Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
3-183960256-C-CCAGGTCCTGAGGGTAGACT c.*27_*45dupAGTCTACCCTCAGGACCTG splice_region ALG3 2 81198 2.46311E-5 40599 0 1.66207E-5
3-183960320-G-T p.His433Gln missense ALG3 1 81636 1.22495E-5 40818 0 NA
3-183960326-G-C p.Thr431Thr synonymous ALG3 2 81698 2.44804E-5 40849 0 NA
3-183960339-A-T p.Phe427Tyr missense ALG3 3 81872 3.66426E-5 40936 0 1.80473E-5
3-183960346-G-T p.Gln425Lys missense ALG3 1 81916 1.22076E-5 40958 0 NA
3-183960347-C-T p.Pro424Pro synonymous ALG3 2 81892 2.44224E-5 40946 0 6.25E-4
3-183960347-C-A p.Pro424Pro synonymous ALG3 1 81892 1.22112E-5 40946 0 1.8077E-5
3-183960348-G-A p.Pro424Leu missense ALG3 42 81948 5.1252E-4 40974 2 0.00178398
3-183960352-C-A p.Gly423Cys missense ALG3 3 81982 3.65934E-5 40991 0 5.03525E-4
3-183960365-C-T p.Leu418Leu synonymous ALG3 1 82098 1.21806E-5 41049 0 3.18431E-5
3-183960376-C-T p.Val415Ile missense ALG3 12 82154 1.46067E-4 41077 0 7.26889E-5
3-183960377-G-A p.Ala414Ala synonymous ALG3 5 82172 6.0848E-5 41086 0 5.03525E-4
3-183960378-G-T p.Ala414Asp missense ALG3 2 82170 2.43398E-5 41085 0 NA
3-183960380-A-G p.His413His synonymous ALG3 1 82190 1.21669E-5 41095 0 NA
3-183960389-G-C p.His410Gln missense ALG3 1 82254 1.21575E-5 41127 0 NA
3-183960404-G-A p.Ser405Ser synonymous ALG3 6 82236 7.29607E-5 41118 0 1.51125E-4
3-183960407-G-C p.Cys404Trp missense ALG3 1 82250 1.21581E-5 41125 0 5.03525E-4
3-183960426-G-T p.Thr398Lys missense ALG3 1 82284 1.2153E-5 41142 0 NA
3-183960437-G-A p.Leu394Leu synonymous ALG3 3 82294 3.64547E-5 41147 0 2.81706E-5
3-183960443-G-A p.Ile392Ile synonymous ALG3 7 82298 8.50567E-5 41149 0 1.03337E-4
3-183960449-C-A p.Gly390Gly synonymous ALG3 1 82284 1.2153E-5 41142 0 2.81458E-5
3-183960454-G-T p.Leu389Met missense ALG3 2 82292 2.43037E-5 41146 0 9.374E-6
3-183960454-G-C p.Leu389Val missense ALG3 1 82292 1.21518E-5 41146 0 NA
3-183960456-AC-A p.Val388fs frameshift ALG3 3 82294 3.64547E-5 41147 0 NA
3-183960594-C-T c.1154+7G>A splice_region ALG3 1 82436 1.21306E-5 41218 0 NA
3-183960596-G-A c.1154+5C>T splice_region ALG3 24 82442 2.91114E-4 41221 0 3.31835E-5
3-183960596-G-C c.1154+5C>G splice_region ALG3 4 82444 4.85178E-5 41222 0 NA
3-183960601-C-G p.Arg385Thr missense+splice_region ALG3 2 82454 2.42559E-5 41227 0 6.36902E-5
3-183960618-C-A p.Trp379Cys missense ALG3 9 82456 1.09149E-4 41228 0 9.55231E-5
3-183960623-G-A p.Arg378Cys missense ALG3 8 82470 9.7005E-5 41235 0 6.25E-4
3-183960626-C-T p.Ala377Thr missense ALG3 1 82468 1.21259E-5 41234 0 NA
3-183960634-G-T p.Ala374Asp missense ALG3 1 82472 1.21253E-5 41236 0 NA
3-183960644-G-C p.Leu371Val missense ALG3 1 82474 1.2125E-5 41237 0 NA
3-183960647-A-G p.Tyr370His missense ALG3 2 82466 2.42524E-5 41233 0 1.66121E-5
