40829 0 NA
1-63881583-A-G p.Ile316Met missense ALG6 6 81644 7.34898E-5 40822 0 4.98049E-5
1-63881588-T-C p.Leu318Ser missense ALG6 1 81668 1.22447E-5 40834 0 NA
1-63881591-T-C p.Ile319Thr missense ALG6 3 81654 3.67404E-5 40827 0 6.37105E-5
1-63881593-C-T p.Leu320Phe missense ALG6 1 81648 1.22477E-5 40824 0 3.18735E-5
1-63881604-T-A p.Ser323Ser synonymous ALG6 21 81674 2.5712E-4 40837 0 2.91341E-4
1-63881618-A-G p.Lys328Arg missense ALG6 1 81512 1.22681E-5 40756 0 6.25E-4
1-63881619-A-C p.Lys328Asn missense ALG6 1 81510 1.22684E-5 40755 0 NA
1-63881622-T-C p.Phe329Phe synonymous ALG6 1361 81432 0.0167133 40716 52 0.0370323
1-63881626-C-T p.Leu331Leu splice_region+synonymous ALG6 1 81340 1.22941E-5 40670 0 NA
1-63881627-T-C p.Leu331Pro missense+splice_region ALG6 1 81366 1.22901E-5 40683 0 NA
1-63881631-A-G c.993+3A>G splice_region ALG6 1 81196 1.23159E-5 40598 0 1.99797E-5
1-63885040-G-A c.994-1G>A splice_acceptor ALG6 3 81762 3.66919E-5 40881 0 8.24375E-6
1-63885050-G-C p.Ala335Pro missense ALG6 1 81854 1.22169E-5 40927 0 1.20139E-5
1-63885051-C-T p.Ala335Val missense ALG6 2 81806 2.44481E-5 40903 0 6.59522E-5
1-63885052-G-A p.Ala335Ala synonymous ALG6 2 81830 2.44409E-5 40915 0 4.12201E-5
1-63885055-A-G p.Leu336Leu synonymous ALG6 3 81874 3.66417E-5 40937 0 3.29772E-5
1-63885058-A-G p.Ser337Ser synonymous ALG6 2 81900 2.442E-5 40950 0 3.19346E-5
1-63885084-A-G p.His346Arg missense ALG6 2 81894 2.44218E-5 40947 0 3.19E-5
1-63885085-T-C p.His346His synonymous ALG6 4 81912 4.88329E-5 40956 0 9.5706E-5
1-63885109-A-G p.Ser354Ser splice_region+synonymous ALG6 2 81558 2.45224E-5 40779 0 8.24865E-6
1-63894396-G-A c.1065-8G>A splice_region ALG6 5 81078 6.1669E-5 40539 0 3.42689E-5
1-63894396-G-T c.1065-8G>T splice_region ALG6 1 81078 1.23338E-5 40539 0 7.0028E-4
1-63894432-C-T p.Pro365Ser missense ALG6 1 82184 1.21678E-5 41092 0 4.00625E-6
1-63894465-A-G p.Thr376Ala missense ALG6 1 82352 1.2143E-5 41176 0 4.40582E-5
1-63894470-TAGGTAAGTCATATCAATTTCCATATATTTTCAGTATAATTCTTGTAAACTAATTTAAAACTTTTTTATGAAGTGGTTATGGTTTGAATTGATAATTCTCTTGTGATTTTTAAAAATTTTCCTTTAC-T c.1133+1_1134-1del splice_acceptor ALG6 6 82306 7.28987E-5 41153 0 NA
1-63894480-A-G c.1133+8A>G splice_region ALG6 1 82250 1.21581E-5 41125 0 1.60801E-5
1-63894593-T-G c.1134-6T>G splice_region ALG6 3 81928 3.66175E-5 40964 0 NA
1-63894596-C-T c.1134-3C>T splice_region ALG6 3 82004 3.65836E-5 41002 0 6.25E-4
1-63894606-C-T p.Pro381Ser missense ALG6 1 82064 1.21856E-5 41032 0 3.18552E-5
1-63894609-C-A p.Leu382Ile missense ALG6 1 82100 1.21803E-5 41050 0 3.18532E-5
1-63894630-C-T p.Leu389Leu synonymous ALG6 1 82302 1.21504E-5 41151 0 6.37349E-5
1-63894642-G-A p.Val393Ile missense ALG6 2 82358 2.42842E-5 41179 0 4.00042E-6
1-63894644-T-G p.Val393Val synonymous ALG6 2 82384 2.42766E-5 41192 0 1.69408E-5
1-63894654-A-G p.Met397Val missense ALG6 1 82454 1.2128E-5 41227 0 NA
1-63894659-A-AT p.Ile401fs frameshift ALG6 2 82502 2.42418E-5 41251 0 3.18573E-5
1-63894679-C-T p.Thr405Ile missense ALG6 1 82662 1.20975E-5 41331 0 NA
1-63894707-TGAA-T p.Glu417del conservative_inframe_deletion ALG6 2 82778 2.4161E-5 41389 0 3.1839E-5
1-63894723-T-G p.Leu420Val missense ALG6 1 82802 1.2077E-5 41401 0 6.3678E-5
1-63894730-C-A p.Ser422Tyr missense ALG6 2 82790 2.41575E-5 41395 0 NA
