Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
22-50297369-C-G p.Gly201Ala missense ALG12 3 78814 3.80643E-5 39407 0 0.00113153
22-50297369-C-T p.Gly201Asp missense ALG12 1 78840 1.26839E-5 39420 0 1.14997E-5
22-50297371-C-G p.Leu200Leu synonymous ALG12 1 79102 1.26419E-5 39551 0 NA
22-50297378-T-C p.Lys198Arg missense ALG12 1 79764 1.2537E-5 39882 0 NA
22-50297382-C-A p.Val197Phe missense ALG12 4 80170 4.9894E-5 40085 0 9.55718E-5
22-50297382-C-T p.Val197Ile missense ALG12 1 80170 1.24735E-5 40085 0 3.15779E-4
22-50297404-A-ACG p.Tyr190fs frameshift ALG12 1 81920 1.2207E-5 40960 0 NA
22-50297405-T-C p.Asn189Ser missense ALG12 1 81922 1.22067E-5 40961 0 1.24023E-5
22-50297409-G-GC p.His188fs frameshift ALG12 1 82074 1.21841E-5 41037 0 NA
22-50297411-TGGA-T p.Phe186_Gln187delinsTer stop_gained ALG12 1 82224 1.21619E-5 41112 0 NA
22-50297418-G-A p.Gln185* stop_gained ALG12 1 82480 1.21242E-5 41240 0 4.07014E-6
22-50297419-T-G p.Ala184Ala synonymous ALG12 1 82504 1.21206E-5 41252 0 1.55096E-4
22-50297421-C-T p.Ala184Thr missense ALG12 1 82520 1.21183E-5 41260 0 NA
22-50297435-T-C p.His179Arg missense ALG12 21427 80090 0.267537 40045 3277 0.347447
22-50297444-C-T p.Ser176Asn missense ALG12 46 83004 5.5419E-4 41502 0 6.05134E-4
22-50297453-G-A p.Pro173Leu missense ALG12 33 83070 3.97255E-4 41535 0 0.0025
22-50297454-G-T p.Pro173Thr missense ALG12 1 83066 1.20386E-5 41533 0 NA
22-50297454-G-A p.Pro173Ser missense ALG12 1 83066 1.20386E-5 41533 0 NA
22-50297457-T-A p.Arg172Trp missense ALG12 1 83066 1.20386E-5 41533 0 8.47185E-6
22-50297460-G-A p.His171Tyr missense ALG12 1 83076 1.20372E-5 41538 0 NA
22-50297462-C-G p.Ser170Thr missense ALG12 1 83058 1.20398E-5 41529 0 NA
22-50297480-T-C p.Asp164Gly missense ALG12 1 82998 1.20485E-5 41499 0 NA
22-50297485-C-G p.Glu162Asp missense ALG12 268 83048 0.00322705 41524 0 0.003125
22-50297493-GGCCGGGGGA-G p.Leu484_Arg486del disruptive_inframe_deletion ALG12 1 83058 1.20398E-5 41529 0 NA
22-50297496-C-T p.Arg486Gln missense ALG12 1 83028 1.20441E-5 41514 0 1.59347E-4
22-50297496-CG-C p.Arg486fs frameshift ALG12 11 83028 1.32485E-4 41514 0 1.27478E-4
22-50297496-C-CG p.Arg486fs frameshift ALG12 1 83028 1.20441E-5 41514 0 NA
22-50297497-G-A p.Arg486Trp missense ALG12 4 83122 4.8122E-5 41561 0 3.187E-5
22-50297504-CCT-C p.Arg483fs frameshift ALG12 1 83134 1.20288E-5 41567 0 NA
22-50297515-G-A p.Leu480Phe missense ALG12 3 83188 3.60629E-5 41594 0 8.25928E-6
22-50297519-C-A p.Trp151Leu missense ALG12 1 83198 1.20195E-5 41599 0 NA
22-50297525-T-C p.Gln149Arg missense+splice_region ALG12 9 83212 1.08157E-4 41606 0 6.37349E-5
22-50297526-G-C p.Gln149Glu missense+splice_region ALG12 13 83210 1.56231E-4 41605 0 5.77624E-5
22-50297528-C-G c.444-1G>C splice_acceptor ALG12 7 83210 8.41245E-5 41605 0 5.09814E-4
22-50297537-G-A p.Val472Val synonymous ALG12 1 83204 1.20187E-5 41602 0 8.24715E-6
22-50297539-C-T p.Val472Ile missense ALG12 7 83196 8.41387E-5 41598 0 5.03525E-4
22-50297540-G-A p.Asn471Asn synonymous ALG12 5 83208 6.00904E-5 41604 0 9.56145E-5
22-50297549-G-A p.Pro468Pro synonymous ALG12 2 83210 2.40356E-5 41605 0 8.24498E-6
22-50297564-G-T p.Asn463Lys missense ALG12 1 83204 1.20187E-5 41602 0 8.24416E-6
22-50297577-C-T p.Gly459Asp missense ALG12 4 83188 4.80839E-5 41594 0 0.00151057
22-50297590-C-T p.Val455Met missense ALG12 1 83156 1.20256E-5 41578 0 7.16549E-5
22-50297591-G-A p.Val454Val synonymous ALG12 42 83150 5.05111E-4 41575 0 0.00125
22-50297593-C-T p.Val454Ile missense ALG12 4 83148 4.8107E-5 41574 0 9.56694E-5