3-183960648-G-A p.Pro369Pro synonymous ALG3 4 82470 4.85025E-5 41235 0 1.66121E-5
3-183960653-G-A p.Leu368Leu synonymous ALG3 2 82464 2.4253E-5 41232 0 6.82693E-5
3-183960671-C-T p.Val362Ile missense ALG3 79 82450 9.58156E-4 41225 2 0.00122384
3-183960678-C-T p.Gln359Gln synonymous ALG3 6 82442 7.27784E-5 41221 0 1.75E-4
3-183960681-G-A p.Tyr358Tyr synonymous ALG3 1 82454 1.2128E-5 41227 0 NA
3-183960695-G-A p.Arg354Cys missense ALG3 1 82402 1.21356E-5 41201 0 2.41262E-5
3-183960696-G-C p.Ser353Arg missense ALG3 1 82404 1.21353E-5 41202 0 NA
3-183960730-AG-A p.Leu342fs frameshift ALG3 1 82308 1.21495E-5 41154 0 NA
3-183960731-G-T p.Leu342Ile missense ALG3 9 82314 1.09337E-4 41157 1 0.00100705
3-183960732-G-A p.Thr341Thr synonymous ALG3 4 82286 4.86109E-5 41143 0 1.91131E-4
3-183960751-C-T c.1010-6G>A splice_region ALG3 3 81858 3.66488E-5 40929 0 1.73916E-5
3-183960752-G-A c.1010-7C>T splice_region ALG3 1 81818 1.22222E-5 40909 0 1.21394E-5
3-183960789-G-T n.307C>A splice_region ALG3 1 80422 1.24344E-5 40211 0 2.37322E-4
3-183960789-G-A n.307C>T splice_region ALG3 1 80422 1.24344E-5 40211 0 NA
3-183960794-T-C n.306-4A>G splice_region ALG3 1 80172 1.24732E-5 40086 0 4.25289E-6
3-183960797-C-T n.306-7G>A splice_region ALG3 1 80028 1.24956E-5 40014 0 NA
3-183961346-G-C p.Pro335Pro synonymous ALG3 1 82634 1.21016E-5 41317 0 2.00739E-5
3-183961354-G-A p.Leu333Phe missense ALG3 1 82660 1.20978E-5 41330 0 NA
3-183961380-G-C p.Ser324Cys missense ALG3 18 82704 2.17644E-4 41352 0 6.69472E-4
3-183961386-T-A p.Asp322Val missense ALG3 5 82704 6.04566E-5 41352 0 4.01303E-5
3-183961397-C-T p.Ser318Ser synonymous ALG3 13 82720 1.57157E-4 41360 0 2.25368E-4
3-183961404-A-G p.Ile316Thr missense ALG3 1 82746 1.20852E-5 41373 0 3.18756E-5
3-183961406-A-G p.Ser315Ser synonymous ALG3 3 82742 3.62573E-5 41371 0 6.37674E-5
3-183961410-T-G p.Glu314Ala missense ALG3 1 82738 1.20863E-5 41369 0 NA
3-183961414-C-G p.Gly313Arg missense ALG3 1 82748 1.20849E-5 41374 0 NA
3-183961422-G-A c.933-4C>T splice_region ALG3 27 82718 3.2641E-4 41359 0 6.82347E-4
3-183961423-A-G c.933-5T>C splice_region ALG3 2 82714 2.41797E-5 41357 0 NA
3-183961581-G-A p.His310His splice_region+synonymous ALG3 1 82224 1.21619E-5 41112 0 4.05762E-6
3-183961582-T-A p.His310Leu missense ALG3 1 82226 1.21616E-5 41113 0 NA
3-183961585-C-T p.Trp309* stop_gained ALG3 1 82218 1.21628E-5 41109 0 NA
3-183961593-G-A p.Leu306Leu synonymous ALG3 1 82258 1.21569E-5 41129 0 1.79931E-5
3-183961602-C-T p.Leu303Leu synonymous ALG3 2 82260 2.43132E-5 41130 0 1.74249E-5
3-183961602-C-G p.Leu303Leu synonymous ALG3 2 82260 2.43132E-5 41130 0 NA
3-183961619-GGT-G p.His297fs frameshift ALG3 1 82242 1.21592E-5 41121 0 1.20738E-5
3-183961640-G-A p.Leu291Leu synonymous ALG3 1 82282 1.21533E-5 41141 0 6.25E-4