1-63894736-C-T p.Ser424Phe missense ALG6 1 82796 1.20779E-5 41398 0 NA
1-63894743-T-A p.Ser426Ser synonymous ALG6 3 82790 3.62363E-5 41395 0 1.23279E-5
1-63894755-T-C p.Tyr430Tyr synonymous ALG6 1 82726 1.20881E-5 41363 0 NA
1-63894762-T-G p.Cys433Gly missense ALG6 4 82686 4.83758E-5 41343 0 3.18431E-5
1-63894770-A-G p.Thr435Thr synonymous ALG6 1 82592 1.21077E-5 41296 0 NA
1-63894771-T-A p.Phe436Ile missense ALG6 4 82586 4.84344E-5 41293 0 6.36862E-5
1-63894779-C-T p.Ser438Ser synonymous ALG6 1 82464 1.21265E-5 41232 0 NA
1-63894785-T-C p.Ile440Ile synonymous ALG6 10 82396 1.21365E-4 41198 0 1.15557E-4
1-63894790-A-T p.Gln442Leu missense ALG6 1 82252 1.21578E-5 41126 0 NA
1-63894794-T-C p.Tyr443Tyr synonymous ALG6 689 82098 0.00839241 41049 7 0.0125368
1-63894797-G-GTTTCTTATCTCA c.1332_1332+1insTTTCTTATCTCA splice_donor ALG6 1 82048 1.2188E-5 41024 0 NA
1-63894797-G-GTTTCTTATCTCAGTCATCACTATGGT c.1332_1332+1insTTTCTTATCTCAGTCATCACTATGGT splice_donor ALG6 2 82048 2.4376E-5 41024 1 NA
1-63894803-T-A c.1332+6T>A splice_region ALG6 1 81784 1.22273E-5 40892 0 2.90048E-5
1-63902485-TCC-T c.1333-8_1333-7delCC splice_region ALG6 1 82414 1.21339E-5 41207 0 NA
1-63902489-TGCAG-T c.1333-4_1333-1delGCAG splice_acceptor ALG6 1 82452 1.21283E-5 41226 0 NA
1-63902493-G-GTTTTTT p.Phe445_Leu446insPhePhe conservative_inframe_insertion ALG6 1 82524 1.21177E-5 41262 0 NA
1-63902501-T-TGTGTTTAAAACTACTTTTCCTTAA p.Ile447delinsMetCysLeuLysLeuLeuPheLeuAsn disruptive_inframe_insertion ALG6 1 82670 1.20963E-5 41335 0 NA
1-63902503-TCA-T p.Ser448fs frameshift ALG6 1 82688 1.20937E-5 41344 0 NA
1-63902508-C-T p.Val449Val synonymous ALG6 9 82746 1.08767E-4 41373 0 0.00100705
1-63902524-C-G p.Leu455Val missense ALG6 1131 82790 0.0136611 41395 7 0.0127462
1-63902527-A-G p.Thr456Ala missense ALG6 1 82812 1.20755E-5 41406 0 NA
1-63902528-C-T p.Thr456Met missense ALG6 3 82824 3.62214E-5 41412 0 1.27478E-4
1-63902529-G-A p.Thr456Thr synonymous ALG6 1 82822 1.20741E-5 41411 0 1.27592E-4
1-63902560-A-G p.Lys467Glu missense ALG6 2 82782 2.41598E-5 41391 0 NA
1-63902565-A-T p.Leu468Leu synonymous ALG6 50 82766 6.04113E-4 41383 0 0.00197503
1-63902567-C-T p.Pro469Leu missense ALG6 3 82758 3.62503E-5 41379 0 3.18573E-5
1-63902603-G-T p.Cys481Phe missense ALG6 2 82846 2.41412E-5 41423 0 6.37633E-5
1-63902609-A-G p.Asn483Ser missense ALG6 11 82830 1.32802E-4 41415 0 1.315E-4
1-63902618-T-A p.Phe486Tyr missense ALG6 2 82836 2.41441E-5 41418 0 8.24892E-6
1-63902619-C-T p.Phe486Phe synonymous ALG6 24 82820 2.89785E-4 41410 0 0.00135501
1-63902626-G-A p.Val489Ile missense ALG6 1 82786 1.20793E-5 41393 0 3.98568E-6
1-63902632-T-G p.Phe491Val missense ALG6 11 82762 1.32911E-4 41381 0 1.31535E-4
1-63902635-A-G p.Asn492Asp missense ALG6 1 82756 1.20837E-5 41378 0 NA
1-63902638-A-G p.Ile493Val missense ALG6 1 82758 1.20834E-5 41379 0 NA
1-63902648-T-C p.Met496Thr missense ALG6 2 82752 2.41686E-5 41376 0 NA
1-63902663-G-T p.Ser501Ile missense ALG6 1 82704 1.20913E-5 41352 0 NA
1-63902663-G-A p.Ser501Asn missense ALG6 1 82704 1.20913E-5 41352 0 4.38852E-5
1-63902683-A-G p.Ile508Val missense ALG6 1 82632 1.21018E-5 41316 0 NA
1-63902690-AG-A p.Ter510fs frameshift ALG6 1 82564 1.21118E-5 41282 0 1.73058E-5