22-50297599-C-T p.Ala452Thr missense ALG12 1 83110 1.20322E-5 41555 0 NA
22-50297600-CA-C p.Leu451fs frameshift ALG12 1 83114 1.20317E-5 41557 0 NA
22-50297607-C-T p.Arg449Gln missense ALG12 4 83088 4.81417E-5 41544 0 6.37796E-5
22-50297608-G-A p.Arg449Trp missense ALG12 20 83102 2.40668E-4 41551 0 4.78347E-4
22-50297614-T-C p.Thr447Ala missense ALG12 1 83118 1.20311E-5 41559 0 3.18878E-5
22-50297618-C-T p.Arg445Arg synonymous ALG12 2 83112 2.40639E-5 41556 0 8.24987E-6
22-50297622-T-C p.Tyr444Cys missense ALG12 8 83100 9.62696E-5 41550 0 9.56694E-5
22-50297623-A-G p.Tyr444His missense ALG12 2 83102 2.40668E-5 41551 0 3.98387E-6
22-50297645-C-T p.Ala436Ala synonymous ALG12 3 83042 3.61263E-5 41521 0 1.65052E-5
22-50297650-C-T p.Glu435Lys missense ALG12 1 83028 1.20441E-5 41514 0 3.98711E-6
22-50297652-A-G p.Met434Thr missense ALG12 1 83038 1.20427E-5 41519 0 NA
22-50297653-T-C p.Met434Val missense ALG12 1 83028 1.20441E-5 41514 0 8.25464E-6
22-50297654-G-A p.Leu433Leu synonymous ALG12 34 83024 4.0952E-4 41512 0 6.37796E-4
22-50297679-C-A p.Gly425Val missense ALG12 2 83032 2.40871E-5 41516 0 NA
22-50297681-T-A p.Thr424Thr synonymous ALG12 1 83016 1.20459E-5 41508 0 NA
22-50297681-T-C p.Thr424Thr synonymous ALG12 2 83016 2.40917E-5 41508 0 3.30589E-5
22-50297687-C-T p.Pro422Pro synonymous ALG12 2 83000 2.40964E-5 41500 0 1.65347E-5
22-50297705-CTT-C p.Lys416fs frameshift ALG12 5 83008 6.02352E-5 41504 0 3.18878E-5
22-50297709-T-C p.Asp415Gly missense ALG12 5 82970 6.02627E-5 41485 0 5.58151E-5
22-50297710-C-T p.Asp415Asn missense ALG12 4 82954 4.82195E-5 41477 0 3.18979E-5
22-50297714-C-G p.Arg413Ser missense+splice_region ALG12 6 82974 7.23118E-5 41487 0 1.59418E-4
22-50297715-C-G c.1239-1G>C splice_acceptor ALG12 1 82964 1.20534E-5 41482 0 NA
22-50297722-A-G c.1239-8T>C splice_region ALG12 1 82948 1.20557E-5 41474 0 6.63009E-5
22-50297834-C-T p.Ala411Thr missense ALG12 1 83258 1.20109E-5 41629 0 5.03525E-4
22-50297835-G-A p.Ser410Ser synonymous ALG12 2 83254 2.40229E-5 41627 0 3.18756E-5
22-50297841-G-T p.Val408Val synonymous ALG12 1 83264 1.201E-5 41632 0 NA
22-50297849-G-C p.Leu406Val missense ALG12 1 83260 1.20106E-5 41630 0 6.25E-4
22-50297850-A-G p.Phe405Phe synonymous ALG12 1 83268 1.20094E-5 41634 0 NA
22-50297852-A-G p.Phe405Leu missense ALG12 1 83260 1.20106E-5 41630 0 8.25096E-6
22-50297852-A-T p.Phe405Ile missense ALG12 1 83260 1.20106E-5 41630 0 NA
22-50297854-C-T p.Arg404Gln missense ALG12 3 83270 3.60274E-5 41635 0 3.18634E-5
22-50297854-C-A p.Arg404Leu missense ALG12 2 83270 2.40183E-5 41635 0 3.97791E-6
22-50297855-G-A p.Arg404Trp missense ALG12 1 83264 1.201E-5 41632 0 2.47517E-5
22-50297872-G-A p.Ala398Val missense ALG12 1 83268 1.20094E-5 41634 0 3.97864E-6
22-50297873-C-T p.Ala398Thr missense ALG12 2 83252 2.40234E-5 41626 0 3.18735E-5
22-50297874-G-A p.Ala397Ala synonymous ALG12 1 83256 1.20111E-5 41628 0 3.18796E-5
22-50297882-C-T p.Val395Met missense ALG12 2 83280 2.40154E-5 41640 1 3.30093E-5
22-50297882-C-G p.Val395Leu missense ALG12 2 83280 2.40154E-5 41640 0 NA
22-50297888-T-C p.Ile393Val missense ALG12 8662 83172 0.104146 41586 514 0.112151
22-50297900-C-T p.Val389Ile missense+splice_region ALG12 4 83266 4.80388E-5 41633 0 6.37511E-5
22-50297901-G-A p.Arg191Cys missense+splice_region ALG12 4 83256 4.80446E-5 41628 0 5.03525E-4
22-50297902-TCTAGGAAAACCAGGCCTGCCGTCAGAGCCCAGCCCTGCAGTCGGAGCCACAGCAGTCCCCAGGCAGTGCCCCCAGCACCCAC-T c.1162+1_1163-1delGTGGGTGCTGGGGGCACTGCCTGGGGACTGCTGTGGCTCCGACTGCAGGGCTGGGCTCTGACGGCAGGCCTGGTTTTCCTAG splice_acceptor ALG12 8 83252 9.60938E-5 41626 0 NA