3-183961652-G-A p.Arg287* stop_gained ALG3 1 82266 1.21557E-5 41133 0 3.18613E-5
3-183961654-T-A p.His286Leu missense ALG3 1 82274 1.21545E-5 41137 0 3.18512E-5
3-183961665-C-T p.Ala282Ala synonymous ALG3 1 82256 1.21572E-5 41128 0 8.38603E-6
3-183961666-G-A p.Ala282Val missense ALG3 67 82242 8.14669E-4 41121 1 8.91777E-4
3-183961668-C-T p.Glu281Glu synonymous ALG3 1 82280 1.21536E-5 41140 0 NA
3-183961712-G-T p.Gln267Lys missense ALG3 2 82196 2.43321E-5 41098 0 9.22339E-5
3-183961715-G-A p.Arg266Cys missense ALG3 2 82200 2.43309E-5 41100 0 8.38434E-6
3-183961715-G-C p.Arg266Gly missense ALG3 1 82200 1.21655E-5 41100 0 NA
3-183961721-G-A p.Leu264Phe missense ALG3 17 82184 2.06853E-4 41092 0 0.00100705
3-183961731-G-A p.Arg260Arg synonymous ALG3 1 82144 1.21737E-5 41072 0 NA
3-183961733-G-A p.Arg260Cys missense ALG3 8 82128 9.74089E-5 41064 0 5.22987E-5
3-183961734-G-A p.Ser259Ser synonymous ALG3 7 82122 8.5239E-5 41061 0 5.8714E-5
3-183961736-A-G p.Ser259Pro missense ALG3 1 82056 1.21868E-5 41028 0 NA
3-183961746-G-A p.Ser255Ser synonymous ALG3 2 81936 2.44093E-5 40968 0 8.39842E-6
3-183961747-C-T p.Ser255Asn missense ALG3 1 81960 1.22011E-5 40980 0 8.39955E-6
3-183961752-G-T p.Asn253Lys missense ALG3 1 81896 1.22106E-5 40948 0 NA
3-183961760-G-A p.Leu251Leu synonymous ALG3 1 81746 1.2233E-5 40873 0 NA
3-183961783-A-C p.Val243Gly missense+splice_region ALG3 1 81292 1.23013E-5 40646 0 NA
3-183961783-AC-A p.Val243fs frameshift ALG3 1 81292 1.23013E-5 40646 0 4.03682E-6
3-183961785-C-T c.727-1G>A splice_acceptor ALG3 1 81310 1.22986E-5 40655 0 8.54555E-6
3-183961789-G-A c.727-5C>T splice_region ALG3 1 81186 1.23174E-5 40593 0 NA
3-183962394-G-A p.Leu241Phe missense ALG3 1 82280 1.21536E-5 41140 0 4.14879E-6
3-183962398-A-C p.Ala239Ala synonymous ALG3 8 82292 9.72148E-5 41146 0 2.22973E-4
3-183962409-C-T p.Gly236Arg missense ALG3 1 82352 1.2143E-5 41176 0 2.06129E-5
3-183962419-G-A p.Leu232Leu synonymous ALG3 1 82366 1.21409E-5 41183 0 3.18796E-5
3-183962425-C-T p.Gly230Gly synonymous ALG3 4 82372 4.85602E-5 41186 0 1.12098E-5
3-183962429-C-T p.Arg229His missense ALG3 1 82376 1.21395E-5 41188 0 0.00102145
3-183962430-G-A p.Arg229Cys missense ALG3 8 82390 9.70992E-5 41195 0 6.25E-4
3-183962438-A-G p.Phe226Ser missense ALG3 1 82406 1.2135E-5 41203 0 NA
3-183962446-G-A p.Leu223Leu synonymous ALG3 68 82394 8.25303E-4 41197 1 0.00609756
3-183962459-A-G p.Leu219Pro missense ALG3 2 82382 2.42771E-5 41191 0 NA
3-183962464-C-A p.Gly217Gly synonymous ALG3 2 82364 2.42825E-5 41182 0 NA
3-183962472-C-A p.Ala215Ser missense ALG3 1 82320 1.21477E-5 41160 0 NA
3-183962473-G-A p.Phe214Phe synonymous ALG3 2 82356 2.42848E-5 41178 0 9.84726E-5
3-183962476-G-T p.Leu213Leu synonymous ALG3 5 82362 6.07076E-5 41181 0 5.45114E-5