22-50297908-A-T c.1163-6T>A splice_region ALG12 1 83252 1.20117E-5 41626 0 NA
22-50297989-C-G p.Gln386His missense ALG12 19 83132 2.28552E-4 41566 0 1.2747E-4
22-50297990-T-TG p.Gln386fs frameshift ALG12 3 83106 3.60985E-5 41553 0 6.64905E-4
22-50297991-G-C p.Gln386Glu missense ALG12 1 83154 1.20259E-5 41577 0 3.18857E-5
22-50297992-G-A p.Pro188Ser missense ALG12 101 83154 0.00121461 41577 0 0.00277264
22-50297993-G-T p.Pro385His missense ALG12 1 83148 1.20267E-5 41574 0 8.27732E-6
22-50297995-G-C p.Pro187Ala missense ALG12 22 83140 2.64614E-4 41570 0 1.31363E-4
22-50298003-G-A p.Ala184Val missense ALG12 1 83210 1.20178E-5 41605 0 3.18674E-5
22-50298006-G-C p.Gln381Glu missense ALG12 6 83232 7.20877E-5 41616 0 0.00125
22-50298014-C-T p.Arg378Lys missense ALG12 4 83268 4.80377E-5 41634 0 1.98926E-5
22-50298018-G-A p.Gln377* stop_gained ALG12 1 83282 1.20074E-5 41641 0 NA
22-50298018-G-C p.Gln377Glu missense ALG12 1 83282 1.20074E-5 41641 0 2.47991E-5
22-50298024-C-T p.Ala375Thr missense ALG12 1 83278 1.2008E-5 41639 0 7.95703E-6
22-50298025-G-A p.Arg177Cys missense ALG12 2 83284 2.40142E-5 41642 0 1.59138E-5
22-50298027-C-T p.Val374Ile missense ALG12 1 83280 1.20077E-5 41640 0 1.1935E-5
22-50298028-G-A p.Arg176Cys missense ALG12 3 83290 3.60187E-5 41645 0 4.13073E-5
22-50298036-GGTA-G p.Tyr370del conservative_inframe_deletion ALG12 2 83318 2.40044E-5 41659 0 NA
22-50298058-C-T p.Leu363Leu synonymous ALG12 1 83346 1.19982E-5 41673 0 1.65158E-5
22-50298064-C-T p.Thr361Thr synonymous ALG12 1 83332 1.20002E-5 41666 0 1.19328E-5
22-50298065-G-A p.Thr361Met missense ALG12 9 83346 1.07984E-4 41673 0 0.00125
22-50298070-T-A p.Ser359Ser synonymous ALG12 1 83356 1.19967E-5 41678 0 NA
22-50298078-C-T p.Ala357Thr missense ALG12 1 83346 1.19982E-5 41673 0 1.65188E-5
22-50298079-G-A p.Ala356Ala synonymous ALG12 9 83342 1.07989E-4 41671 0 1.91229E-4
22-50298090-C-T p.Val353Met missense ALG12 8 83328 9.60061E-5 41664 0 1.91266E-4
22-50298099-C-T p.Gly350Arg missense ALG12 1 83320 1.20019E-5 41660 0 2.47987E-5
22-50298100-G-C p.Ile349Met missense ALG12 17 83320 2.04033E-4 41660 0 0.001875
22-50298100-G-A p.Ile349Ile synonymous ALG12 5 83320 6.00096E-5 41660 0 3.18674E-5
22-50298104-A-C p.Val348Gly missense ALG12 1 83322 1.20016E-5 41661 0 8.26856E-6
22-50298117-C-A p.Gly344Trp missense ALG12 1 83306 1.20039E-5 41653 0 NA
22-50298117-C-T p.Gly344Arg missense ALG12 1 83306 1.20039E-5 41653 0 NA
22-50298118-C-T p.Ala343Ala synonymous ALG12 1939 83246 0.0232924 41623 19 0.0325234
22-50298118-C-G p.Ala343Ala synonymous ALG12 1 83304 1.20042E-5 41652 0 NA
22-50298119-G-A p.Ala343Val missense ALG12 3 83294 3.6017E-5 41647 0 3.31203E-5
22-50298123-T-G p.Lys342Gln missense ALG12 2 83296 2.40108E-5 41648 0 2.38728E-5
22-50298124-G-A p.Tyr341Tyr synonymous ALG12 1 83290 1.20062E-5 41645 0 3.18674E-5
22-50298145-GT-G p.Asn334fs frameshift ALG12 5 83214 6.0086E-5 41607 0 5.17635E-5
22-50298149-T-C p.Asn333Ser missense ALG12 2 83178 2.40448E-5 41589 0 8.34098E-6
22-50298151-C-G p.Leu332Leu synonymous ALG12 1 83138 1.20282E-5 41569 0 3.98368E-6
22-50301375-G-A p.Ser329Phe missense ALG12 3 82752 3.62529E-5 41376 0 NA
22-50301380-G-A p.Gly327Gly synonymous ALG12 6 82824 7.24428E-5 41412 0 2.49713E-5
22-50301384-C-T p.Arg326Lys missense ALG12 1 82856 1.20691E-5 41428 0 3.98083E-6
22-50301392-C-T p.Thr323Thr synonymous ALG12 4 82926 4.82358E-5 41463 0 4.14099E-5
22-50301393-G-A p.Thr323Met missense ALG12 1 82924 1.20592E-5 41462 0 1.98997E-5
22-50301395-G-A p.Ile322Ile synonymous ALG12 2 82970 2.41051E-5 41485 0 5.04032E-4
22-50301406-T-C p.Met319Val missense ALG12 1 83010 1.20467E-5 41505 0 3.18634E-5
22-50301407-G-C p.Pro318Pro synonymous ALG12 2 83020 2.40906E-5 41510 0 NA
22-50301407-G-A p.Pro318Pro synonymous ALG12 2 83020 2.40906E-5 41510 0 NA
22-50301409-G-A p.Pro318Ser missense ALG12 1 83002 1.20479E-5 41501 0 NA
22-50301410-G-A p.Phe317Phe synonymous ALG12 1 83004 1.20476E-5 41502 0 1.19362E-5
22-50301413-G-C p.Ala316Ala synonymous ALG12 1 83018 1.20456E-5 41509 0 1.1936E-5
22-50301422-G-A p.Ile313Ile synonymous ALG12 274 82992 0.00330152 41496 8 0.00891606
22-50301428-G-A p.Arg311Arg synonymous ALG12 3 83004 3.61428E-5 41502 0 3.18532E-5
22-50301430-G-A p.Arg311Cys missense ALG12 3 83000 3.61446E-5 41500 0 5.04541E-4
22-50301443-T-G p.Pro306Pro synonymous ALG12 2 82972 2.41045E-5 41486 0 1.65145E-5
22-50301449-G-A p.Leu304Leu synonymous ALG12 1 82922 1.20595E-5 41461 0 6.37186E-5
22-50301451-G-A p.Leu304Phe missense ALG12 4 82906 4.82474E-5 41453 0 3.18552E-5
22-50301472-C-T p.Gly297Ser missense ALG12 3 82722 3.6266E-5 41361 0 6.37227E-5
22-50301476-T-C p.Ala295Ala synonymous ALG12 23554 82012 0.287202 41006 4446 0.353831
22-50301486-G-A p.Thr292Met missense ALG12 2 82568 2.42225E-5 41284 0 3.30464E-5
22-50301488-C-T p.Pro291Pro synonymous ALG12 2 82514 2.42383E-5 41257 0 0.00125
22-50301491-C-T p.Ala290Ala synonymous ALG12 2 82432 2.42624E-5 41216 0 2.47868E-5
22-50301492-G-A p.Ala290Val missense ALG12 17 82412 2.06281E-4 41206 0 0.00655242
22-50301494-G-A p.His289His synonymous ALG12 34 82402 4.12611E-4 41201 1 0.00151362
22-50301497-C-A p.Thr288Thr synonymous ALG12 7 82356 8.49968E-5 41178 0 1.65267E-5
22-50301497-C-T p.Thr288Thr synonymous ALG12 1 82356 1.21424E-5 41178 0 1.65267E-5
22-50301498-G-A p.Thr288Met missense ALG12 4 82318 4.8592E-5 41159 0 1.65287E-5
22-50301504-C-T p.Arg286Lys missense ALG12 1 82332 1.21459E-5 41166 0 NA
22-50301520-G-T p.Leu281Met missense ALG12 1 82100 1.21803E-5 41050 0 0.00100908
22-50301520-G-C p.Leu281Val missense ALG12 1 82100 1.21803E-5 41050 0 2.48053E-5
22-50301530-G-C p.Leu277Leu synonymous ALG12 1 82042 1.21889E-5 41021 0 NA
22-50301534-A-G p.Leu276Pro missense ALG12 1 81968 1.21999E-5 40984 0 6.37267E-5
22-50301539-G-A p.Cys274Cys synonymous ALG12 1 81860 1.2216E-5 40930 0 3.31472E-5
22-50301540-C-T p.Cys274Tyr missense ALG12 2 81834 2.44397E-5 40917 0 NA
22-50301545-C-G p.Leu272Leu synonymous ALG12 2 81750 2.44648E-5 40875 0 NA
22-50301550-C-T p.Gly271Ser missense ALG12 3 81558 3.67836E-5 40779 0 5.99286E-5
22-50301551-G-A p.Arg270Arg synonymous ALG12 1 81566 1.226E-5 40783 0 3.18634E-5
22-50301552-C-T p.Arg270His missense ALG12 5 81464 6.13768E-5 40732 0 1.19904E-4
22-50301555-G-A p.Pro269Leu missense ALG12 1 81466 1.22751E-5 40733 0 8.31656E-6
22-50301557-C-T p.Leu268Leu synonymous ALG12 1 81410 1.22835E-5 40705 0 7.99501E-6
22-50301567-T-TAGA p.Phe264dup conservative_inframe_insertion ALG12 2 81148 2.46463E-5 40574 0 8.00724E-6
22-50301584-C-T p.Pro259Pro synonymous ALG12 2 80374 2.48837E-5 40187 0 9.55657E-5
22-50301585-G-A p.Pro259Leu missense ALG12 4 80328 4.97958E-5 40164 0 3.18532E-5
22-50301587-G-C p.Ser258Ser synonymous ALG12 1 80328 1.2449E-5 40164 0 NA
22-50301591-G-A p.Thr257Ile missense+splice_region ALG12 1 80120 1.24813E-5 40060 0 8.46984E-6
22-50302891-C-T c.768+1G>A splice_donor ALG12 3 83172 3.60698E-5 41586 0 1.59123E-5
22-50302894-C-G p.Gly256Arg missense+splice_region ALG12 1 83184 1.20215E-5 41592 0 NA
22-50302898-G-T p.Asn254Lys missense ALG12 10 83226 1.20155E-4 41613 0 9.55475E-5