3-183962491-C-G p.Lys208Asn missense ALG3 1 82292 1.21518E-5 41146 0 NA
3-183962517-G-A c.606-8C>T splice_region ALG3 22 82146 2.67816E-4 41073 0 1.47632E-4
3-183962857-G-A n.723C>T splice_region ALG3 1 64418 1.55236E-5 32209 0 NA
3-183962979-T-C c.605+7A>G splice_region ALG3 2 82242 2.43185E-5 41121 0 6.39836E-5
3-183962992-A-C p.Phe200Cys missense ALG3 1 82328 1.21465E-5 41164 0 4.01984E-6
3-183963000-A-G p.Gly197Gly synonymous ALG3 1466 82312 0.0178103 41156 81 0.0374992
3-183963000-AC-A p.Gly197fs frameshift ALG3 2 82346 2.42878E-5 41173 0 NA
3-183963013-C-T p.Arg193His missense ALG3 1 82352 1.2143E-5 41176 0 6.25E-4
3-183963024-CAGG-C p.Leu189del disruptive_inframe_deletion ALG3 1 82368 1.21406E-5 41184 0 NA
3-183963037-C-G p.Ser185Thr missense ALG3 1 82332 1.21459E-5 41166 0 4.02123E-6
3-183963042-G-A p.Phe183Phe synonymous ALG3 3 82338 3.64352E-5 41169 0 3.18552E-5
3-183963070-T-C p.Asn174Ser missense ALG3 1 82288 1.21524E-5 41144 0 NA
3-183963079-C-T p.Arg171Gln missense ALG3 10 82298 1.2151E-4 41149 0 9.56694E-5
3-183963079-C-A p.Arg171Leu missense ALG3 1 82298 1.2151E-5 41149 0 8.69036E-6
3-183963080-G-A p.Arg171Trp missense ALG3 2 82292 2.43037E-5 41146 0 5.23186E-5
3-183963081-C-A p.Leu170Leu synonymous ALG3 2 82290 2.43043E-5 41145 0 9.56738E-5
3-183963086-C-T p.Val169Met missense ALG3 3 82308 3.64485E-5 41154 0 8.72205E-6
3-183963104-G-A p.Arg163Cys missense ALG3 1 82252 1.21578E-5 41126 0 2.43418E-5
3-183963114-G-A p.Cys159Cys synonymous ALG3 25 82224 3.04047E-4 41112 0 0.00100705
3-183963122-T-A p.Met157Leu missense ALG3 1 82214 1.21634E-5 41107 0 NA
3-183963134-C-T p.Val153Ile missense ALG3 9 82148 1.09558E-4 41074 0 0.00100705
3-183963135-G-A p.Phe152Phe synonymous ALG3 1 82174 1.21693E-5 41087 0 1.78063E-5
3-183963141-A-T p.Pro150Pro synonymous ALG3 1 82118 1.21776E-5 41059 0 NA
3-183963144-TACCTAAAGGGAAAACACAGTAAGGTACAAGGTCAGCTCAGCAAGCCTGAGCCATCCCCACCACCCAGCCCTCCCAGGCTGGGGCCCTCTAGCCCTGGTAGCATGGACTC-T p.Val149fs frameshift ALG3 5 82052 6.0937E-5 41026 1 NA
3-183963250-A-G c.444+6T>C splice_region ALG3 1 82550 1.21139E-5 41275 0 NA
3-183963255-C-A c.444+1G>T splice_donor ALG3 1 82578 1.21098E-5 41289 0 3.33095E-5
3-183963258-T-C p.Lys148Glu missense+splice_region ALG3 1 82574 1.21103E-5 41287 0 3.18613E-5
3-183963270-G-A p.His144Tyr missense ALG3 2 82612 2.42096E-5 41306 0 4.01471E-6
3-183963274-G-C p.Ile142Met missense ALG3 1 82614 1.21045E-5 41307 0 NA
3-183963275-A-G p.Ile142Thr missense ALG3 2 82612 2.42096E-5 41306 0 1.66351E-5
3-183963287-A-G p.Leu138Pro missense ALG3 1 82634 1.21016E-5 41317 0 3.18512E-5
3-183963313-A-G p.Leu96Pro missense ALG3 1 82682 1.20945E-5 41341 0 NA
3-183963314-G-A p.Ala129Val missense ALG3 1 82682 1.20945E-5 41341 0 3.18613E-5