22-50302898-G-C p.Asn254Lys missense ALG12 1 83226 1.20155E-5 41613 0 NA
22-50302919-A-T p.Thr247Thr synonymous ALG12 1 83336 1.19996E-5 41668 0 8.23873E-6
22-50302920-G-C p.Thr247Ser missense ALG12 1 83336 1.19996E-5 41668 0 3.97646E-6
22-50302924-T-G p.Asn246His missense ALG12 7 83352 8.39812E-5 41676 0 1.19293E-5
22-50302941-C-T p.Gly240Glu missense ALG12 1 83354 1.1997E-5 41677 0 3.97652E-6
22-50302946-C-T p.Pro238Pro synonymous ALG12 7 83356 8.39772E-5 41678 0 3.18512E-5
22-50302960-G-C p.Gln234Glu missense ALG12 4 83346 4.79927E-5 41673 0 3.18735E-5
22-50302962-C-T p.Arg233Gln missense ALG12 195 83328 0.00234015 41664 5 0.00484601
22-50302963-G-A p.Arg233Trp missense ALG12 1 83342 1.19988E-5 41671 0 7.95317E-6
22-50302971-T-TA p.Tyr230fs frameshift ALG12 1 83338 1.19993E-5 41669 0 3.97665E-6
22-50302971-TAA-T p.Tyr230fs frameshift ALG12 1 83338 1.19993E-5 41669 0 8.24185E-6
22-50302980-A-G p.Val227Ala missense ALG12 1 83316 1.20025E-5 41658 0 3.97703E-6
22-50302988-C-T p.Thr224Thr synonymous ALG12 3 83240 3.60404E-5 41620 0 8.25723E-6
22-50302989-G-A p.Thr224Met missense ALG12 1 83244 1.20129E-5 41622 0 1.98893E-5
22-50302992-A-C p.Leu223Arg missense ALG12 1 83224 1.20158E-5 41612 0 NA
22-50302995-C-G p.Gly222Ala missense+splice_region ALG12 29 83196 3.48574E-4 41598 0 8.60092E-4
22-50303000-CAAAAT-C c.665-10_665-6delATTTT splice_region ALG12 1 83078 1.20369E-5 41539 0 8.33834E-6
22-50303544-A-G p.Leu221Ser missense+splice_region ALG12 1 82570 1.21109E-5 41285 0 NA
22-50303554-T-C p.Ile218Val missense ALG12 20 82526 2.42348E-4 41263 0 3.50296E-4
22-50303561-C-T p.Pro215Pro synonymous ALG12 226 82566 0.0027372 41283 4 0.00547771
22-50303566-C-A p.Val214Phe missense ALG12 2 82564 2.42236E-5 41282 0 NA
22-50303567-G-A p.Ala213Ala synonymous ALG12 2 82570 2.42219E-5 41285 0 1.47316E-4
22-50303568-G-A p.Ala213Val missense ALG12 1 82574 1.21103E-5 41287 0 6.25E-4
22-50303570-G-A p.His212His synonymous ALG12 3 82568 3.63337E-5 41284 0 3.1839E-5
22-50303571-T-C p.His212Arg missense ALG12 1 82564 1.21118E-5 41282 0 NA
22-50303575-G-A p.Arg211Cys missense ALG12 488 82564 0.00591057 41282 3 0.011875
22-50303584-T-A p.Arg208* stop_gained ALG12 2 82582 2.42184E-5 41291 0 NA
22-50303589-A-T p.Val206Glu missense ALG12 2 82570 2.42219E-5 41285 0 3.58531E-5
22-50303590-C-T p.Val206Ile missense ALG12 1 82568 1.21112E-5 41284 0 0.00125
22-50303592-G-A p.Ser205Phe missense ALG12 1 82570 1.21109E-5 41285 0 2.49389E-5
22-50303596-C-G p.Val204Leu missense ALG12 1 82564 1.21118E-5 41282 0 1.66367E-5
22-50303596-C-T p.Val204Ile missense ALG12 2 82564 2.42236E-5 41282 0 NA
22-50303601-C-T p.Arg202Gln missense ALG12 1 82558 1.21127E-5 41279 0 2.49788E-5
22-50303602-G-A p.Arg202* stop_gained ALG12 2 82540 2.42307E-5 41270 0 6.36943E-5
22-50303611-A-G p.Leu199Leu synonymous ALG12 3 82516 3.63566E-5 41258 0 6.67668E-5
22-50303614-CCAG-C p.Leu197del conservative_inframe_deletion ALG12 1 82500 1.21212E-5 41250 0 1.09044E-4
22-50303618-C-T p.Leu196Leu synonymous ALG12 1 82468 1.21259E-5 41234 0 2.51982E-5
22-50303627-G-A p.Leu193Leu synonymous ALG12 2 82438 2.42607E-5 41219 0 NA
22-50303628-A-C p.Leu193Arg missense ALG12 1 82436 1.21306E-5 41218 0 3.18431E-5
22-50303643-C-T p.Cys188Tyr missense ALG12 8 82316 9.71865E-5 41158 0 0.0025
22-50303653-C-G p.Val185Leu missense ALG12 1 82218 1.21628E-5 41109 0 NA
22-50303655-C-T p.Arg184Lys missense ALG12 2 82234 2.43208E-5 41117 0 NA
22-50303656-T-C p.Arg184Gly missense ALG12 2 82230 2.4322E-5 41115 0 4.0016E-6
22-50303662-C-T p.Val182Met missense ALG12 1 82168 1.21702E-5 41084 0 8.70004E-6
22-50303663-G-A p.Ile181Ile synonymous ALG12 1 82158 1.21717E-5 41079 0 NA
22-50303669-G-A p.Ala179Ala synonymous ALG12 2 82088 2.43641E-5 41044 0 3.18431E-5
22-50303671-C-T p.Ala179Thr missense ALG12 2 81982 2.43956E-5 40991 0 5.04032E-4
22-50303672-G-A p.Phe178Phe synonymous ALG12 3 81964 3.66014E-5 40982 0 9.55475E-5
22-50303673-A-G p.Phe178Ser missense ALG12 3 81956 3.6605E-5 40978 0 NA
22-50303677-C-T p.Ala177Thr missense ALG12 1 81850 1.22175E-5 40925 0 NA
22-50303690-G-C p.Phe172Leu missense ALG12 1 81582 1.22576E-5 40791 0 3.18532E-5
22-50303690-G-A p.Phe172Phe synonymous ALG12 1 81582 1.22576E-5 40791 0 NA
22-50303694-C-T p.Arg171His missense ALG12 3 81424 3.68442E-5 40712 0 3.18674E-5
22-50303698-C-T p.Ala170Thr missense ALG12 1 81270 1.23047E-5 40635 0 1.22131E-5
22-50303704-C-T p.Glu168Lys missense ALG12 4 81078 4.93352E-5 40539 0 5.3148E-5
22-50303705-G-A p.His167His synonymous ALG12 78 81030 9.62606E-4 40515 1 0.00191131
22-50303705-G-C p.His167Gln missense ALG12 1 81032 1.23408E-5 40516 0 NA
22-50303709-C-T p.Arg166Gln missense ALG12 1 80870 1.23655E-5 40435 0 5.46496E-5
22-50303712-A-G p.Leu165Pro missense ALG12 1 80834 1.2371E-5 40417 0 NA
22-50303718-G-GC p.Ala163fs frameshift ALG12 1 80714 1.23894E-5 40357 0 1.22267E-5
22-50303720-C-T p.Ala162Ala synonymous ALG12 1 80606 1.2406E-5 40303 0 1.22892E-5
22-50303721-G-A p.Ala162Val missense ALG12 1 80464 1.24279E-5 40232 0 1.27333E-5
22-50303722-C-CTGCT p.Ala162fs frameshift ALG12 1 80406 1.24369E-5 40203 0 1.27395E-5
22-50303725-GG-CA p.AlaLeu160AlaVal missense ALG12 1 80420 1.24347E-5 40210 0 NA
22-50303731-GC-G p.Leu159fs frameshift ALG12 1 80000 1.25E-5 40000 0 1.38939E-5
22-50303733-A-ATGAAGC p.Met1delinsArgPheMet start_lost ALG12 1 79960 1.25063E-5 39980 0 1.41159E-5
22-50303735-G-GCCC p.Val157_Leu158insGly disruptive_inframe_insertion ALG12 1 79870 1.25203E-5 39935 0 1.4367E-5
22-50303737-C-CTTGTCGTGCCG c.470-2_470-1insCGGCACGACAA splice_acceptor ALG12 1 79774 1.25354E-5 39887 0 1.45421E-5
22-50303739-G-A c.470-3C>T splice_region ALG12 1 79620 1.25597E-5 39810 0 1.56421E-5
22-50303739-G-GC c.470-4_470-3insG splice_region ALG12 1 79620 1.25597E-5 39810 0 NA
22-50304077-C-T c.469+5G>A splice_region ALG12 17 81440 2.08743E-4 40720 0 5.41608E-4
22-50304078-G-A c.469+4C>T splice_region ALG12 5 81500 6.13497E-5 40750 0 2.80728E-5
22-50304086-A-G p.Pro155Pro synonymous ALG12 4 81914 4.88317E-5 40957 0 3.79716E-4
22-50304089-C-A p.Leu154Leu synonymous ALG12 2 81980 2.43962E-5 40990 0 3.18532E-5
22-50304089-C-G p.Leu154Leu synonymous ALG12 2 81980 2.43962E-5 40990 0 4.00125E-6
22-50304102-T-C p.Asn150Ser missense ALG12 4 82304 4.86003E-5 41152 0 NA
22-50304113-C-T p.Arg146Arg synonymous ALG12 2 82600 2.42131E-5 41300 0 NA
22-50304114-C-T p.Arg146Gln missense ALG12 18 82626 2.17849E-4 41313 0 1.49676E-4
22-50304115-G-A p.Arg146Trp missense ALG12 6 82628 7.26146E-5 41314 0 6.37146E-5
22-50304116-C-T p.Thr145Thr synonymous ALG12 1 82674 1.20957E-5 41337 0 3.32094E-5
22-50304117-G-A p.Thr145Met missense ALG12 1 82730 1.20875E-5 41365 0 6.36983E-5
22-50304133-G-A p.Leu140Leu synonymous ALG12 1 82976 1.20517E-5 41488 0 NA
22-50304138-A-T p.Phe138Tyr missense ALG12 1 82996 1.20488E-5 41498 0 1.65276E-5
22-50304140-C-T p.Gln137Gln synonymous ALG12 1 83020 1.20453E-5 41510 0 7.95678E-6
22-50304145-T-C p.Met136Val missense ALG12 5 83072 6.01888E-5 41536 0 2.56042E-4
22-50304148-C-T p.Ala135Thr missense ALG12 1 83064 1.20389E-5 41532 0 9.55536E-5
22-50304149-C-T p.Thr134Thr synonymous ALG12 4 83070 4.81522E-5 41535 0 9.55475E-5