3-183963316-A-G p.Leu95Ser missense ALG3 1 82680 1.20948E-5 41340 0 6.37349E-5
3-183963326-TG-T p.Gln125fs frameshift ALG3 2 82708 2.41815E-5 41354 0 4.01378E-6
3-183963335-C-T p.Arg122His missense ALG3 1 82728 1.20878E-5 41364 0 NA
3-183963341-T-C p.Asp120Gly missense ALG3 1 82738 1.20863E-5 41369 0 4.01523E-6
3-183963344-G-T p.Thr119Asn missense ALG3 1 82738 1.20863E-5 41369 0 NA
3-183963350-C-T p.Arg117Gln missense ALG3 4 82716 4.83582E-5 41358 0 1.70291E-5
3-183963350-C-G p.Arg117Pro missense ALG3 1 82716 1.20896E-5 41358 0 8.51455E-6
3-183963351-G-A p.Arg117* stop_gained ALG3 4 82716 4.83582E-5 41358 0 5.11056E-5
3-183963353-C-A p.Ser116Ile missense ALG3 1 82720 1.2089E-5 41360 0 3.41186E-5
3-183963357-T-C p.Thr115Ala missense ALG3 1 82714 1.20899E-5 41357 0 4.02201E-6
3-183963371-C-A p.Gly110Val missense ALG3 2 82704 2.41826E-5 41352 0 6.37349E-5
3-183963375-T-C p.Met109Val missense ALG3 1 82720 1.2089E-5 41360 0 8.67197E-6
3-183963379-G-C p.Ile107Met missense ALG3 1 82708 1.20907E-5 41354 0 NA
3-183963381-T-C p.Ile107Val missense ALG3 1370 82698 0.0165663 41349 14 0.020625
3-183963388-G-A p.Ser71Leu missense ALG3 4 82710 4.83617E-5 41355 0 3.07611E-4
3-183963396-C-A p.Ala102Ser missense ALG3 1 82700 1.20919E-5 41350 0 NA
3-183963401-TACCTGGAAGATGAGAGAAAATGTGAGCCTGGGTCAGGTCACACAGACTAGTACCTAACCAGCCCCTCACATCCTCCCTGAACTTCCTGTCCCCACTC-T p.Tyr100fs frameshift ALG3 13 82712 1.57172E-4 41356 6 NA
3-183963409-A-G c.297-6T>C splice_region ALG3 2 82702 2.41832E-5 41351 0 6.37024E-5
3-183963410-G-C c.297-7C>G splice_region ALG3 1 82694 1.20928E-5 41347 0 NA
3-183963494-C-T c.296+7G>A splice_region ALG3 2 82588 2.42166E-5 41294 0 1.72159E-5
3-183963498-C-T c.296+3G>A splice_region ALG3 2 82584 2.42178E-5 41292 0 NA
3-183963501-A-C p.Val99Gly missense+splice_region ALG3 1 82598 1.21068E-5 41299 0 8.54263E-6
3-183963503-A-T p.Leu98Leu splice_region+synonymous ALG3 4 82596 4.84285E-5 41298 0 3.40983E-5
3-183963509-T-G p.Gly96Gly synonymous ALG3 1 82588 1.21083E-5 41294 0 NA
3-183963511-C-T p.Gly96Arg missense ALG3 1 82580 1.21095E-5 41290 0 2.00832E-5
3-183963535-A-G p.Tyr88His missense ALG3 1 82526 1.21174E-5 41263 0 3.18654E-5
3-183963540-T-C p.Tyr86Cys missense ALG3 1 82492 1.21224E-5 41246 0 1.20398E-5
3-183963549-T-C p.Asn83Ser missense ALG3 9 82458 1.09146E-4 41229 0 0.00125
3-183963569-G-A p.Pro64Leu missense ALG3 2 82060 2.43724E-5 41030 0 8.58782E-6
3-183963575-G-A p.Thr62Ile missense ALG3 52 81848 6.35324E-4 40924 0 6.25E-4
3-183963600-T-TATGCCACC c.197-1_197insGGTGGCAT splice_acceptor ALG3 1 79932 1.25106E-5 39966 0 NA
3-183963603-GGAA-G c.197-6_197-4delTTC splice_region ALG3 4 79626 5.02348E-5 39813 0 1.34022E-4
3-183966534-T-C p.Met43Val missense+splice_region ALG3 1 65768 1.5205E-5 32884 0 4.63027E-6