22-50304159-C-T p.Cys131Tyr missense ALG12 2 83120 2.40616E-5 41560 0 NA
22-50304166-T-C p.Met129Val missense ALG12 3 83130 3.60881E-5 41565 0 6.76143E-5
22-50304167-G-A p.Thr128Thr synonymous ALG12 1 83132 1.20291E-5 41566 0 3.1841E-5
22-50304173-C-T p.Val126Val synonymous ALG12 2 83120 2.40616E-5 41560 0 NA
22-50304184-C-T p.Gly123Arg missense ALG12 2 83134 2.40575E-5 41567 0 NA
22-50304190-G-A p.His121Tyr missense ALG12 1 83146 1.2027E-5 41573 0 1.64924E-5
22-50304192-C-T p.Arg120Gln missense ALG12 198 83158 0.00238101 41579 0 0.009375
22-50304193-G-A p.Arg120Trp missense ALG12 8 83160 9.62001E-5 41580 0 1.03398E-4
22-50304194-T-C p.Arg119Arg synonymous ALG12 1 83166 1.20241E-5 41583 0 3.18695E-5
22-50304202-C-G p.Glu117Gln missense ALG12 2 83176 2.40454E-5 41588 0 NA
22-50304212-C-T p.Thr113Thr synonymous ALG12 2 83154 2.40518E-5 41577 0 4.12262E-5
22-50304220-G-A p.Leu111Phe missense ALG12 1 83132 1.20291E-5 41566 0 3.18492E-5
22-50304232-C-T p.Val107Met missense ALG12 29 83084 3.49044E-4 41542 0 5.03525E-4
22-50304238-G-A p.Leu105Phe missense ALG12 1 83050 1.20409E-5 41525 0 3.97706E-6
22-50304240-C-T p.Gly104Glu missense ALG12 1 83038 1.20427E-5 41519 0 NA
22-50304248-T-C p.Gly101Gly synonymous ALG12 1 82990 1.20496E-5 41495 0 NA
22-50304250-C-T p.Gly101Arg missense ALG12 2 82992 2.40987E-5 41496 0 8.24797E-6
22-50304255-A-G p.Val99Ala missense+splice_region ALG12 1 82892 1.20639E-5 41446 0 NA
22-50304261-CAA-C c.296-8_296-7delTT splice_region ALG12 1 82844 1.20709E-5 41422 0 4.12494E-5
22-50307027-C-T c.295+6G>A splice_region ALG12 2 83082 2.40726E-5 41541 0 6.3678E-5
22-50307032-C-T c.295+1G>A splice_donor ALG12 7 83108 8.42278E-5 41554 0 9.5511E-5
22-50307044-G-C p.Ser95Cys missense ALG12 1 83124 1.20302E-5 41562 0 NA
22-50307048-A-G p.Tyr94His missense ALG12 1 83134 1.20288E-5 41567 0 3.97962E-6
22-50307056-G-A p.Ser91Phe missense ALG12 1 83164 1.20244E-5 41582 0 3.97953E-6
22-50307070-C-T p.Ser86Ser synonymous ALG12 2 83164 2.40489E-5 41582 0 8.2526E-6
22-50307071-G-A p.Ser86Leu missense ALG12 1 83168 1.20239E-5 41584 0 1.59169E-5
22-50307079-G-A p.Tyr83Tyr synonymous ALG12 1 83198 1.20195E-5 41599 0 8.25341E-6
22-50307085-C-T p.Ala81Ala synonymous ALG12 10 83204 1.20187E-4 41602 0 5.03525E-4
22-50307086-G-A p.Ala81Val missense ALG12 12 83206 1.4422E-4 41603 0 0.00100705
22-50307087-C-T p.Ala81Thr missense ALG12 10 83206 1.20184E-4 41603 0 9.5511E-5
22-50307088-G-A p.Pro80Pro synonymous ALG12 1 83214 1.20172E-5 41607 0 1.2734E-4
22-50307105-C-T p.Ala75Thr missense ALG12 2 83242 2.40263E-5 41621 0 7.4293E-5
22-50307106-G-T p.Ile74Ile synonymous ALG12 3 83240 3.60404E-5 41620 0 NA
22-50307113-A-C p.Val72Gly missense ALG12 1 83236 1.2014E-5 41618 0 NA
22-50307114-C-G p.Val72Leu missense ALG12 2 83232 2.40292E-5 41616 0 NA
22-50307120-C-T p.Gly70Arg missense ALG12 1 83218 1.20166E-5 41609 0 3.97991E-6
22-50307132-T-C p.Arg66Gly missense ALG12 1 83214 1.20172E-5 41607 0 NA
22-50307136-G-A p.Val64Val synonymous ALG12 2 83208 2.40361E-5 41604 0 NA
22-50307136-G-T p.Val64Val synonymous ALG12 1 83208 1.20181E-5 41604 0 8.25505E-6
22-50307137-A-G p.Val64Ala missense ALG12 1 83204 1.20187E-5 41602 0 NA
22-50307138-C-T p.Val64Ile missense ALG12 1 83190 1.20207E-5 41595 0 3.1841E-5
22-50307139-G-A p.Val63Val synonymous ALG12 13 83186 1.56276E-4 41593 0 5.03525E-4
22-50307145-G-A p.Pro61Pro synonymous ALG12 8 83204 9.61492E-5 41602 0 3.18431E-5
22-50307145-G-C p.Pro61Pro synonymous ALG12 1 83204 1.20187E-5 41602 0 NA
22-50307148-G-A p.Phe60Phe synonymous ALG12 1 83192 1.20204E-5 41596 0 6.25E-4
22-50307151-C-T p.Glu59Glu synonymous ALG12 1 83196 1.20198E-5 41598 0 8.25559E-6
22-50307162-C-T p.Asp56Asn missense ALG12 4 83190 4.80827E-5 41595 0 9.90867E-5
22-50307163-G-A p.Tyr55Tyr splice_region+synonymous ALG12 3 83188 3.60629E-5 41594 0 2.47696E-5
22-50307165-ACTGCGAGGAGAAGGGCAGGTCAGTGCACCGGGGCCCTGCCAGCTGGTAACATGAGGTTTTCCCCAAAGACAGCAGGGGCCCCTCAC-A c.162+1_163-1delGTGAGGGGCCCCTGCTGTCTTTGGGGAAAACCTCATGTTACCAGCTGGCAGGGCCCCGGTGCACTGACCTGCCCTTCTCCTCGCAG splice_acceptor ALG12 11 83180 1.32243E-4 41590 4 NA
22-50307169-C-T c.163-4G>A splice_region ALG12 5 83168 6.01193E-5 41584 0 4.77684E-5
22-50307170-G-A c.163-5C>T splice_region ALG12 5 83168 6.01193E-5 41584 0 6.36862E-5
22-50307173-G-A c.163-8C>T splice_region ALG12 1 83166 1.20241E-5 41583 0 NA
22-50307255-C-T p.Glu53Glu synonymous ALG12 1 83174 1.2023E-5 41587 0 NA
22-50307273-G-A p.Tyr47Tyr synonymous ALG12 2 83230 2.40298E-5 41615 0 8.25559E-6
22-50307279-C-T p.Leu45Leu synonymous ALG12 2 83232 2.40292E-5 41616 0 3.97836E-6
22-50307281-G-A p.Leu45Leu synonymous ALG12 2 83234 2.40286E-5 41617 0 NA
22-50307282-G-A p.Asp44Asp synonymous ALG12 2 83232 2.40292E-5 41616 0 3.30213E-5
22-50307286-T-C p.His43Arg missense ALG12 1 83238 1.20137E-5 41619 0 NA
22-50307287-G-C p.His43Asp missense ALG12 1 83246 1.20126E-5 41623 0 NA
22-50307297-C-T p.Leu39Leu synonymous ALG12 2 83240 2.40269E-5 41620 0 NA
22-50307314-C-G p.Glu34Gln missense ALG12 1 83252 1.20117E-5 41626 0 NA
22-50307315-C-T p.Val33Val synonymous ALG12 2340 83208 0.0281223 41604 62 0.0433031
22-50307338-C-T p.Val26Ile missense ALG12 1 83212 1.20175E-5 41606 0 8.25887E-6
22-50307339-C-G p.Leu25Leu synonymous ALG12 1 83204 1.20187E-5 41602 0 NA
22-50307342-G-A p.His24His synonymous ALG12 2 83198 2.4039E-5 41599 0 3.97953E-6
22-50307356-C-T p.Val20Ile missense ALG12 3 82976 3.6155E-5 41488 0 6.37024E-5
22-50307357-G-A p.Ala19Ala synonymous ALG12 4 82960 4.8216E-5 41480 0 4.19463E-5
22-50307359-C-T p.Ala19Thr missense ALG12 31 82964 3.73656E-4 41482 0 6.25E-4
22-50307366-C-G p.Leu16Leu synonymous ALG12 148 82976 0.00178365 41488 3 0.00755287
22-50307369-C-G p.Gly15Gly synonymous ALG12 1 83060 1.20395E-5 41530 0 3.99096E-6
22-50307370-C-T p.Gly15Glu missense ALG12 1 83048 1.20412E-5 41524 0 1.66503E-5
22-50307378-C-G p.Leu12Leu synonymous ALG12 2 83042 2.40842E-5 41521 0 3.18451E-5
22-50307380-G-GGGGCCGCCTGCCT p.Leu12fs frameshift ALG12 1 83070 1.2038E-5 41535 0 NA
22-50307385-C-T p.Arg10Gln missense ALG12 6 83014 7.2277E-5 41507 0 4.15538E-5
22-50307386-G-A p.Arg10Trp missense ALG12 13 82978 1.56668E-4 41489 0 3.50497E-4
22-50307393-T-C p.Ser7Ser synonymous ALG12 1 82996 1.20488E-5 41498 0 8.29917E-6
22-50307407-C-T p.Gly3Arg missense ALG12 1 82820 1.20744E-5 41410 0 NA
22-50307433-G-A c.-20C>T 5_prime_UTR_premature_start_codon_gain ALG12 6 81670 7.34664E-5 40835 0 6.37105E-5
22-50307462-C-T c.-49G>A 5_prime_UTR_premature_start_codon_gain ALG12 1 79248 1.26186E-5 39624 0 5.25928E-5
22-50307463-C-A c.-50G>T 5_prime_UTR_premature_start_codon_gain ALG12 4 79228 5.04872E-5 39614 0 NA
22-50307468-G-A c.-55C>T 5_prime_UTR_premature_start_codon_gain ALG12 3 78446 3.82429E-5 39223 0 3.1841E-5
22-50307486-C-T c.-73G>A 5_prime_UTR_premature_start_codon_gain ALG12 5 75156 6.65283E-5 37578 0 3.1835E-5
22-50307489-A-G c.-76T>C splice_region ALG12 7 74164 9.43854E-5 37082 0 6.36902E-5
22-50307490-T-C c.-77A>G splice_region ALG12 1 74004 1.35128E-5 37002 0 NA
22-50307490-T-G c.-77A>C 5_prime_UTR_premature_start_codon_gain ALG12 1 74004 1.35128E-5 37002 0 NA