3-183966537-C-A p.Gly42Cys missense ALG3 2 66726 2.99733E-5 33363 0 2.88873E-5
3-183966564-G-A p.His33Tyr missense ALG3 6 73206 8.19605E-5 36603 0 6.25E-4
3-183966574-G-T p.Ala52Glu missense ALG3 1 74548 1.34142E-5 37274 0 NA
3-183966592-G-A p.Ala46Val missense ALG3 1 75658 1.32174E-5 37829 0 NA
3-183966599-G-A p.Ala21Val missense ALG3 1 76032 1.31524E-5 38016 0 1.93757E-5
3-183966603-C-G p.Ala20Pro missense ALG3 1 76184 1.31261E-5 38092 0 NA
3-183966604-GTGTAGCGCGGCTCCCGCAGCAGCAGGCGCCGCTCT-G p.Gln30fs frameshift ALG3 2 76222 2.62391E-5 38111 0 NA
3-183966617-C-G p.Glu38Gln missense ALG3 7 76730 9.1229E-5 38365 0 1.91314E-4
3-183966619-C-T p.Arg37Gln missense ALG3 1 76816 1.30181E-5 38408 0 NA
3-183966650-G-C p.Arg27Gly missense ALG3 2 77122 2.59329E-5 38561 0 1.26897E-5
3-183966654-C-T p.Ala3Thr missense ALG3 1 77348 1.29286E-5 38674 0 NA
3-183966655-A-G p.Leu25Pro missense ALG3 1 77404 1.29192E-5 38702 0 8.8968E-5
3-183966657-C-T p.Trp24* stop_gained ALG3 3 77426 3.87467E-5 38713 0 NA
3-183966663-C-T p.Lys22Lys synonymous ALG3 1 77538 1.28969E-5 38769 0 8.05585E-5
3-183966667-C-A p.Cys21Phe missense ALG3 2 77496 2.58078E-5 38748 0 2.86807E-4
3-183966668-A-C p.Cys21Gly missense ALG3 2 77500 2.58065E-5 38750 0 2.19533E-5
3-183966670-A-C p.Leu20Arg missense ALG3 6 77462 7.74573E-5 38731 0 3.18898E-5
3-183966674-C-T p.Gly19Arg missense ALG3 1 77364 1.29259E-5 38682 0 NA
3-183966675-C-T p.Glu18Glu synonymous ALG3 1 77370 1.29249E-5 38685 0 1.47011E-5
3-183966676-T-C p.Glu18Gly missense ALG3 2 77318 2.58672E-5 38659 0 4.45262E-5
3-183966678-T-C p.Ala17Ala synonymous ALG3 2 77234 2.58953E-5 38617 0 4.99939E-4
3-183966679-G-C p.Ala17Gly missense ALG3 1 77148 1.29621E-5 38574 0 2.23157E-4
3-183966679-G-A p.Ala17Val missense ALG3 2 77148 2.59242E-5 38574 0 1.54121E-5
3-183966686-C-T p.Ala15Thr missense ALG3 1 77050 1.29786E-5 38525 0 NA
3-183966692-AACCGGACCGGCCGCGT-A p.Lys7fs frameshift ALG3 1 77096 1.29708E-5 38548 0 NA
3-183966696-G-A c.-36C>T 5_prime_UTR_premature_start_codon_gain ALG3 1 77114 1.29678E-5 38557 0 6.37674E-5
3-183966701-GGCCGCGTTTCCGCAGCCCA-G p.Leu5fs frameshift ALG3 2 77084 2.59457E-5 38542 0 NA
3-183966701-G-A p.Arg10Trp missense ALG3 1 77084 1.29729E-5 38542 0 1.17481E-4
3-183966705-G-A p.Arg8Arg synonymous ALG3 1 77040 1.29803E-5 38520 0 1.44562E-4
3-183966710-T-G p.Lys7Gln missense ALG3 1 77068 1.29756E-5 38534 0 1.08267E-4
3-183966713-G-T p.Arg6Arg synonymous ALG3 11 77034 1.42794E-4 38517 0 2.54972E-4
3-183966715-A-G p.Leu5Pro missense ALG3 1 77050 1.29786E-5 38525 0 6.37471E-5
3-183966716-G-C p.Leu5Val missense ALG3 2 77062 2.59531E-5 38531 0 4.08263E-5
3-183966723-C-T p.Ala2Ala synonymous ALG3 1 77158 1.29604E-5 38579 0 NA
3-183966724-G-A p.Ala2Val missense ALG3 1 77184 1.29561E-5 38592 0 1.04475E-5
3-183966727-A-G p.Met1? start_lost ALG3 2 77236 2.58947E-5 38618 0 5.27248E-6
3-183966758-C-A c.-30G>T 5_prime_UTR_premature_start_codon_gain ALG3 20 77192 2.59094E-4 38596 0 0.00301907
3-183966771-C-T c.76+7G>A splice_region ALG3 2 77280 2.58799E-5 38640 0 NA
3-183966778-C-T p.Asp26Asn missense+splice_region ALG3 1 77320 1.29333E-5 38660 0 6.85777E-5
3-183966782-G-A p.Val24Val synonymous ALG3 8 77316 1.03471E-4 38658 0 2.231E-4
3-183966791-G-A p.Asn21Asn synonymous ALG3 2 77400 2.58398E-5 38700 0 1.40375E-5
3-183966805-G-T p.His17Asn missense ALG3 2 77498 2.58071E-5 38749 0 NA
3-183966813-T-G p.Asp14Ala missense ALG3 1 77680 1.28733E-5 38840 0 6.9772E-6
3-183966818-C-A p.Trp12Cys missense ALG3 1080 77780 0.0138853 38890 11 0.0167197
3-183966828-C-T p.Arg9His missense ALG3 2 78066 2.56193E-5 39033 0 2.72889E-4
3-183966832-G-A p.Arg8Trp missense ALG3 2 78284 2.5548E-5 39142 0 1.37382E-5
3-183966836-C-T p.Ser6Ser synonymous ALG3 1 78462 1.2745E-5 39231 0 NA
3-183966837-G-T p.Ser6* stop_gained ALG3 2 78514 2.54732E-5 39257 0 1.31752E-4
3-183966840-T-TA p.Tyr5fs frameshift ALG3 14 78678 1.7794E-4 39339 0 3.18532E-4
3-183966845-A-G p.Thr3Thr synonymous ALG3 5 79180 6.31473E-5 39590 0 NA
3-183966849-T-A p.Lys2Met missense ALG3 1 79458 1.25853E-5 39729 0 NA
3-183966860-C-A c.-7G>T 5_prime_UTR_premature_start_codon_gain ALG3 5 80268 6.22913E-5 40134 0 NA
3-183966901-C-G c.-48G>C 5_prime_UTR_premature_start_codon_gain ALG3 1 81868 1.22148E-5 40934 0 NA
3-183966972-T-C c.-119A>G 5_prime_UTR_premature_start_codon_gain ALG3 1 82182 1.21681E-5 41091 0 5.54964E-5
3-183967010-C-T c.52+4G>A splice_region ALG3 1 82102 1.218E-5 41051 0 1.01245E-5
3-183967020-C-A p.Gly16Trp missense ALG3 18 82046 2.19389E-4 41023 0 3.82336E-4
3-183967020-C-G p.Gly16Arg missense ALG3 1 82048 1.2188E-5 41024 0 2.07454E-4
3-183967021-A-G p.Cys15Cys synonymous ALG3 1 82012 1.21933E-5 41006 0 NA
3-183967026-C-T p.Gly14Ser missense ALG3 3 82010 3.65809E-5 41005 0 1.22052E-5
3-183967027-G-T p.Ser13Arg missense ALG3 7 81982 8.53846E-5 40991 0 4.07491E-5
3-183967034-C-T p.Gly11Asp missense ALG3 1 81946 1.22032E-5 40973 0 4.06861E-6
3-183967042-C-T p.Glu8Glu synonymous ALG3 2 81984 2.4395E-5 40992 0 4.07657E-6
3-183967048-C-T p.Ala6Ala synonymous ALG3 1 81950 1.22026E-5 40975 0 1.02942E-5
3-183967088-G-A c.-23C>T 5_prime_UTR_premature_start_codon_gain ALG3 2 81688 2.44834E-5 40844 0 2.15884E-5
3-183967175-G-C c.-110C>G 5_prime_UTR_premature_start_codon_gain ALG3 1 75386 1.32651E-5 37693 0 NA
3-183967198-T-C c.-133A>G 5_prime_UTR_premature_start_codon_gain ALG3 3 71014 4.22452E-5 35507 0 9.55292E-5
3-183967233-C-T c.-168G>A 5_prime_UTR_premature_start_codon_gain ALG3 1 63028 1.5866E-5 31514 0 NA